The cultivation of rubella virus in avian tissue culture systems, and particularly in RIF-free chick embryo tissue culture, is of importance in the development of safe attenuated rubella virus vaccines for parenteral administration. Nine virulent or attenuated rubella virus strains were propagated for at least 3 passages in RIF-free chick embryo tissue culture or duck embryo tissue culture. Several strains showed growth in duck and chick tissue through the 5th to 7th passages. Highest titers were usually obtained when passages were made at intervals of 7 or more days. Virus titers varied from 1.2 to 4.5 TCIND50 log 10/ml in duck tissue culture at the 5th to 7th passages, and 1.0 to 1.5 TCIND50 log10/ml in chick tissue culture at the 5th passage level. Virus growth was demonstrated in early passages in embryonated duck eggs but no detectable growth was obtained in chick eggs. The propagation of rubella virus in RIF-free chick embryo tissue culture warrants further efforts at the development of an attenuated rubella vaccine in this tissue culture system.
Primary cultures of human fetal brain cells were transfected with plasmid DNA pMK16, containing an origin-defective mutant of simian virus 40 (SV40). Several weeks after DNA treatment, proliferation of glial cells was evident in the culture, allowing passage of the cells at low split ratios. Initially, only 10% of the cells demonstrated nuclear fluorescence staining using a hamster tumor antibody to the SV40 T protein. By the sixth passage, however, 100% of the cells reacted positively to the same antibody. During these early passages, the cells designated SVG began growing very rapidly and acquired a homogeneous morphology. Cell division required only low serum concentrations, was not contact-inhibited, and remained anchorage dependent. These characteristics of the SVG cells have been stable through 25 passages or approximately equal to 80 cell generations. The SV40 T protein is continuously produced in the cells and can direct the replication of DNA inserts in the pSV2 vector, determined by in situ hybridization using biotin-labeled DNA probes, which contains the SV40 replication origin. More importantly, SVG cells support the multiplication of the human papovavirus JCV at levels comparable to primary cultures of human fetal glial cells, producing infectious virus as early as 1 week after viral adsorption. Their brain-cell derivation has been established as astroglial, based on their reactivity with a monoclonal antibody to glial fibrillary acid protein and lack of activity with an anti-galactocerebroside antibody, which identifies oligodendroglial cells. The SVG cells represent a unique line of continuous rapidly growing human fetal astroglial cells that synthesizes a replication-proficient SV40 T protein. Their susceptibility to JC virus (JCV) infection obviates a host restriction barrier that limited JCV studies to primary cultures of human fetal brain and thus should allow for more detailed molecular studies of human brain cells and JCV that infects them.
Adjacent NF-1 and Ac neuronal-specific genes has revealed that many of these have apparent adjacent binding sites for NF-1-and Jun-related proteins.The binding site for these two proteins is located a short distance from the mRNA start site. MATERIALS AND METHODSCell Lines-Primary (8-16 weeks gestation) human fetal glial (HFG) cells, a transformed HFG (SVG) cell line (Major et al., 1985), a glioma (A172) cell line, and HeLa cells were grown in Eagle's minimum essential medium with 10% fetal bovine serun, L-glutamine (0.3 mg/ml), and antibiotics.Cells were grown at 37 "C with 5% Cot in 150 X 25-mm culture dishes and harvested after 3-5 days.DNA Probes and Oligonucleotides-The 368-bp HindIII-AccI DNA fragment used in the binding studies was obtained from the plasmid pJC188,,i which contains only one 98-bp repeat unit (Amemiya et al., 1989).It was labeled with '*Po4 at the 5'-end of the HindIII site with T4 polynucleotide kinase, digested with AccI, gel-purified, and concentrated.The 278-bp AccI-FokI fragment came from pJC582,h, which contains the JCV 582-bp StuI-AccI fragment covering the regulatory region cloned into the EcoRV-AccI site of pBR322.~JC582,,~ was digested with AccI, dephosphorylated, kinased, and digested with FokI to yield the 278-bp AccI-FokI fragment.The 337bp HindIII-ApaI fragment which contained part of the regulatory region of the mouse MBP gene came from the plasmid pJCC138 which was a kind gift from Dr. Lynn Hudson in our laboratory.Oligonucleotides used in this study were prepared essentially as described previously (Amemiya et al., 1989).The following oligonucleotides were used site A/B (34-mer), 5'-GATCTGGAAGGGA TGGCTGCCAGCCAAGCATGAA-3'; site A/Bm (34-mer), 5'-GAT CTGGAAGGGATTACTGCCAGCTGAGCATGAA-3'; site C (38mer), 5'-GATCTAGCTGTTTTGGCTTGTCACCAGCTGGCCAT A-3'; site D (38-mer), 5"AGGATCTAGCTGTTTTGGCTTGTCA CCAGCTGGCCATA-3'; site E (38-mer), 5"GATCTCCATGGT Nuclear Extract Preparation-Nuclear extracts were prepared by the method of Dignam et al. (1983) with the following modifications as described by Dynan (1987).After the nuclei were lysed and extracted, the mixture was centrifuged at 50,000 rpm for at least 60 min.The proteins from the supernatant were precipitated by the addition of solid ammonium sulfate (0.33 g/ml).After stirring the TCTTCGCCAGCTGTCACGTAAGGCTA-3'.A.
