Coexistence of Three Divergent mtDNA Lineages in Northeast Asia Provides New Insights into Phylogeography of Goldfish (Carssius auratus)
2
Citation
27
Reference
10
Related Paper
Citation Trend
Abstract:
Goldfish (Carassius aurautus), which is a middle size cyprinid, widely distribute throughout Eurasia. Phylogeographic studies using mtDNA markers have revealed several divergent lineages within goldfish. In this study, mtDNA variations were determined to elucidate the phylogeographical pattern and genetic structure of goldfish in Northeast Asia. A total of 1054 individuals from Amur river basin were analyzed, which including five newly collected populations and four previously reported populations. Three distinct mtDNA lineages were identified in those samples, two of which corresponded to two known lineages C2 and C6, respectively. The third lineage referred to as C7, following six known lineages of goldfish in mainland Eurasia. AMOVA results suggested that most of the genetic variations were among lineages, rather than among populations or twice samplings. We noted that the control region (CR) and cytochrome b (cytb) sequences of lineage C7 have been reported in previous studies, respectively. However, the evolutionary position and distribution pattern of this lineage was not discussed in the context of the species. Our results showed that "odd" CR and "hidden" cytb sequences from Central Asia represent the same mtDNA lineage of goldfish. The known samples of C7 lineage were collected from Central Asia (Eastern Kazakhstan and Western Mongolia) to East Asia (Northeast China and Far East Russia), which suggested that it had a wider distribution, rather than limit in Central Asia.Keywords:
Lineage (genetic)
mtDNA control region
Central Asia
The masked palm civet (Paguma larvata) in Japan is considered as an alien species; however, the details on introduction routes to Japan and the expansion history are still unclear. In the present study, to further solve these questions, we analyzed the mitochondrial DNA control region (523 base-pairs) of 226 individuals from Japan and Taiwan, and identified 13 haplotypes, which are phylogenetically closely related to each other. Then, we combined the present control region data with the previously reported cytochrome b sequences, and found multiple haplotypes in Shikoku, Gunma, and Tokyo. The population in Shikoku was formed by several genetic lineages, one of which was not found in other areas, indicating the differentiation of the Shikoku population from those in Central Honshu. In addition, animals with the major cytochrome b haplotype in Eastern Japan in the previous study were found to have three different haplotypes in control region. The results strongly show multiple introduced routes of P. larvata in Eastern Japan. Our study much contributes to further understanding of the expansion history of P. larvata on the Japanese islands, in conjunction with previous genetic data.
mtDNA control region
Cite
Citations (3)
Lineage (genetic)
Cite
Citations (0)
Lineage (genetic)
Cite
Citations (0)
Abstract. Kurniawan A, Hariati AM, Kurniawan A, Kurniawan N, Nugroho TW, Bidayani E, Syarif AF, wiadnya DGR. 2022. Genetic diversity analysis and phylogeography of Osteochilus spilurus (Cyprinidae: Labeoninae) from Bangka, Belitung, and Kalimantan Islands using Cytochrome b gene. Biodiversitas 23: 4738-4746. The Sundaland fish species, Osteochilus spilurus is only utilized commercially in the Belitung Islands and has yet to be domesticated. This species can characterize freshwater fish phylogeography because have a minimum of human influence. This study aimed to analyze the genetic diversity and phylogeography of O. spilurus from the Bangka, Belitung, and Kalimantan Islands using Cytochrome b gene. Twenty fish samples were collected from the Sebangau and Kapuas Rivers in Kalimantan, the Lenggang River in Belitung Island, and the Lebak River in Bangka Island. Forward LA-cyp and reverse HA-cyp primers were used for amplification Cytochrome b gene. Mega 10.0 applications were used to construct of the phylogenetic tree. The phylogeographic analysis uses a comparative phylogenetic tree approach with geographical history. The cytochrome b gene showed variations in the nucleotides of O. spilurus from the three islands. Phylogeography of O. spilurus showed that there are two different clades with intraspecific variation according to a geographic area with bootstrap values of 99-100%. One clade contains fish samples from Bangka and Belitung islands, while the other clade comes from Kalimantan island. The formation of the Karimata Strait (between Bangka-Belitung and Kalimantan Islands) and the pattern of paleo rivers are predicted to influence the disparity.
