The interconnection between LXR activation and autophagy in primary human macrophages
0
Citation
0
Reference
10
Related Paper
Keywords:
Liver X receptor
Foam cell
Efflux
Reverse cholesterol transport
The ATP-binding cassette transporter ABCA1 is essential for high density lipoprotein (HDL) formation and considered rate-controlling for reverse cholesterol transport. Expression of the Abca1 gene is under control of the liver X receptor (LXR). We have evaluated effects of LXR activation by the synthetic agonist T0901317 on hepatic and intestinal cholesterol metabolism in C57BL/6J and DBA/1 wild-type mice and in ABCA1-deficient DBA/1 mice. In wild-type mice, T0901317 increased expression of Abca1 in liver and intestine, which was associated with a ∼60% rise in HDL. Biliary cholesterol excretion rose 2.7-fold upon treatment, and fecal neutral sterol output was increased by 150–300%. Plasma cholesterol levels also increased in treated Abca1−/−mice (+120%), but exclusively in very low density lipoprotein-sized fractions. Despite the absence of HDL, hepatobiliary cholesterol output was stimulated upon LXR activation inAbca1−/− mice, leading to a 250% increase in the biliary cholesterol/phospholipid ratio. Most importantly, fecal neutral sterol loss was induced to a similar extent (+300%) by the LXR agonist in DBA/1 wild-type and Abca1−/− mice. Expression of Abcg5 and Abcg8, recently implicated in biliary excretion of cholesterol and its intestinal absorption, was induced in T0901317-treated mice. Thus, activation of LXR in mice leads to enhanced hepatobiliary cholesterol secretion and fecal neutral sterol loss independent of (ABCA1-mediated) elevation of HDL and the presence of ABCA1 in liver and intestine. The ATP-binding cassette transporter ABCA1 is essential for high density lipoprotein (HDL) formation and considered rate-controlling for reverse cholesterol transport. Expression of the Abca1 gene is under control of the liver X receptor (LXR). We have evaluated effects of LXR activation by the synthetic agonist T0901317 on hepatic and intestinal cholesterol metabolism in C57BL/6J and DBA/1 wild-type mice and in ABCA1-deficient DBA/1 mice. In wild-type mice, T0901317 increased expression of Abca1 in liver and intestine, which was associated with a ∼60% rise in HDL. Biliary cholesterol excretion rose 2.7-fold upon treatment, and fecal neutral sterol output was increased by 150–300%. Plasma cholesterol levels also increased in treated Abca1−/−mice (+120%), but exclusively in very low density lipoprotein-sized fractions. Despite the absence of HDL, hepatobiliary cholesterol output was stimulated upon LXR activation inAbca1−/− mice, leading to a 250% increase in the biliary cholesterol/phospholipid ratio. Most importantly, fecal neutral sterol loss was induced to a similar extent (+300%) by the LXR agonist in DBA/1 wild-type and Abca1−/− mice. Expression of Abcg5 and Abcg8, recently implicated in biliary excretion of cholesterol and its intestinal absorption, was induced in T0901317-treated mice. Thus, activation of LXR in mice leads to enhanced hepatobiliary cholesterol secretion and fecal neutral sterol loss independent of (ABCA1-mediated) elevation of HDL and the presence of ABCA1 in liver and intestine. reverse cholesterol transport high density lipoprotein scavenger receptor class B type I liver X receptor fast protein liquid chromatography very low density lipoprotein Reverse cholesterol transport (RCT)1 or centripetal cholesterol flux is a key process in maintenance of whole body cholesterol homeostasis (1Glomset J.A. Norum K.R. Adv. Lipid Res. 1973; 11: 1-65Crossref Google Scholar, 2Fielding C.J. Fielding P.E. J. Lipid Res. 1995; 36: 211-228Abstract Full Text PDF PubMed Google Scholar, 3Barter P.J. Rye K.A. Curr. Opin. Lipidol. 1996; 7: 82-87Crossref PubMed Scopus (171) Google Scholar, 4Dietschy J.M. Turley S.D. J. Biol. Chem. 2002; 277: 3801-3804Abstract Full Text Full Text PDF PubMed Scopus (221) Google Scholar, 5Attie A.D. Kastelein J.P. Hayden M.R. J. Lipid Res. 2001; 42: 1717-1726Abstract Full Text Full Text PDF PubMed Google Scholar, 6Oram J.F. Trends Mol. Med. 2002; 8: 168-173Abstract Full Text Full Text PDF PubMed Scopus (80) Google Scholar). RCT involves efflux of excess cholesterol from peripheral cells toward nascent high density lipoprotein (HDL) and its transport to the liver, followed by hepatic uptake mediated by scavenger receptor class B type I (SR-BI), biliary secretion in the form of cholesterol or bile salt, and finally disposal into feces. HDL-mediated RCT is generally assumed to underlie the well known epidemiological relationship between high HDL cholesterol levels and low risk for development of atherosclerosis. Efflux of cholesterol from peripheral cells, including macrophages in the vessel wall, is now known to be mediated in part by the ATP-binding cassette transporter ABCA1 (7Rust S. Rosier M. Funke H. Real J. Amoura Z. Piette J.C. Deleuze J.F. Brewer H.B. Duverger N. Denefle P. Assmann G. Nat. Genet. 