This study was designed to determine the incidence of previous and current herpesvirus hominis Type II infections in asymptomatic pregnant women. Sera were obtained from 985 patients for detection of Type I and II herpesvirus hominis antibodies. In addition 770 cervical and 211 amniotic fluid cultures for herpesvirus hominis Type II were performed. Identification of previous herpesvirus hominis infection was determined in 352 patients (35.7%) by calculation of a Type II/I antibody index of 85 or greater. Type II herpesvirus hominis was isolated from five cervical cultures for a 0.65% antepartum incidence of infection. None of the amniotic fluid cultures demonstrated virus. The significance of these findings is discussed.
In an effort to obtain the flexibility and ease of performance of a rapid, serological test for detection of cytomegalovirus antibody, the indirect hemagglutination (IHA) technique was investigated by using a microserological system. Antigens were prepared from tissue cultures of infected human fibroblasts. The specificity of the cytomegalovirus antibody response detected by the IHA test correlated well with the standard neutralization test. The IHA method was more sensitive than the complement fixation test in detecting antibody in congenitally infected newborns. There appeared to be some heterologous antibody response with Herpesvirus hominis or varicella virus infections. The IHA test pattern was found to be very stable with excellent persistence of agglutination.
Primary cultures of human fetal brain cells were transfected with plasmid DNA pMK16, containing an or- igin-defective mutant of simian virus 40 (SV40). Several weeks after DNA treatment, proliferation of glial cells was evident in the culture, allowing passage of the cells at low split ratios. Initially, only 10% of the cells demonstrated nuclear fluores- cence staining using a hamster tumor antibody to the SV40 T protein. By the sixth passage, however, 100% of the cells re- acted positively to the same antibody. During these early pas- sages, the cells designated SVG began growing very rapidly and acquired a homogenous morphology. Cell division re- quired only low serum concentrations, was not contact-inhibit- ed, and remained anchorage dependent. These characteristics of the SVG cells have been stable through 25 passages or -80 cell generations. The SV40 T protein is continuously produced in the cells and can direct the replication of DNA inserts in the pSV2 vector, determined by in situ hybridization using biotin- labeled DNA probes, which contains the SV40 replication ori- gin. More importantly, SVG cells support the multiplication of the human papovavirus JCV at levels comparable to primary cultures of human fetal glial cells, producing infectious virus as early as 1 week after viral adsorption. Their brain-cell deri- vation has been established as astroglial, based on their reac- tivity with a monoclonal antibody to glial fibrillary acid pro- tein and lack of activity with an anti-galactocerebroside anti- body, which identifies oligodendroglial cells. The SVG cells represent a unique line of continuous rapidly growing human fetal astroglial cells that synthesizes a replication-proficient SV40 T protein. Their susceptibility to JC virus (JCV) infec- tion obviates a host restriction barrier that limited JCV studies to primary cultures of human fetal brain and thus should allow for more detailed molecular studies of human brain cells and JCV that infects them.
