Abstract In many cancers, a stem-like cell subpopulation mediates tumor initiation, dissemination and drug resistance. Here, we report that cancer stem cell (CSC) abundance is transcriptionally regulated by C-terminally phosphorylated p27 (p27pT157pT198). Mechanistically, this arises through p27 co-recruitment with STAT3/CBP to gene regulators of CSC self-renewal including MYC , the Notch ligand JAG1 , and ANGPTL4 . p27pTpT/STAT3 also recruits a SIN3A/HDAC1 complex to co-repress the Pyk2 inhibitor, PTPN12 . Pyk2, in turn, activates STAT3, creating a feed-forward loop increasing stem-like properties in vitro and tumor-initiating stem cells in vivo. The p27-activated gene profile is over-represented in STAT3 activated human breast cancers. Furthermore, mammary transgenic expression of phosphomimetic, cyclin-CDK-binding defective p27 (p27CK-DD) increases mammary duct branching morphogenesis, yielding hyperplasia and microinvasive cancers that can metastasize to liver, further supporting a role for p27pTpT in CSC expansion. Thus, p27pTpT interacts with STAT3, driving transcriptional programs governing stem cell expansion or maintenance in normal and cancer tissues.
Abstract p27 is a cell cycle inhibitor and a tumor suppressor. It can also regulate cellular processes including migration and transcription through mechanisms independent of its CDK-inhibitory role. In cancers, p27 C-terminal phosphorylation by PI3K-activated kinases, AKT, RSK1, and SGK1 at T157 and T198 alters p27 protein-protein interactions and shifts p27 from CDK-inhibitor to an oncogene. Previously, our group showed that CDK-binding defective p27pT157pT198 phosphomimetic (p27CK-DD) upregulates epithelial-mesenchymal transition (EMT) and the metastatic potential of cancer cell lines. In addition to its action to promote EMT, p27 appears to promote CSC expansion and or maintenance. Here we demonstrated that C-terminally phosphorylated p27 increases CSC properties, including tumor sphere formation and CSC markers. p27CK-DD increases the expression of several embryonic stem cell transcription factors (ES-TFs), including SOX2, NANOG and cMYC, which are known to drive embryonic stem cell self-renewal and to promote CSC expansion. A human phospho-kinase array showed Pyk2 is activated by p27CK-DD. We demonstrated that Pyk2 activation and its binding to p27 are dependent on phosphorylation of p27 at T198 and T157. Treatment with a Pyk2 inhibitor, and PYK2-knockdown by siRNA or shRNA revealed that Pyk2 is a key mediator of the increase in tumor spheres, ALDH1 activity and ES-TFs in cancer cells expressing abundant C-terminally phosphorylated p27. Pyk2 enhances STAT3 phosphorylation and activation. We identified that C-terminally phosphorylated p27 recruits STAT3 to form p27-Pyk2-STAT3 complex leading to STAT3 activation. p27/STAT3 complexes co-localize to the nucleus and co-occupy chromatin. We confirmed by ChIP-qPCR that p27/STAT3 bind and activate the cMYC promotor. Altogether, in breast cancer cells with high p27pT157pT198 or expressing p27CK−DD, STAT3 is partly activated by Pyk2 and interacts with p27. p27 is a STAT3 coregulator, whose assembly and chromatin association is governed by p27 phosphorylation. These data reveal a novel mechanism whereby p27-driven Pyk2 activation promotes CSC expansion and tumor progression via transcriptionally activation of the STAT3 and its target genes. Citation Format: Seyedehfatemeh Razavipour, Kibeom Jang, Hyunho Yoon, Minsoon Kim, Miyoung Shin, Dekuang Zhao, Joyce Slingerland. p27 transcriptionally coregulates STAT3 to drive cancer stem cells [abstract]. In: Proceedings of the Annual Meeting of the American Association for Cancer Research 2020; 2020 Apr 27-28 and Jun 22-24. Philadelphia (PA): AACR; Cancer Res 2020;80(16 Suppl):Abstract nr 504.