Nucleotide diversity
Fresh water fish
Cite
Citations (8)
Subspecies
Cervus elaphus
Maximum parsimony
Cite
Citations (257)
A portion of the mitochondrial control region (494 bp) was sequenced in 106 great reed warblers sampled in six breeding populations in Europe and one wintering population in Africa. In total, 33 different haplotypes were found. There was little evidence of divergence between populations in northern and western Europe whereas the sample from Greece differed significantly from the other European breeding populations. The lowest haplotypc diversity was found near the distribution range limit in Sweden and in The Netherlands suggesting recent effects of bottlenecks/founder events in these areas. A neighbour-joining analysis of the different haplotypes placed the haplotypes into two distinctive clades, A and B. The divergence of the two clades was on average 1.29%. Accounting for the within cladc variation suggested a divergence time between these lines approximately 70 000 years BP. The frequency of the two clades changed longitudinally across Europe with the A haplotypc in the west and the B haplotypc in the east. All birds from Kenya carried the B haplotypc suggesting an origin of these birds east of Latvia/Greece. The long-term female effective population size was estimated to be 20 000 individuals, which is approximately 2% of current population size.
mtDNA control region
Population Structure
Cite
Citations (6)
Goldfish (Carassius aurautus), which is a middle size cyprinid, widely distribute throughout Eurasia. Phylogeographic studies using mtDNA markers have revealed several divergent lineages within goldfish. In this study, mtDNA variations were determined to elucidate the phylogeographical pattern and genetic structure of goldfish in Northeast Asia. A total of 1054 individuals from Amur river basin were analyzed, which including five newly collected populations and four previously reported populations. Three distinct mtDNA lineages were identified in those samples, two of which corresponded to two known lineages C2 and C6, respectively. The third lineage referred to as C7, following six known lineages of goldfish in mainland Eurasia. AMOVA results suggested that most of the genetic variations were among lineages, rather than among populations or twice samplings. We noted that the control region (CR) and cytochrome b (cytb) sequences of lineage C7 have been reported in previous studies, respectively. However, the evolutionary position and distribution pattern of this lineage was not discussed in the context of the species. Our results showed that "odd" CR and "hidden" cytb sequences from Central Asia represent the same mtDNA lineage of goldfish. The known samples of C7 lineage were collected from Central Asia (Eastern Kazakhstan and Western Mongolia) to East Asia (Northeast China and Far East Russia), which suggested that it had a wider distribution, rather than limit in Central Asia.
Lineage (genetic)
mtDNA control region
Central Asia
Cite
Citations (2)
Event Abstract Back to Event The phylogeography of coho salmon based on mtDNA control region variation: Asian populations descend from the Beringian Refugium Valeria A. Soshnina1, 2, Alexey A. Sergeev1 and Daria A. Zelenina1* 1 All-Russian Research Institute Fisheries and Oceanography, Russia 2 Lomonosov Moscow State University, Russia Coho salmon (Oncorhynchus kisutch Walbaum, 1792), one of the most valuable species among salmon fish, inhabits the northern part of the Pacific Rim and its coasts. Nowadays this species plays an important role not only in fisheries, but in the world salmon aquaculture as well, so the importance of detailed genetic studies has increased significantly. However, its genetic structure is insufficiently investigated, especially in the western part of its range. The aim of the current study is to explore the control region of mitochondrial DNA polymorphism in coho salmon populations throughout the Asian part of its range: the Kamchatka peninsula, the mainland coast of the Sea of Okhotsk and the Sakhalin island. We examined 478 individuals from 14 different locations throughout the Russian Far East: five rivers from western Kamchatka; four rivers from eastern Kamchatka, three samples from the continental coast rivers and two samples from the Sakhalin island rivers (Table 1). Thus our study covered almost the whole Asian part of the coho salmon range. In all the samples, the sequences of the 5’ end portion of the mtDNA control region were determined. The examined 553-bp fragment corresponds to the positions 15658–16660 bp of the complete mtDNA genome of the coho salmon (GenBank MH003640) (de Flamingh et al., 2018), positions 7- 559 bp of the control region. DNA was isolated and purified using the silica-based method (Ivanova et al., 2006). Amplification was carried out in a total volume of 15 μL (30 mM Tris-HCl (pH 8.6), 16.6 mM (NH4)2SO4, 2.5 mM MgCl2, 0.6 mM dNTP, 3 pmol of each primer, about 100 ng DNA, and 0.5 units of Taq polymerase, Eurogen) under the following reaction conditions: initial DNA denaturation at 95°C for 2 min; 42 cycles of denaturation at 94°C for 20 s, primer annealing at 52°C for 45 s, and DNA extension at 72°C for 30 s; and final extension at 72°C for 10 min, using the PCR-primers HN20 GTGTTATGCTTTAGTTAAGC and Tpro2 ACCCTTAACTCCCAAAGC (Brunner et al., 2001). Sequencing was performed on an ABI 3500 automated sequencer using the BigDye v.3.1 sequencing kit from Tpro2 primer. Processing of chromatograms and multiple sequence alignment was carried out in the Geneious 6.0.5. (Kearse et al., 2012). Genetic polymorphism of the samples was evaluated in the Arlequin v. 3.5.1.3 software (Excoffier et al., 2010). As a result of control region sequencing, an extremely low polymorphism of this region of mtDNA was revealed: eight haplotypes were found (Genbank MK888685-MK888692), one of them (MK888691) is prevailing in all the samples (Fig. 1). All the samples analysed are characterised by a low level of genetic diversity; moreover, the samples from mainland coast and Sakhalin Island turned out to be monomorphic. The haplotype composition and distribution throughout the American part of the coho range was described earlier (Smith et al, 2001), and the different levels of haplotype diversity in the northern and southern parts of the western coast of North America were found out (Fig. 1). According to the glacial history of this region, the existence of two main Pleistocene refugia for Pacific salmon was suggested; both of them, Beringian and Cascadian, were located on the North American continent. However, it’s evident that originally there was a single southern refugium until the late Pleistocene when species spread into a northern refugium in the Bering Sea during an interglacial period. This suggestion is strongly supported by mitochondrial data for coho (Smith et al, 2001) and chinook salmon (Martin et al, 2010). At least three haplogroups were identified in the populations south to the area covered by an ice sheet, while only one was noted north to the glaciation zone (Smith et al, 2001). The presence of only one haplogroup in the Russian populations allows to suggest that the entire Asian coho salmon stock was formed as a result of dispersion from the Beringian refugium located north to the Alaska Peninsula. Thus, our data demonstrate the patterns of colonization similar to those proposed for chinook salmon (Martin et al, 2010; Shpigalskaya, 2008). The reported study was funded by RFBR according to the research project № 18-04-01375-a. Figure 1. Coho salmon control region haplotype distribution in the Russian part of its range and its comparison with the American part (Smith et al., 2001). Figure 1 References de Flamingh A., Mallott E.K., Roca A.L., Boraas A.S. and Malhi R.S. (2018) Species identification and mitochondrial genomes of ancient fish bones from the Riverine Kachemak tradition of the Kenai Peninsula, Alaska. Mitochondrial DNA B Resour 3 (1), 409-411. DOI: 10.1080/23802359.2018.1456371 Ivanova, N.V., deWaard, J., and Hebert, P.D.N. (2006) An inexpensive, automation-friendly protocol for recovering high-quality DNA. Molecular Ecology Notes, 6, 998—1002. DOI: 10.1111/j.1471-8286.2006.01428.x Brunner P.C., Douglas M.R., Osinov A., Wilson C.C., and Bernatchez L. (2001) Holarctic phylogeography of arctic charr (Salvelinus alpinus L.) inferred from mitochondrial DNA sequences. Evolution, 55 (3), 573—586. DOI:10.1111/j.0014-3820.2001.tb00790.x Kearse M., Moir R., Wilson A., Stones-Havas S., Cheung M., Sturrock S., Buxton S., Cooper A., Markowitz, S., Duran, C., Thierer, T., Ashton, B., Meintjes, P., and Drummond, A. (2012) Geneious Basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data, Bioinformatics, 28 (12), 1647—1649. DOI: 10.1093/bioinformatics/bts199 Excoffier L. and Lischer H.E.L. (2010) Arlequin suite ver 3.5: a new series of programs to perform population genetics analyses under Linux and Windows, Molecular Ecology Resources, 10 (3), 564—567. DOI: 10.1111/j.1755-0998.2010.02847.x Christian T. Smith, R. John Nelson, Chris C. Wood, Ben F. Koop (2001) Glacial biogeography of North American coho salmon (Oncorhynchus kisutch). Molecular Ecology, 10, 2775-2785. doi: 10.1046/j.1365-294X.2001.t01-1-01405.x Kyle E. Martin , Craig A. Steele , Joseph P. Brunelli & Gary H. Thorgaard (2010) Mitochondrial Variation and Biogeographic History of Chinook Salmon, Transactions of the American Fisheries Society, 139:3, 792-802. DOI: 10.1577/T09-080.1 Shpigalskaya, N., V. I. A. Brykov, A. J. Gharrett, A. D. Kukhlevsky, R. A. Shaporev, and N. V. Varnavskaya (2008) Variation of mitochondrial DNA in Chinook salmon Oncorhynchus tshawytscha Walbaum populations from Kamchatka. Russian Journal of Genetics 44(7):849–858. DOI: 10.1134/S1022795408070132 