1999; 22: 352-355Crossref PubMed Scopus (1269) Google Scholar, 8Bodzioch M. Orso E. Klucken J. Langmann T. Bo¨ttcher A. Diederich W. Drobnik W. Barlage S. Bu¨chler C. Porsch-Ozcurumez M. Kaminski W.E. Hahmann H.W. Oette K. Rothe G. Aslanidis C. Lackner K.J. Schmitz G. Nat. Genet. 1999; 22: 347-351Crossref PubMed Scopus (1349) Google Scholar, 9Brooks-Wilson A. Marcil M. Clee S.M. Zhang L.H. Roomp K. van Dam M., Yu, L. Brewer C. Collins J.A. Molhuizen H.O. Loubser O. Ouelette B.F. Fichter K. Ashbourne-Excoffon K.J. Sensen C.W. Scherer S. Mott S. Denis M. Martindale D. Frohlich J. Morgan K. Koop B. Pimstone S. Kastelein J.J. Hayden M.R. Nat. Genet. 1999; 22: 336-345Crossref PubMed Scopus (1509) Google Scholar, 10Bortnick A.E. Rothblat G.H. Stoudt G. Hoppe K.L. Royer L.J. McNeish J. Francone O.L. J. Biol. Chem. 2000; 275: 28634-28640Abstract Full Text Full Text PDF PubMed Scopus (273) Google Scholar). Abca1 mRNA is widely distributed throughout the body, with high expression levels in macrophages, hepatocytes, and enterocytes (11Luciani M.F. Denizot F. Savary S. Mattei M.G. Chimini G. Genomics. 1994; 21: 150-159Crossref PubMed Scopus (231) Google Scholar, 12Langmann T. Klucken J. Reil M. Liebisch G. Luciani M.F. Chimini G. Kaminski W.E. Schmitz G. Biochem. Biophys. Res. Commun. 1999; 257: 29-33Crossref PubMed Scopus (429) Google Scholar). This distribution pattern has recently been confirmed for the ABCA1 protein (13Wellington C.L. Walker E.K. Suarez A. Kwok A. Bissada N. Singaraja R. Yang Y.Z. Zhang L.H. James E. Wilson J.E. Francone O. McManus B.M. Hayden M.R. Lab. Invest. 2002; 82: 273-283Crossref PubMed Scopus (244) Google Scholar). The role of ABCA1 in hepatocytes is currently unknown, but may involve formation of pre-β-HDL particles (14Vaisman B.L. Lambert G. Amar M. Joyce C. Ito T. Shamburek R.D. Cain W.J. Fruchart-Najib J. Neufeld E.D. Remaley A.T. Brewer H.B., Jr. Santamarina-Fojo S. J. Clin. Invest. 2001; 108: 303-309Crossref PubMed Scopus (222) Google Scholar). In the intestine, ABCA1 has been suggested to be involved in cholesterol efflux from enterocytes into the lumen, thereby regulating the efficiency of intestinal cholesterol absorption (15Edwards P.A. Kast H.R. Anisfeld A.M. J. Lipid Res. 2002; 43: 2-12Abstract Full Text Full Text PDF PubMed Google Scholar, 16Lu T.T. Repa J.J. Mangelsdorf D.J. J. Biol. Chem. 2001; 276: 37735-37738Abstract Full Text Full Text PDF PubMed Scopus (327) Google Scholar). HDL is considered a major source for bile-destined cholesterol and phospholipid (17Schwartz C.C. Halloran L.G. Vlahcevic Z.R. Gregory D.H. Swell L. Science. 1978; 200: 62-64Crossref PubMed Scopus (218) Google Scholar, 18Robins S.J. Fasulo J.M. J. Clin. Invest. 1997; 99: 380-384Crossref PubMed Scopus (109) Google Scholar). Yet, we have recently demonstrated that, despite the absence of HDL, hepatobiliary cholesterol flux and fecal sterol excretion are not affected in Abca1 knockout mice (19Groen A.K. Bloks V.W. Bandsma R.H.J. Ottenhoff R. Chimini G. Kuipers F. J. Clin. Invest. 2001; 108: 843-850Crossref PubMed Scopus (143) Google Scholar). Our results thus questioned whether ABCA1 has indeed an important role in control of mass cholesterol transport from the periphery to the liver and suggest that its major peripheral function is removal of excess cholesterol from macrophages. Haghpassand et al. (20Haghpassand M. Bourassa P.A. Francone O.L. Aiello R.J. J. Clin. Invest. 2001; 108: 1315-1320Crossref PubMed Scopus (234) Google Scholar) showed convincingly that efflux from macrophages constitutes only a small fraction of HDL cholesterol. Several genes involved in control of cholesterol metabolism, includingAbca1, are transcriptionally regulated by the liver X receptor (LXR) (21Costet P. Luo Y. Wang N. Tall A.R. J. Biol. Chem. 2000; 275: 28240-28245Abstract Full Text Full Text PDF PubMed Scopus (853) Google Scholar, 22Venkateswaran A. Laffitte B.A. Joseph S.B. Mak P.A. Wilpitz D.C. Edwards P.A. Tontonoz P. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 12097-12102Crossref PubMed Scopus (848) Google Scholar, 23Repa J.J. Turley S.D. Lobaccaro J.A. Medina J., Li, L. Lustig K. Shan B. Heyman R.A. Dietschy J.M. Mangelsdorf D.J. Science. 2000; 289: 1524-1529Crossref PubMed Scopus (1151) Google Scholar, 24Schwartz K. Lawn R.M. Wade D.P. Biochem. Biophys. Res. Commun. 2000; 274: 794-802Crossref PubMed Scopus (376) Google Scholar). Two LXR isoforms have been identified, LXRα (NR1H3) and LXRβ (NR1H2) (25Willy P.J. Umesono K. Ong E.S. Evans R.M. Heyman R.A. Mangelsdorf D.J. Genes Dev. 1995; 9: 1033-1045Crossref PubMed Scopus (923) Google Scholar, 26Teboul M. Enmark E., Li, Q. Wikstrom A.C. Pelto-Huikko M. Gustafsson J.A. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 2096-2100Crossref PubMed Scopus (200) Google Scholar). Upon stimulation by oxysterols, activated LXR forms a heterodimer with the retinoid X receptor (RXR, NR2B1), binds to DNA, and influences gene expression. It has been proposed that a high dietary cholesterol intake (via subsequent formation of oxysterols) activates LXR, which, in turn, induces expression of genes involved in cholesterol disposal (27Janowski B.A. Willy P.J. Devi T.R. Falck J.R. Mangelsdorf D.J. Nature. 1996; 383: 728-731Crossref PubMed Scopus (1477) Google Scholar, 28Janowski B.A. Grogan M.J. Jones S.A. Wisely G.B. Kliewer S.A. Corey E.J. Mangelsdorf D.J. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 266-271Crossref PubMed Scopus (798) Google Scholar). Because of its prominent position in controlling cholesterol homeostasis, pharmacological activation of LXR is considered a promising approach to raise HDL, to improve RCT, and thereby to prevent the development of atherosclerosis. Treatment of rodents with LXR (or retinoid X receptor) agonists indeed results in elevation of plasma HDL levels (29Schultz J.R., Tu, H. Luk A. Repa J.J. Medina J.C., Li, L. Schwendner S. Wang S. Thoolen M. Mangelsdorf D.J. Lustig K.D. Shan B. Genes Dev. 2000; 14: 2831-2838Crossref PubMed Scopus (1404) Google Scholar, 30Joseph S.B. Laffitte B.A. Patel P.H. Watson M.A. Matsukuma K.E. Walczak R. Collins J.L. Osborne T.F. Tontonoz P. J. Biol. Chem. 2002; 277: 11019-11025Abstract Full Text Full Text PDF PubMed Scopus (626) Google Scholar) and reduced intestinal cholesterol absorption (23Repa J.J. Turley S.D. Lobaccaro J.A. Medina J., Li, L. Lustig K. Shan B. Heyman R.A. Dietschy J.M. Mangelsdorf D.J. Science. 2000; 289: 1524-1529Crossref PubMed Scopus (1151) Google Scholar). In this study, we have investigated the role of ABCA1 in LXR-controlled pathways of hepatobiliary and fecal cholesterol output in mice. For this purpose, wild-type and ABCA1-deficient mice (31McNeish J. Aiello R.J. Guyot D. Turi T. Gabel C. Aldinger C. Hoppe K.L. Roach M.L. Royer L.J. de Wet J. Broccardo C. Chimini G. Francone O.L. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 4245-4250Crossref PubMed Scopus (483) Google Scholar) were treated with the synthetic LXR agonist T0901317 (23Repa J.J. Turley S.D. Lobaccaro J.A. Medina J., Li, L. Lustig K. Shan B. Heyman R.A. Dietschy J.M. Mangelsdorf D.J. Science. 2000; 289: 1524-1529Crossref PubMed Scopus (1151) Google Scholar, 29Schultz J.R., Tu, H. Luk A. Repa J.J. Medina J.C., Li, L. Schwendner S. Wang S. Thoolen M. Mangelsdorf D.J. Lustig K.D. Shan B. Genes Dev. 2000; 14: 2831-2838Crossref PubMed Scopus (1404) Google Scholar). Surprisingly, both T0901317-treated Abca1−/− and wild-type mice showed similarly increased rates of hepatobiliary cholesterol output and increased fecal sterol loss independent of (ABCA1-mediated) elevation of plasma HDL levels and the (putative) role of ABCA1 in intestinal cholesterol absorption. Male C57BL/6J mice (2–3 months old) were purchased from Harlan (Horst, The Netherlands). Abca1−/−mice with a DBA/1 background (6–8 months old) and age-matched DBA/1 wild-type mice were obtained from IFFA Credo (Saint-Germain-sur-L'Arbresle, France). Because of the limited supply of homozygous knockout mice, both male and female mice were used in these experiments. Animals received standard mouse chow (Hope Farms BV, Woerden, The Netherlands) and water ad libitum. The synthetic LXR agonist T0901317, kindly provided by Organon BV (Oss, The Netherlands), was solubilized in Me2SO. This solution was diluted 1:1 with chremophor and further diluted 1:9 with mannitol/water (5%). Animals received 20 μmol of T0901317/kg/day by gavage at 4 p.m. Control groups were treated with the solvent only. All animals were housed separately, and feces of individual mice were collected from days 4 to 5. At day 5, mice were anesthetized by intraperitoneal injection of Hypnorm (fentanyl/fluanisone, 1 ml/kg) and diazepam (10 mg/kg). Bile was collected for 30 min by cannulation of the gallbladder. During bile collection, body temperature was stabilized using a humidified incubator. At the end of the collection period, animals were killed by cardiac puncture. Blood was collected in EDTA-containing tubes. Livers were excised and weighed. The small intestine was rinsed with cold phosphate-buffered saline and divided into three equal parts. Parts of both the liver and intestine were snap-frozen in liquid nitrogen and stored at −80 °C for mRNA isolation and biochemical analysis. Samples for microscopic evaluation were frozen in isopentane and stored at −80 °C or fixed in paraformaldehyde for hematoxylin/eosin and oil red O staining. C57BL/6J mice used for RNA isolation and lipid analysis only were killed without prior bile collection. Tissues were immediately removed, snap-frozen in liquid nitrogen, and manipulated as described below. Bile salts were measured enzymatically (32Murphy G.M. Billing B.H. Baron D.N. J. Clin. Pathol. 