The purpose of the present study is to evaluate the effects of Mental Fitness Positive Psychology; MFPP) program for improvement of adjustment to military life. In the present study, the Mental Fitness program (Kim & Ko, 2009) was adapted for the Korean Army. A total of 78 military soldiers were divided into two groups: the MFPP group (n=35) and control group (n=43). The results of the present study are as follows: relative to the comparison group, the MFPP group showed a significant decrease of military life stress and a significant improvement of adjustment to military life. These results suggest that, in spite of a short-term intervention consisting of 6 weekly sessions, the MFPP program adapted for military soldiers was effective in enhancing soldiers' adjustment to military life. Lastly, the implications of the present study and directions for future research were addressed.
<p>hASC characterization (S1); Co-culture of immature adipocytes with mammary epithelial cells increases pro-inflammatory cytokine expression (S2); Immature adipocyte or cytokine exposure increases abundance of sphere and colony forming cells without changing global cell proliferation (S3); Immature adipocyte or cytokine exposure increases matrigel invasion in vitro and tumor formation, vasculogenesis and metastasis in vivo (S4); Src mediates cytokine effects via ES-TF upregulation affecting soft agar colony growth but not cell cycle progression (S5); Cytokine-mediated increase in sphere formation is Sox2-dependent and miR302b upregulation drives further c-MYC and SOX2 gene expression (S6).</p>
Research Article8 February 2017Open Access Transparent process VEGFA activates an epigenetic pathway upregulating ovarian cancer-initiating cells Kibeom Jang Kibeom Jang Braman Family Breast Cancer Institute at Sylvester Comprehensive Cancer Center, University of Miami Miller School of Medicine, Miami, FL, USA Department of Biochemistry & Molecular Biology, University of Miami Miller School of Medicine, Miami, FL, USA Search for more papers by this author Minsoon Kim Minsoon Kim Braman Family Breast Cancer Institute at Sylvester Comprehensive Cancer Center, University of Miami Miller School of Medicine, Miami, FL, USA Department of Biochemistry & Molecular Biology, University of Miami Miller School of Medicine, Miami, FL, USA Search for more papers by this author Candace A Gilbert Candace A Gilbert Braman Family Breast Cancer Institute at Sylvester Comprehensive Cancer Center, University of Miami Miller School of Medicine, Miami, FL, USA Search for more papers by this author Fiona Simpkins Fiona Simpkins Braman Family Breast Cancer Institute at Sylvester Comprehensive Cancer Center, University of Miami Miller School of Medicine, Miami, FL, USA Department of Obstetrics & Gynecology, University of Miami Miller School of Medicine, Miami, FL, USA Search for more papers by this author Tan A Ince Tan A Ince orcid.org/0000-0003-0315-6425 Braman Family Breast Cancer Institute at Sylvester Comprehensive Cancer Center, University of Miami Miller School of Medicine, Miami, FL, USA Department of Pathology, University of Miami Miller School of Medicine, Miami, FL, USA Interdisciplinary Stem Cell Institute, University of Miami Miller School of Medicine, Miami, FL, USA Search for more papers by this author Joyce M Slingerland Corresponding Author Joyce M Slingerland [email protected] orcid.org/0000-0003-1487-8554 Braman Family Breast Cancer Institute at Sylvester Comprehensive Cancer Center, University of Miami Miller School of Medicine, Miami, FL, USA Department of Biochemistry & Molecular Biology, University of Miami Miller School of Medicine, Miami, FL, USA Department of Medicine, University of Miami Miller School of Medicine, Miami, FL, USA Search for more papers by this author Kibeom Jang Kibeom Jang Braman Family Breast Cancer Institute at Sylvester Comprehensive Cancer Center, University of Miami Miller School of Medicine, Miami, FL, USA Department of Biochemistry & Molecular Biology, University of Miami Miller School of Medicine, Miami, FL, USA Search for more papers by this author Minsoon Kim Minsoon Kim Braman Family Breast Cancer Institute at Sylvester