Keywords: Coho Salmon, Control region, Phylogegraphy, molecular genetics, mtDNA, Russian far east Conference: XVI European Congress of Ichthyology, Lausanne, Switzerland, 2 Sep - 6 Sep, 2019. Presentation Type: Poster Topic: TAXONOMY, PHYLOGENY AND ZOOGEOGRAPHY Citation: Soshnina VA, Sergeev AA and Zelenina DA (2019). The phylogeography of coho salmon based on mtDNA control region variation: Asian populations descend from the Beringian Refugium. Front. Mar. Sci. Conference Abstract: XVI European Congress of Ichthyology. doi: 10.3389/conf.fmars.2019.07.00119 Copyright: The abstracts in this collection have not been subject to any Frontiers peer review or checks, and are not endorsed by Frontiers. They are made available through the Frontiers publishing platform as a service to conference organizers and presenters. The copyright in the individual abstracts is owned by the author of each abstract or his/her employer unless otherwise stated. Each abstract, as well as the collection of abstracts, are published under a Creative Commons CC-BY 4.0 (attribution) licence (https://creativecommons.org/licenses/by/4.0/) and may thus be reproduced, translated, adapted and be the subject of derivative works provided the authors and Frontiers are attributed. For Frontiers’ terms and conditions please see https://www.frontiersin.org/legal/terms-and-conditions. Received: 16 May 2019; Published Online: 14 Aug 2019. * Correspondence: Dr. Daria A Zelenina, All-Russian Research Institute Fisheries and Oceanography, Moscow, Moscow Oblast, Russia, d.zelenina@gmail.com Login Required This action requires you to be registered with Frontiers and logged in. To register or login click here. Abstract Info Abstract Supplemental Data The Authors in Frontiers Valeria A Soshnina Alexey A Sergeev Daria A Zelenina Google Valeria A Soshnina Alexey A Sergeev Daria A Zelenina Google Scholar Valeria A Soshnina Alexey A Sergeev Daria A Zelenina PubMed Valeria A Soshnina Alexey A Sergeev Daria A Zelenina Related Article in Frontiers Google Scholar PubMed Abstract Close Back to top Javascript is disabled. Please enable Javascript in your browser settings in order to see all the content on this page.
Refugium (fishkeeping)
mtDNA control region
Variation (astronomy)
Cite
Citations (2)
ABSTRACT Complete mitochondrial DNA (mtDNA) control region of 30 Pakistani domestic goats was sequenced to investigate the genetic diversity and organization. Twenty‐two new haplotypes were observed and all were classified into mt‐lineage A . Phylogenetic analysis revealed two distinct clusters in mt‐lineage A , A1 and A2 . A 17 bp deletion and a 76 bp insertion were detected in the L‐domain and observed 10 and one animals, respectively, in 232 Pakistani domestic goats. These remarkable deletion/insertion events would be useful to investigate mtDNA diversity within the highly divergent mt‐lineage A . In analysis of the control region feature, the caprine mtDNA was A/T rich as observed for other artiodactyls. Four conserved regions, Block A in the L domain, the C‐domain, Block B and CSB1 in the R domain, were defined as well as in the other species.
Lineage (genetic)
mtDNA control region
D-loop
Cite
Citations (15)
Mitochondrial (mt) DNA control region sequences were used to test the genetic and phylogeographic structure of walleye Stizostedion vitreum populations at different geographical scales: among spawning sites, lake basins, lakes, and putative glacial refugia in the Great Lakes region. Sequencing 199 walleye revealed nucleotide substitutions and tandemly repeated sequences that varied in copy number, as well as in sequence composition, in ≈ 1200 bp of the mtDNA control region. Variable numbers of copies of an 11‐bp tandem repeat showed no geographical patterning and were not used in further analyses. Substitutions in the other areas of the control region yielded 19 haplotypes, revealing phylogeographic structure and significant differences among glacial refugia, lakes, basins and some spawning sites. Differences among spawning populations were consistent with reduced gene flow, philopatry and possible natal homing. Analysis of spawning populations showed consistency of genotypic frequencies among years and between males and females, supporting philopatry in both sexes. The unglaciated plateau in southern Ohio, USA housed a very different haplotype that diverged prior to the Missouri, Mississippi and Atlantic glacial refugia types. Haplotypes from the three refugia colonized the Great Lakes after retreat of the Wisconsin glaciers, and their present distribution reflects the geography of their prior isolation and differential colonization. Populations that became associated with spawning localities appear to have diverged further due to philopatry, resulting in fine‐scale phylogeographic structuring.
Stizostedion
Philopatry
mtDNA control region
Population Genetics
Cite
Citations (140)