1970; 23: 594-598Crossref PubMed Scopus (185) Google Scholar). Commercially available kits were used for the determination of free cholesterol (Wako, Neuss, Germany); total cholesterol, HDL cholesterol, and triglycerides (Roche Molecular Biochemicals, Mannheim, Germany); and phospholipids and free fatty acids (Wako) in plasma. Hepatic and biliary lipids were extracted according to Bligh and Dyer (33Bligh E. Dyer W. Can. J. Biochem. Biophys. 1959; 37: 911-917Crossref Scopus (43132) Google Scholar). Phospholipids in bile and liver were determined as described by Bo¨ttcher et al. (34Bo¨ttcher C. van Gent C. Pries C. Anal. Chim. Acta. 1961; 24: 203-204Crossref Scopus (854) Google Scholar). Cholesterol in bile was measured according to Gamble et al. (35Gamble W. Vaughan M. Kruth H.S. Avigan J. J. Lipid Res. 1978; 19: 1068-1070Abstract Full Text PDF PubMed Google Scholar). Hepatic cholesterol and triglyceride contents were analyzed as described above. Feces were lyophilized, weighed, and homogenized. Neutral sterols and bile salts were analyzed according to Arca et al. (36Arca M. Montali A. Ciocca S. Angelico F. Cantafora A. J. Lipid Res. 1983; 24: 332-335Abstract Full Text PDF PubMed Google Scholar) and Setchell et al. (37Setchell K.D. Lawson A.M. Tanida N. Sjovall J. J. Lipid Res. 1983; 24: 1085-1100Abstract Full Text PDF PubMed Google Scholar), respectively. Pooled plasma samples from all animals of one group were used for lipoprotein separation by fast protein liquid chromatography (FPLC) as described previously (38Voshol P.J. Havinga R. Wolters H. Ottenhoff R. Princen H.M. Oude Elferink R.P. Groen A.K. Kuipers F. Gastroenterology. 1998; 114: 1024-1034Abstract Full Text Full Text PDF PubMed Scopus (82) Google Scholar). Total RNA was isolated with Trizol (Invitrogen) and quantified using Ribogreen (Molecular Probes, Inc., Eugene, OR). cDNA synthesis was done according to Blokset al. (39Bloks V.W. Plo¨sch T. van Goor H. Roelofsen H. Baller J.F.W. Havinga R. Verkade H.J. van Tol A. Jansen P.L.M. Kuipers F. J. Lipid Res. 2001; 42: 41-50Abstract Full Text Full Text PDF PubMed Google Scholar). For C57BL/6J mice, all three intestinal samples per mouse were analyzed separately, whereas for DBA/1 andAbca1−/− mice, equal amounts of RNA from the three distinct parts of the small intestine were pooled prior to reverse transcription. Real-time quantitative PCR (40Heid C.A. Stevens J. Livak K.J. Williams P.M. Genome Res. 1996; 6: 986-994Crossref PubMed Scopus (5040) Google Scholar) was performed using an Applied Biosystems 7700 sequence detector according to the manufacturer's instructions. Primers were obtained from Invitrogen. Fluorogenic probes, labeled with 6-carboxyfluorescein and 6-carboxytetramethylrhodamine, were made by Eurogentec (Seraing, Belgium); all sequences are listed in TableI. All expression data were subsequently standardized for 18 S rRNA, which was analyzed in separate runs.Table IPrimer sequences used in mRNA quantification by real-time reverse transcription-PCRAccession No.ForwardReverseProbeSrebp1aRef.58Shimomura I. Shimano H. Horton J.D. Goldstein J.L. Brown M.S. J. Clin. Invest. 1997; 99: 838-845Crossref PubMed Scopus (642) Google ScholarGAGGCGGCTCTGGAACAGATGTCTTCGATGTCGTTCAAAACCTGTGTCCAGTTCGCACATCTCGGCSrebp1cBI656094GGAGCCATGGATTGCACATTCCTGTCTCACCCCCAGCATACAGCTCATCAACAACCAAGACAGTGACTTCCSrebp2AF374267CTGCAGCCTCAAGTGCAAAGCAGTGTGCCATTGGCTGTCTCCATCCAGCAGCAGGTGCAGACGLXRα (NR1H3)AF085745GCTCTGCTCATTGCCATCAGTGTTGCAGCCTCTCTACTTGGATCTGCAGACCGGCCCAACGTGHmgcrBB664708CCGGCAACAACAAGATCTGTGATGTACAGGATGGCGATGCATGTCGCTGCTCAGCACGTCCTCTTCCyp7a1NM_007824CAGGGAGATGCTCTGTGTTCAAGGCATACATCCCTTCCGTGATGCAAAACCTCCAATCTGTCATGAGACCTCCCyp27AK004977GCCTTGCACAAGGAAGTGACTCGCAGGGTCTCCTTAATCACACCCTTCGGGAAGGTGCCCCAGAcat1NM_009230TGGGTGCCACTTCGATGACTTGAGTGCACACCCACCATTGCCAACCTCATTGAAAAGTCCGCATCGCAcat2NM_011433GGTGGAACTATGTGGCCAAGACCAGGATGAAGCAGGCATAGACAAACAGCCCAGGACCTGGGCAAAGLp1NM_008509AAGGTCAGAGCCAAGAGAAGCACCAGAAAAGTGAATCTTGACTTGGTCCTGAAGACTCGCTCTCAGATGCCCTACAAbca1NM_013454CCCAGAGCAAAAAGCGACTCGGTCATCATCACTTTGGTCCTTGAGACTACTCTGTCTCTCAGACAACACTTGACCAAGAbcg5AF312713TCAGGACCCCAAGGTCATGATAGGCTGGTGGATGGTGACAATCCACAGGACTGGACTGCATGACTGCAAbcg8AK004871GACAGCTTCACAGCCCACAAGCCTGAAGATGTCAGAGCGACTGGTGCTCATCTCCCTCCACCAGBsep(Abcb11)NM_021022CTGCCAAGGATGCTAATGCACGATGGCTACCCTTTGCTTCTTGCCACAGCAATTTGACACCCTAGTTGGMdr2(Abcb4)NM_008830GCAGCGAGAAACGGAACAGGGTTGCTGATGCTGCCTAGTTAAAGTCGCCGTCTAGGCGCCGTNtcp(Slc10a1)AB003303ATGACCACCTGCTCCAGCTTGCCTTTGTAGGGCACCTTGTCCTTGGGCATGATGCCTCTCCTCOatp1(Slc21a1)NM_013797CAGTCTTACGAGTGTGCTCCAGATATGAGGAATACTGCCTCTGAAGTGTGGATTTGCCAGTACATTTACCTTCTTGCCCSR-BINM_016741TCAGAAGCTGTTCTTGGTCTGAACGTTCATGGGGATCCCAGTGAACCCAAAGGAGCATTCCTTGTTCCTAGACA18 