Comprehensive Cancer Center, University of Miami Miller School of Medicine, Miami, FL, USA Department of Biochemistry & Molecular Biology, University of Miami Miller School of Medicine, Miami, FL, USA Search for more papers by this author Candace A Gilbert Candace A Gilbert Braman Family Breast Cancer Institute at Sylvester Comprehensive Cancer Center, University of Miami Miller School of Medicine, Miami, FL, USA Search for more papers by this author Fiona Simpkins Fiona Simpkins Braman Family Breast Cancer Institute at Sylvester Comprehensive Cancer Center, University of Miami Miller School of Medicine, Miami, FL, USA Department of Obstetrics & Gynecology, University of Miami Miller School of Medicine, Miami, FL, USA Search for more papers by this author Tan A Ince Tan A Ince orcid.org/0000-0003-0315-6425 Braman Family Breast Cancer Institute at Sylvester Comprehensive Cancer Center, University of Miami Miller School of Medicine, Miami, FL, USA Department of Pathology, University of Miami Miller School of Medicine, Miami, FL, USA Interdisciplinary Stem Cell Institute, University of Miami Miller School of Medicine, Miami, FL, USA Search for more papers by this author Joyce M Slingerland Corresponding Author Joyce M Slingerland [email protected] orcid.org/0000-0003-1487-8554 Braman Family Breast Cancer Institute at Sylvester Comprehensive Cancer Center, University of Miami Miller School of Medicine, Miami, FL, USA Department of Biochemistry & Molecular Biology, University of Miami Miller School of Medicine, Miami, FL, USA Department of Medicine, University of Miami Miller School of Medicine, Miami, FL, USA Search for more papers by this author Author Information Kibeom Jang1,2, Minsoon Kim1,2, Candace A Gilbert1, Fiona Simpkins1,3,7, Tan A Ince1,4,5 and Joyce M Slingerland *,1,2,6 1Braman Family Breast Cancer Institute at Sylvester Comprehensive Cancer Center, University of Miami Miller School of Medicine, Miami, FL, USA 2Department of Biochemistry & Molecular Biology, University of Miami Miller School of Medicine, Miami, FL, USA 3Department of Obstetrics & Gynecology, University of Miami Miller School of Medicine, Miami, FL, USA 4Department of Pathology, University of Miami Miller School of Medicine, Miami, FL, USA 5Interdisciplinary Stem Cell Institute, University of Miami Miller School of Medicine, Miami, FL, USA 6Department of Medicine, University of Miami Miller School of Medicine, Miami, FL, USA 7Present address: Department of Obstetrics & Gynecology, University of Pennsylvania, Philadelphia, PA, USA *Corresponding author. Tel: +1 305 243 7265; Fax: +1 305 243 6170; E-mail: [email protected] EMBO Mol Med (2017)9:304-318https://doi.org/10.15252/emmm.201606840 PDFDownload PDF of article text and main figures. Peer ReviewDownload a summary of the editorial decision process including editorial decision letters, reviewer comments and author responses to feedback. ToolsAdd to favoritesDownload CitationsTrack CitationsPermissions ShareFacebookTwitterLinked InMendeleyWechatReddit Figures & Info Abstract The angiogenic factor, VEGFA, is a therapeutic target in ovarian cancer (OVCA). VEGFA can also stimulate stem-like cells in certain cancers, but mechanisms thereof are poorly understood. Here, we show that VEGFA mediates stem cell actions in primary human OVCA culture and OVCA lines via VEGFR2-dependent Src activation to upregulate Bmi1, tumor spheres, and ALDH1 activity. The VEGFA-mediated increase in spheres was abrogated by Src inhibition or SRC knockdown. VEGFA stimulated sphere formation only in the ALDH1+ subpopulation and increased OVCA-initiating cells and tumor formation in vivo through Bmi1. In contrast to its action in hemopoietic malignancies, DNA methyl transferase 3A (DNMT3A) appears to play a pro-oncogenic role in ovarian cancer. VEGFA-driven Src increased DNMT3A leading to miR-128-2 methylation and upregulation of Bmi1 to increase stem-like cells. SRC knockdown was rescued by antagomir to miR-128. DNMT3A knockdown prevented VEGFA-driven miR-128-2 loss, and the increase in Bmi1 and tumor spheres. Analysis of over 1,300 primary human OVCAs revealed an aggressive subset in which high VEGFA is associated with miR-128-2 loss. Thus, VEGFA stimulates OVCA stem-like cells through Src-DNMT3A-driven miR-128-2 methylation and Bmi1 upregulation. Synopsis VEGFA is not only a key mediator of angiogenesis during tumor progression, but can also act to expand the population of ovarian cancer-initiating cells with stem-like properties. VEGFA increases sphere formation and ALDH1 activity of ovarian cancer cells in vitro and stimulates ovarian tumor-initiating cells in vivo. VEGFA rapidly activates VEGFR2 and Src to upregulate DNMT3 expression. DNMT3A plays a pro-oncogenic role to methylate miR-128-2 leading to Bmi1 and OVCA stem-like cell upregulation. High VEGFA and decreased miR-128-2 associate with poor ovarian cancer outcome. Introduction Developing cancers rapidly outstrip the diffusion capacity of nutrients and oxygen and must form new blood vessels via angiogenesis (Bergers & Benjamin, 2003). They must also maintain self-renewal capacity despite adverse conditions of suboptimal pH, nutrient, and oxygen availability. Vascular endothelial growth factor A, VEGFA, is a key angiogenic factor that alters the endothelial cell niche to promote new vessel formation (Bergers & Benjamin, 2003). In various cancers, VEGFA stimulates not only angiogenesis but also tumor growth, metastasis, and survival (Wu et al, 2006; Hu et al, 2007; Paez-Ribes et al, 2009). The importance of VEGFA in angiogenesis and its frequent upregulation in human cancers (Goel & Mercurio, 2013) stimulated development of VEGF- and VEGF receptor-targeted therapies. The monoclonal antibody, bevacizumab, blocks VEGFA interaction with receptors VEGFR1 and 2 (Ferrara, 2004). Despite initial promise, VEGF-targeted therapies have shown limited efficacy, with short responses in most solid tumors (Eskander & Tewari, 2014). Hypoxia resulting from inhibition of angiogenesis upregulates VEGFA expression, contributing to aggressive disease recurrence and angiogenic therapy failure (Ebos et al, 2009; Paez-Ribes et al, 2009). In ovarian cancer, bevacizumab significantly increases progression-free survival (PFS) compared with chemotherapy alone in advanced disease, and more recently VEGFR-targeting agents were shown to significantly increase PFS (Eskander & Tewari, 2014) and overall survival (OS; Witteveen et al, 2013). Bevacizumab is approved for use with non-platinum chemotherapy in Europe and the USA for platinum-resistant ovarian cancer; however, reponses are of short duration and resistance rapidly emerges (Eskander & Tewari, 2014). Increasing evidence indicates that cancer stem-like cells (CSCs) comprise a distinct self-renewing subpopulation that can generate cancerous progeny with reduced replicative potency (Dalerba et al, 2007). CSCs are important therapeutic targets: they may not only initiate tumors but also mediate recurrence and metastasis (Magee et al, 2012). Most anticancer drugs kill the bulk cancer population. CSCs either proliferate too slowly for targeting by cycle active drugs, or escape chemotherapy by drug expulsion or greater DNA repair, leading to recurrence (Magee et al, 2012). CSCs share properties with normal tissue stem cells, expressing discrete surface markers and forming spheres when seeded at single cell density (Visvader & Lindeman, 2012). Subpopulations of many malignancies, including OVCA, with aldehyde dehydrogenase 1 activity (ALDH1+) are enriched for CSC properties in vitro and the ability to initiate tumors in immunocompromised mice (Ginestier et al, 2007; Landen et al, 2010). Several surface markers have been proposed to characterize OVCA stem-like cells (Shah & Landen, 2014). The ALDH1+ subpopulation of primary ovarian cancers (Stewart et al, 2011) and in OVCA lines (Silva et al, 2011; Shah & Landen, 2014) is enriched in tumor-initiating cells in vivo and by prior chemotherapy