S rRNAX00686CGGCTACCACATCCAAGGACCAATTACAGGGCCTCGAAACGCGCAAATTACCCACTCCGAQuantitative real-time PCR was performed as described under "Experimental Procedures." All probes were labeled with 6-carboxyfluorescein and 6-carboxytetramethylrhodamin at the 5′- and 3′-ends, respectively. Open table in a new tab Quantitative real-time PCR was performed as described under "Experimental Procedures." All probes were labeled with 6-carboxyfluorescein and 6-carboxytetramethylrhodamin at the 5′- and 3′-ends, respectively. Statistical analyses were performed using SPSS Version 10.0 for Windows (SPSS Inc., Chicago, IL). Treated and untreated groups were compared by Student's t test for large data series of biochemical parameters and by the Mann-WhitneyU test for the remaining, as indicated. A p value <0.05 was considered statistically significant. Treatment with the LXR agonist T0901317 resulted in profound changes in plasma and liver lipid homeostasis in C57BL/6J mice, as previously reported by ourselves (41Grefhorst, A., Elzinga, B. M., Voshol, P. J., Plo¨sch, T., Kok, T., Bloks, V. W., van der Sluijs, F. H., Havekes, L. M., Romijn, J. A., Verkade, H. J., and Kuipers, F. (July 3, 2002) J. Biol. Chem.10.1074/jbc.M204887200Google Scholar) and others (23Repa J.J. Turley S.D. Lobaccaro J.A. Medina J., Li, L. Lustig K. Shan B. Heyman R.A. Dietschy J.M. Mangelsdorf D.J. Science. 2000; 289: 1524-1529Crossref PubMed Scopus (1151) Google Scholar, 29Schultz J.R., Tu, H. Luk A. Repa J.J. Medina J.C., Li, L. Schwendner S. Wang S. Thoolen M. Mangelsdorf D.J. Lustig K.D. Shan B. Genes Dev. 2000; 14: 2831-2838Crossref PubMed Scopus (1404) Google Scholar). On the treatment protocol employed in this study, mice developed significantly elevated plasma levels of cholesterol, particularly in the esterified fraction, and phospholipids. HDL cholesterol was elevated by 59% upon treatment. Administration of T0901317 increased liver weight by 40% without any change in body weight. Hepatic total cholesterol content was decreased in treated mice (−15%), partly as a result of a significantly diminished cholesteryl ester concentration (−32%), whereas the concentration of phospholipids was not affected. In treated animals, we found a >8-fold increase in hepatic triglyceride content, in accordance with recently published studies (30Joseph S.B. Laffitte B.A. Patel P.H. Watson M.A. Matsukuma K.E. Walczak R. Collins J.L. Osborne T.F. Tontonoz P. J. Biol. Chem. 2002; 277: 11019-11025Abstract Full Text Full Text PDF PubMed Scopus (626) Google Scholar). Histologically, these animals presented with profound hepatic fat deposits, but no signs of liver damage were noticed (data not shown). Bile flow was unaffected by T0901317 treatment when calculated on the basis of body weight (TableII). Biliary cholesterol output was 2.7-fold higher upon treatment, whereas biliary bile salt and phospholipid output was not affected. As a consequence, the ratio of cholesterol to phospholipids increased from 0.07 to 0.23 upon treatment, indicative of uncoupling of biliary cholesterol from phospholipid secretion.Table IIBile flow and biliary secretion rates of C57BL/6J mice treated with the LXR agonist T0901317 or its solventControlT0901317Bile flow (μl/min/100 g body weight)8.2 ± 2.87.8 ± 2.6Bile salts (nmol/min/100 g body weight)584 ± 229477 ± 200Cholesterol (nmol/min/100 g body weight)3.8 ± 1.410.3 ± 3.12-aIndicates significant difference (Mann-Whitney U test, p < 0.05).Phospholipids (nmol/min/100 g body weight)52.7 ± 10.844.2 ± 9.7Cholesterol/phospholipid ratio0.07 ± 0.030.23 ± 0.042-bIndicates significant difference (Mann-Whitney U test, p < 0.001).Male C57BL/6J mice (2–3 months old) were treated with the LXR agonist T0901317 or solvent only as described under "Experimental Procedures" (n = six per group). Bile was collected for 30 min. Values represent means ± S.D.2-a Indicates significant difference (Mann-Whitney U test, p < 0.05).2-b Indicates significant difference (Mann-Whitney U test, p < 0.001). Open table in a new tab Male C57BL/6J mice (2–3 months old) were treated with the LXR agonist T0901317 or solvent only as described under "Experimental Procedures" (n = six per group). Bile was collected for 30 min. Values represent means ± S.D. Gene expression profiles of key regulatory, metabolic, and transporter-encoding genes involved in hepatic cholesterol metabolism were analyzed by real-time PCR (TableIII). As expected (42Repa J.J. Liang G., Ou, J. Bashmakov Y. Lobaccaro J.M. Shimomura I. Shan B. Brown M.S. Goldstein J.L. Mangelsdorf D.J. Genes Dev. 2000; 14: 2819-2830Crossref PubMed Scopus (1423) Google Scholar, 43Liang G. Yang J. Horton J.D. Hammer R.E. Goldstein J.L. Brown M.S. J. Biol. Chem. 2002; 277: 9520-9528Abstract Full Text Full Text PDF PubMed Scopus (527) Google Scholar), the gene encoding sterol regulatory element-binding protein 1c (Srebp1c) was the only regulatory gene with a modified expression (2.6-fold up) upon T0901317 treatment. This predicted increase is indicative of the overall stimulatory action of the agonist on hepatic gene expression, also supported by an ∼5-fold increase in expression levels of the LXR target gene Lpl encoding lipoprotein lipase (data not shown). The gene encoding 3-hydroxy-3-methylglutaryl-coenzyme A reductase (Hmgcr), the key enzyme in cholesterol synthesis, was up-regulated by 55%, whereas the 45% up-regulation of the bile salt synthesis geneCyp7a1 did not reach statistical significance. T0901317 treatment increased expression of Abca1 and Abcg52.4- and 2.8-fold, respectively; expression of hepatic Abcg8showed a high variation in its expression levels. Expression of transporters involved in bile salt uptake (Ntcp(Na/taurocholate-cotransporting polypeptide) and Oatp1(organic anion-transporting polypeptide-1)) and secretion (Bsep (bile salt export pump)) and in phospholipid secretion (Mdr2 (multidrug resistance P-glycoprotein-2)) remained unaffected.Table IIImRNA expression levels in liver tissue of C57BL/6J mice treated with the LXR agonist T0901317 or its solvent measured by real-time reverse transcription-PCRmRNAControlT0901317Srebp1a1.00 ± 0.181.22 ± 0.06Srebp1c1.00 ± 0.152.64 ± 0.543-aIndicates significant difference (Mann-Whitney U test, p < 0.05).Srebp21.00 ± 0.171.00 ± 0.06LXR1.00 ± 0.090.84 ± 0.11Hmgcr1.00 ± 0.101.55 ± 0.363-aIndicates significant difference (Mann-Whitney U test, p < 0.05).Cyp7a11.00 ± 0.421.45 ± 0.74Cyp271.00 ± 0.160.94 ± 0.08Acat21.00 ± 0.121.24 ± 0.27Abca11.00 ± 0.552.38 ± 0.963-aIndicates significant difference (Mann-Whitney U test, p < 0.05).Abcg51.00 ± 0.422.81 ± 1.193-aIndicates significant difference (Mann-Whitney U test, p < 0.05).Abcg81.00 ± 0.561.54 ± 0.51Bsep1.00 ± 0.181.01 ± 0.06Mdr21.00 ± 0.101.13 ± 0.17Ntcp1.00 ± 0.040.97 ± 0.10Oatp11.00 ± 0.410.63 ± 0.09Male C57BL/6J mice (2–3 months old) were treated with the LXR agonist T0901317 or solvent only as described under "Experimental Procedures" (n = four per group). Quantitative real-time PCR was performed as described under "Experimental Procedures" with the primers and probes given in Table I. All data were standardized for 18 S rRNA. Expression in control mice was set to 1.00. Values represent means ± S.D.3-a Indicates significant difference (Mann-Whitney U test, p < 0.05). Open table in a new tab Male C57BL/6J mice (2–3 months old) were treated with the LXR agonist T0901317 or solvent only as described under "Experimental Procedures" (n = four per group). Quantitative real-time PCR was performed as described under "Experimental Procedures" with the primers and probes given in Table I. All data were standardized for 18 S rRNA. Expression in control mice was set to 1.00. Values represent means ± S.D. Fecal bile salt loss was increased by 84% upon activation of LXR with T0901317 (Fig. 1), reflecting increased hepatic bile salt synthesis. In addition, neutral sterol output was enhanced by 187% in T0901317-treated mice. Increased expression of Abca1 in the intestine has been proposed to reduce the efficacy of cholesterol (re)absorption and hence to enhance fecal cholesterol disposal (23Repa J.J. Turley S.D. Lobaccaro J.A. Medina J., Li, L. Lustig K. Shan B. Heyman R.A. Dietschy J.M. Mangelsdorf D.J. Science. 2000; 289: 1524-1529Crossref PubMed Scopus (1151) Google Scholar). Indeed, treatment of mice with the LXR agonist T0901317 resulted in an ∼3-fold increase in Abca1mRNA abundance along the entire length of the small intestine (Fig.2A). Likewise, expression ofAbcg5 and Abcg8, recently implicated in control of cholesterol absorption (44Berge K.E. Tian H. Graf G.A., Yu, L. Grishin N.V. Schultz J. Kwiterovich P. Shan B. Barnes R. Hobbs H.H. Science. 2000; 290: 1771-1775Crossref PubMed Scopus (1361) Google Scholar, 45Lee M.H., Lu, K. Hazard S., Yu, H. Shulenin S. Hidaka H. Kojima H. Allikmets R. Sakuma N. Pegoraro R. Srivastava A.K. Salen G. Dean M. Patel S.B. Nat. Genet. 