exposure (Landen et al, 2010). While certain cytokines increase CSC and enhance tumor initiation in vivo (Zhao et al, 2014), extracellular growth factors and signaling pathways that stimulate CSC expansion are poorly characterized. A greater understanding of pathways governing CSC may permit the design of more effective anticancer treatments. VEGFA is not only a potent angiogenic factor, it also stimulates stem-like cells in both normal and cancer tissues. VEGFA maintains normal stem cell populations in hemopoietic (Gerber et al, 2002), endothelial (Kane et al, 2011), and neuronal tissues (Calvo et al, 2011). VEGFA was recently shown to increase tumor-initiating stem-like cells in skin and breast cancers (Beck et al, 2011; Goel et al, 2013; Zhao et al, 2014). Pathways activated by VEGFA that increase cancer stem-like cells and tumor initiation are largely uncharacterized. Since VEGFA is frequently overexpressed in OVCA (Yu et al, 2013) and VEGF/VEGFR-targeted therapies have significant activity in this cancer (Eskander & Tewari, 2014), we investigated whether VEGFA drives ovarian CSC expansion and sought to identify targetable pathways mediating these effects. MicroRNAs (miRNAs) are increasingly implicated in CSC regulation (Takahashi et al, 2014). These small non-coding RNAs bind the 3′ untranslated region (3′ UTR) of target genes to inhibit gene expression. miRNAs regulate targets essential for normal and malignant stem-like cell self-renewal (Takahashi et al, 2014) and are often misregulated in cancer (Croce,2009). Oncogenic miRNAs target tumor suppressors and increase drug resistance and metastasis. In contrast, tumor suppressor miRNAs are frequently downregulated in cancer (Croce, 2009). Here, we investigated the role of VEGFA as a driver of stem-like cell expansion in OVCA. This work reveals a novel pathway linking VEGFA to miRNA-dependent CSC regulation. We show that VEGFA activates Src and induces DNMT3A to methylate miR-128-2, leading to increased Bmi1 and OVCA stem-like cell expansion. Results VEGFA increases sphere formation and ALDH1 activity in OVCA populations While VEGFA is an angiogenic agent and therapeutic target in OVCA, the possibility that the limited effects of VEGF-targeted therapies and emergence of resistance might be due, in part, to VEGFA effects on ovarian CSC has not been evaluated. To investigate whether VEGFA stimulates ovarian CSCs, we used three models. Since > 60% of OVCAs express the estrogen receptor α (ER), we used the well-established ER+ line, PEO1R, derived from human high-grade serous OVCA ascites (Langdon et al, 1994). Results were validated using an ER- high-grade serous human OVCAR8 line (Slayton, 1984; Domcke et al, 2013). Since OVCA lines diverge from primary tumors over time (Ince et al, 2015) and since OVCA may represent different cancers with different molecular origins, results were validated using early-passage OCI-C5X, a primary OVCA culture derived from a clear cell OVCA. OCI-C5X faithfully represents the molecular and cellular phenotype of the original patient's clear cell tumor and is one of 25 new ovarian cancer cultures established by Ince by immediate culture of primary cancer in Ovarian Carcinoma Modified Ince medium, OCMI (Ince et al, 2015). Sphere formation from a single CSC seeded in low adhesion conditions is a measure of stem-like cell abundance in vitro (Visvader & Lindeman, 2012). Prior work showed VEGFA and a network of pro-inflammatory cytokines increase breast CSC abundance, but required prolonged exposure for full effect (Zhao et al, 2014; Picon-Ruiz et al, 2016). VEGFA (10 ng/ml) effects were assayed over short- and long-term exposures (1, 3, and 7 days). A 7-day exposure, but not shorter intervals, significantly increased sphere formation by PEO1R, OVCAR8, and OCI-C5X cells seeded without further VEGFA. All sphere assays were carried out in limiting dilutions and sphere formation could not be accounted for by aggregation. VEGFA-blocking antibody, bevacizumab, and 2C3 antibody that blocks VEGFR2 both inhibited VEGFA-stimulated sphere formation (Fig 1A). Neither antibody alone decreased baseline sphere formation, suggesting VEGFA does not drive basal CSC self-renewal, but augments CSC recruitment in these OVCA models. VEGFA was not a mitogen in these models. Cell cycle profiles were not changed by VEGFA exposure for 48 h in 2D and were not affected by 7 days in sphere culture (representative data from OVCAR8, Fig EV1A). Furthermore, the % apoptotic cells in PEO1R as assayed by annexin V staining was unchanged by VEGFA exposure over 7 days (Fig EV1B) and VEGFA did not increase cell numbers over time in unsorted cells (Fig EV1C). Figure 1. VEGFA increases sphere-forming and ALDH1-positive OVCA cellsSee also Fig EV1. Indicated cells were pre-treated for 7 days with either 10 ng/ml VEGFA, VEGFA + 50 μg/ml bevacizumab, VEGFA + 15 μg/ml 2C3, or no cytokine control and plated into sphere assays. Spheres > 75 μm were counted at 14 days for PEO1R and at 21 days for OVCAR8 and OCI-C5X. All assays were performed in triplicate biologic repeats with at least three technical repeats within each assay and graphed data represent mean ± SEM. Differences between multiple treatment groups were compared by ANOVA. PEO1R; *P = 0.0003, **P = 0.23, ‡P = 0.24, OVCAR8; *P = 0.0022, **P = 0.85, ‡P = 0.41, OCI-C5X; *P = 0.0051, **P = 0.55, ‡P = 0.38. Cells were treated with ± VEGFA for 7 days and the proportion of ALDEFLUOR positive (% ALDH1+) assayed by flow cytometry and mean ± SEM graphed for repeat assays. ALDH1+ cells in controls versus VEGFA-treated cells were compared by Student's t-test. PEO1R; *P = 0.000003, OVCAR8; *P = 0.0033, OCI-C5X; *P = 0.00048. Download figure Download PowerPoint Click here to expand this figure. Figure EV1. VEGFA does not change cell cycle, apoptosis or cell proliferation The cell cycle distributions of OVCAR8 cells treated without (control) or with VEGFA in 2-day culture over 7 days (top) or assayed from dissociated OVCAR8 spheres formed ± VEGFA (bottom panel). Similar findings were observed with PEO1R cells (not shown). PEO1R cells were treated with or without VEGFA for 7 days and then recovered for annexin V-FITC/PI flow cytometric analysis to quantitate the % of apoptotic cells. Positive control cells were treated with 200 nM paclitaxel. *P = 0.0001. Equal numbers (10,000 cells) of PEO1R and OVCAR8 cells were plated into 2-day culture ± VEGFA, and viable cells were counted every 2 days. Triplicate repeat data show no difference in population growth between groups over 8 days. Data information: All graphed data show mean ± SEM for at least 3 different biologic experiments with at least three technical repeats within each assay. Differences between multiple treatment groups were compared by ANOVA. Download figure Download PowerPoint The ALDH1+ population of OVCA lines (Silva et al, 2011; Shah & Landen, 2014) and primary tumors (Stewart et al, 2011) is enriched for CSC in vitro and tumor-initiating cells in vivo. VEGFA exposure increased ALDH1+ cell abundance in all three models, including early-passage OCI-C5X culture (Ince et al, 2015; Fig 1B). Thus, prolonged VEGFA exposure increases the abundance of sphere forming and ALDH1+. VEGFA increases expression of the stem-like cell regulator Bmi1 Several embryonic stem cell transcription factors (ES-TFs) govern embryonic stem cells (ES) self-renewal, induce pluripotency in skin fibroblasts (Li et al, 2010), and have been implicated in CSC self-renewal in a number of different cancers (Zhang et al, 2008). B cell-specific Moloney murine leukemia virus integration site 1 (Bmi1) is part of the polycomb-repressive complex 1 (PRC1) that regulates chromatin remodeling during development (Siddique & Saleem, 2012). Bmi1 promotes normal hematopoietic and neural stem cell expansion (Park et al, 2003; Molofsky et al, 2005) and can upregulate malignant stem-like cells in part through changes in ES-TFs (Lessard & Sauvageau, 2003; Siddique & Saleem, 2012). Bmi1 has been shown to be upregulated in cancers, including OVCA (Siddique & Saleem, 2012), but its role in ovarian CSC expansion has not been established. To assay their potential involvement in VEGFA-stimulated ALDH1 activity and sphere formation, we tested VEGFA effects on Bmi1 and ES-TFs in PEO1R, OVCAR8, and OCI-C5X. Basal Bmi1 levels were increased by 6 h and remained elevated at 7 days (Fig 2A, left). Densitometry of Western blots on repeat assays showed Bmi1 protein increased by 2.0 ± 0.02 fold in PEO1R, 4.7 ± 0.1 fold in OVCAR8, and 1.9 ± 0.09 fold in OCI-C5X after 7 days of VEGF exposure. Notably, while VEGFA also increased ES-TF levels, including cMyc (by 3.5 ± 0.1 fold by day 1), Oct4 (2.2 ± 0.06 fold, day 2), and Klf4 (4.1 ± 0.3 fold day 2; Fig EV2), these rose after the increase in Bmi1. Thus, we assayed the role of Bmi1 in VEGFA-mediated ovarian CSC effects. Figure 2. VEGFA increases OVCA sphere formation via Src-mediated Bmi1 upregulation. VEGFA effects on indicated proteinsSee also Figs EV2 and EV3. A, B. Bmi1 (A), and total and Y416-phosphorylated Src (pSrc) (B), at times indicated. C. Cells were treated for 7 days with or without VEGFA, ± Src inhibition by 1 μM saracatinib (AZD0530) during the last 48 h. Western blots show Src, pSrc, and Bmi1 levels. D. Cells were transduced with siRNA BMI1 or scrambled controls 48 h prior to VEGFA treatment for 7 days and then recovered for Western blot. E. Cells were transduced with either siBMI1 or control siRNA for 48 h prior to VEGFA addition for 7 days (± siBMI1) or treated with VEGFA for 7 days with or without Src inhibitor (AZD0530, 1 μM) during the last 48 h followed by a 2-day washout without drug or cytokine prior to plating of spheres into limiting dilution sphere formation. All graphed data show mean ± SEM for at least 3 different biologic experiments with at least three technical repeats within each assay. Differences between multiple treatment groups were compared by ANOVA. PEO1R; 1,000 cells: *P < 0.0001, **P < 0.0001, ‡P < 0.0001, #P < 0.0001, †P < 0.0001, 500 cells: *P < 0.0001, **P = 0.0002, ‡P = 0.001, #P = 0.003, †P = 0.0143, OVCAR8; 2,500 cells: *P < 0.0001, **P = 0.0328, ‡P = 0.0297, #P = 0.6599, †P = 0.5492, 1,250 cells: *P = 0.0001, **P = 0.9344, ‡P = 0.9889, #P = 0.88954, †P = 0.5744, OCI-C5X; 4,000 cells: *P < 0.0001, **P = 0.0381, ‡P = 0.0381, #P = 0.2128, †P = 0.0545, 2,000 cells: *P = 0.0008, **P = 0.9399, ‡P = 0.6718, #P = 0.2289, †P = 0.3716. Download figure Download PowerPoint Click here to expand this figure. Figure EV2. VEGFA effects on embryonic stem cell transcription factorsWestern blot of VEGFA effects on indicated proteins in PEO1R cells at indicated times in hours (h) or days (D). Download figure Download PowerPoint Increased sphere formation after VEGFA exposure is Src- and Bmi1-dependent Src is frequently overexpressed in human OVCA (Simpkins et al, 2012) and promotes tumor growth (Kim et al, 2009). Since Src was recently shown to mediate cytokine-driven CSC upregulation (Picon-Ruiz et al, 2016), we tested its potential as a mediator of effects of VEGFA on stem-like cells. VEGFA caused sustained Src activation with an increase in pSrc of 4.1 ± 0.42 fold in PEO1R, and 4.8 ± 0.08 fold in OVCAR8 and 1.8 ± 0.04 fold in OCI-C5X within 7 days (Fig 2B). Src inhibition by saracatinib (AZD0530) downregulated basal Bmi1 levels. Furthermore, saracatinib addition during the last 48 h of a 7-day VEGFA exposure prevented the increase in Bmi1 by VEGFA in all three ovarian models (Fig 2C). To test effects of Src inhibition on the sphere-forming population, cells were treated with AZD0530 in the last 48 h of a 7-day VEGFA exposure, followed by a 2-day washout to allow recovery of asynchronous cycling prior to seeding into sphere assays (Fig EV3A). Src inhibition followed by drug washout and prior BMI1 siRNA knockdown (Fig 2D) each decreased sphere formation below that of controls and prevented the VEGFA-mediated increase in sphere