2001; 27: 79-83Crossref PubMed Scopus (0) Google Scholar, 46Repa J.J. Berge K.E. Pomajzl C. Richardson J.A. Hobbs H. Mangelsdorf D.J. J. Biol. Chem. 2002; 277: 18793-18800Abstract Full Text Full Text PDF PubMed Scopus (689) Google Scholar), was induced in treated animals, albeit less pronounced than that of Abca1 (Fig. 2,B and C). In contrast, mRNA levels ofHmgcr and Acat1 (encoding acyl-coenzyme A:cholesterol acyltransferase-1), indicative of intestinal cholesterol synthesis and cholesterol esterification, respectively, were similar in treated and control animals (Fig. 2, D andE). No changes in intestinal morphology were noted upon microscopic examination of hematoxylin/eosin- and oil red O-stained sections (data not shown).Figure 2mRNA expression levels in the intestines of C57BL/6J mice treated with the LXR agonist T0901317 or its solvent measured by real-time PCR. C57BL/6J mice were treated with T0901317 (•) or solvent only (◯) for 4 days (n = four per group); the intestine was removed, rinsed with cold phosphate-buffered saline, divided into three equal parts, and analyzed as described under "Experimental Procedures." All data were standardized for 18 S rRNA. Expression in the proximal part of the small intestine in animals receiving the solvent only was set to 1. Theasterisks indicate significant difference (Mann-WhitneyU test, p < 0.05). A–E, relative expression of Abca1, Abcg5,Abcg8, Hmgcr, and Acat1, respectively.View Large Image Figure ViewerDownload Hi-res image Download (PPT) To elucidate the specific r
Liver X receptor
Reverse cholesterol transport
High-density lipoprotein
Cite
Citations (209)
Liver X receptor (LXR) plays an important role in reverse cholesterol transport (RCT), and activation of LXR could reduce atherosclerosis. In the present study we used a cell-based screening method to identify new potential LXRβ agonists. A novel benzofuran-2-carboxylate derivative was identified with LXRβ agonist activity: E17110 showed a significant activation effect on LXRβ with an EC50 value of 0.72 μmol/L. E17110 also increased the expression of ATP-binding cassette transporter A1 (ABCA1) and G1 (ABCG1) in RAW264.7 macrophages. Moreover, E17110 significantly reduced cellular lipid accumulation and promoted cholesterol efflux in RAW264.7 macrophages. Interestingly, we found that the key amino acids in the LXRβ ligand-binding domain had distinct interactions with E17110 as compared to TO901317. These results suggest that E17110 was identified as a novel compound with LXRβ agonist activity in vitro via screening, and could be developed as a potential anti-atherosclerotic lead compound.
Liver X receptor
ABCG1
Reverse cholesterol transport
Cite
Citations (12)
Liver X receptor
Foam cell
Efflux
Reverse cholesterol transport
Cite
Citations (0)
Nuclear Liver X Receptors activation by synthetic agonists was proven to be atheroprotective in mice; an effect likely based on stimulation of cellular cholesterol efflux from arterial macrophages. However, mechanisms involved in free cholesterol efflux from mouse macrophages appear distinct from those operating in human macrophages. The objective of this study was to decipher precise cellular mechanisms controlling free cholesterol efflux from human macrophages upon LXR stimulation. In THP-1 and human monocyte-derived macrophages (HMDM), treatment with the LXR agonist GW3965 efficiently induced ARL7 expression (6-fold, p<0.05), an effect associated with an increased amount of plasma membrane free cholesterol available for efflux (+25%, p<0.05) and a higher lipid rafts formation (+10%, p<0.05). Both effects were abolished in ARL7 Knockdown (KD) macrophages, leading to a lack of stimulation of cholesterol efflux by GW3965. Specific targeting of each LXR isoforms, LXRα and LXRβ, by RNAi revealed that LXRα silencing in THP-1 and HMDM reduced significantly expression of cholesterol transporters ABCA1, ABCG1 and receptor SR-BI/Cla-1 mRNA levels, as well as free cholesterol efflux to apoA1 (-30%, p<0.05) and to HDL (-20%, p<0.05) upon stimulation with LXR, whereas LXRβ silencing has no impact. Interestingly, stimulation of cholesterol efflux to HDL by GW3965 was significantly reduced (-50%, p<0.05) in ABCA1 KD THP-1 macrophages; those cells being incapable to promote cholesterol efflux to apoA1. However, silencing of ABCG1 or SR-B1/Cla-1 had no impact on cholesterol efflux to HDL from either control or ABCA1 KD THP-1 macrophages treated or not with LXR agonist. By contrast stimulation of cholesterol efflux to HDL by GW3965 was completely abolished in LXRα/ABCA1 double KD macrophages, highlighting the major contribution of ABCA1 in cholesterol efflux from human macrophage. We conclude that LXR-mediated stimulation of cholesterol efflux from human macrophages is a two-steps mechanism. First, LXR activation promotes ARL7-dependent free cholesterol transport to plasma membrane, mostly in lipid raft domains. Then, membrane free cholesterol is exported to apoA1 and HDL acceptors through ABCA1; this latter step being controlled selectively by LXRα.
Liver X receptor
ABCG1
Reverse cholesterol transport
Efflux
Lipid raft
Cite
Citations (0)
The liver X receptor (LXR)-α and -β isoforms are nuclear transcription factors that regulate the expression of a number of genes involved in lipid modulation. One key LXR target gene, which may offer therapeutic potential in the treatment of atherosclerosis, is the ATP-binding cassette transporter A1 (ABCA1) as it is involved in the process of reverse cholesterol transport. ABCA1 initiates the efflux of cholesterol from macrophages present in the atherosclerotic plaques of the arterial wall, where it is accepted by apolipoproteins such as apoA-1 and becomes high-density lipoprotein (HDL). HDL is then transported back to the liver for metabolism and excretion. A number of other genes are regulated by LXR function that may have positive or negative effects on atherosclerosis. Extrapolating the effect of individual gene regulation to an overall effect in humans, when all genes are modulated, is extremely difficult. This is further complicated by the fact that most preclinical work has been carried out in mice that differ quite significantly from humans in terms of lipid balance and metabolism. This review provides an update to the authors’ earlier patent review in this journal, which focused on the structural and biological data reported for LXR agonists in patent applications and associated literature. Various therapeutic indications have been reported for LXR agonists, but this review focuses solely on non-steroidal LXR agonists for the potential treatment of atherosclerosis.
Liver X receptor
Reverse cholesterol transport
Cite
Citations (11)
Liver X receptors (LXRs) are oxysterol-activated nuclear receptors regulating reverse cholesterol transport, in part by modulating cholesterol efflux from macrophages to apoAI and HDL via the ABCA1 and ABCG1/ABCG4 pathways. Moreover, LXR activation increases intracellular cholesterol trafficking via the induction of NPC1 and NPC2 expression. However, implication of LXRs in the selective uptake of cholesteryl esters from lipoproteins in human macrophages has never been reported.Our results show that (1) selective CE uptake from HDL(3) is highly efficient in human monocyte-derived macrophages; (2) surprisingly, HDL(3)-CE uptake is strongly increased by LXR activation despite antiatherogenic effects of LXRs; (3) HDL(3)-CE uptake increase is not linked to SR-BI expression modulation but it is dependent of proteoglycan interactions; (4) HDL(3)-CE uptake increase is associated with increased expression and secretion of apoE and LPL, two proteins interacting with proteoglycans; (5) HDL(3)-CE uptake increase depends on the integrity of raft domains and is associated with an increased caveolin-1 expression.Our study identifies a new role for LXRs in the control of cholesterol homeostasis in human macrophages. LXR activation results in enhanced dynamic intracellular cholesterol fluxes through an increased CE uptake from HDL and leads to an increased cholesterol availability to efflux to apoAI and HDL.
Primary (astronomy)
Cholesteryl ester
Cholesterylester transfer protein
Cite
Citations (31)
ABCG1
Liver X receptor
Reverse cholesterol transport
Efflux
Cite
Citations (3)
Bile is the major route of cholesterol excretion from the body. It is concentrated in the gallbladder, and often results in supersaturation of cholesterol. The high levels of cholesterol in gallbladder bile has clinical implications with respect to cholesterol gallstone formation and cholesterolosis of the gallbladder wall. Gallbladder epithelial cells (GBEC) are exposed to high cholesterol concentrations on their apical surfaces. Therefore, GBEC are uniquely positioned to play an important role in modulating biliary cholesterol concentrations. Recently, it has been documented that the key-transporter for polarized cholesterol and phospholipid efflux in GBEC is ATP-binding cassette transporter A1 (ABCA1) and Liver X receptor (LXR) and retinoid X receptor (RXR) in the nucleus of GBEC have a role that regulates ABCA1 expression. In addition, GBEC synthesize apolipoprotein A-I and E as cholesterol acceptors. These results indicate that GBEC has a perfect system for reverse cholesterol transport. We introduce the roles and mechanisms of ABCA1, scavenger receptor class B-I, LXR and RXR related to reverse cholesterol transport in GBEC with a review of our study experience and related literature.
Reverse cholesterol transport
Liver X receptor
Scavenger Receptor
Apical membrane
Retinoid X receptor
Cite
Citations (6)
Liver X receptor
ABCG1
Reverse cholesterol transport
Cite
Citations (0)
Scavenger Receptor
Foam cell
Reverse cholesterol transport
Hypocholesterolemia
Liver X receptor
High-density lipoprotein
Cite
Citations (39)