formation in both lines, and in OCI-C5X primary culture (Fig 2E). This loss of sphere formation could not be attributed to changes in cell cycling or viability, since neither BMI1 knockdown nor Src inhibition followed by washout-affected cell cycle profiles or viable cell numbers of cells prior to seeding (Fig EV3A and B). Thus, Src kinase action appears to govern basal Bmi1 expression and both are required for the VEGFA-mediated increase in sphere formation. Click here to expand this figure. Figure EV3. Cell cycle distribution and viability of cells used in sphere assays and/or in tumor-initiating stem cell assays Cell cycle distribution was assayed immediately prior to plating into sphere formation or prior to injection into nude mice for limiting dilution stem cell assays. Cells were recovered for cell cycle distribution after either 7 days of VEGFA followed by 2 days without cytokine (VEGFA), or after 7-day treatment with VEGFA with AZD0530 added for 48 h (days 6 and 7) prior to a 2-day washout without cytokine or AZD0530 (AZD0530 + washout). siBMI1 cells were transfected with siBMI1 for 48 h prior to addition of VEGFA for 7 days and followed by 2 days without cytokine. While AZD0530 (1 μM) over 48 h caused partial G1 arrest (AZD0530), cells return to asynchronous cycling after a 2-day washout without AZD0530 (AZD0530 + washout). PEO1R cell viability was not changed by 1 week of VEGFA exposure with or without either Src inhibition in the last 48 h of treatment, or by prior knockdown of Bmi1 48 h prior to addition of VEGFA. All graphed data show mean ± SEM for at least 3 different biologic experiments with at least three technical repeats within each assay. Download figure Download PowerPoint VEGFA increases ovarian tumor-initiating cells via Bmi1 in vivo Effects of VEGFA and Bmi1 on ovarian tumor-initiating cell abundance were further investigated in vivo. Limiting dilution tumor-initiating cell assays, injecting between 100 and 100,000 cells, showed that sustained VEGFA exposure over 7 days prior to injection increased PEO1R tumor-initiating cell abundance. Ex vivo exposure to VEGFA decreased tumor latency and more animals formed tumors from VEGFA-exposed cells than from cells without VEGFA pre-treatment. BMI1 knockdown prevented the VEGFA-mediated increase in tumor-initiating cell abundance (Fig 3A). Note that VEGFA was not a mitogen in this model and did not affect apoptosis (Fig EV1). BMI1 siRNA did not impair proliferation or viability (Fig EV3). The tumor-initiating cell frequency in VEGFA-exposed cells was 1/2,018, compared with 1/21,607 in non-VEGFA-exposed cells and 1/20,313 in VEGFA-exposed cells pre-treated with siRNA to BMI1, as calculated by L-Calc™ Limiting Dilution Software (Fig 3B). Thus, VEGFA increases tumor-initiating OVCA cell abundance in vivo and this is Bmi1 dependent. Figure 3. The VEGFA-mediated increase in OVCA-initiating stem-like cell abundance in vivo is Bmi1 dependent Tumor formation from limiting dilutions of inoculated cells (100,000, 10,000, 1,000, 100 cells) is graphed as % of tumor-free animals/time (weeks). Tumor formation is tabulated and T-ISC frequency is calculated. Download figure Download PowerPoint VEGFA repression of miR-128-2 is Src dependent Bmi1 is regulated by miR-128, a 21 nucleotide (ucacagugaaccggucucuuu) that targets the BMI1 3′ UTR (Godlewski et al, 2008; Zhu et al, 2011; Jin et al, 2014). Mature miR-128 is encoded by two miRs, miR-128-1 and miR-128-2. qPCR with primers that distinguish pre-miR-128-1 and pre-miR-128-2 showed that VEGFA significantly reduced miR-128-2 but not miR-128-1 expression after 7 days (Fig EV4). Since pre-miRs are unstable and less abundant, subsequent work used primers to detect mature miR-128. VEGFA downregulated miR-128 in all OVCA models (Fig 4A). To test whether VEGFA relieves miR-128 targeting of the BMI1 3′ UTR, VEGFA-exposed and control cells were transfected with a BMI1 3′ UTR luciferase reporter. VEGFA increased BMI1 3′ UTR luciferase reporter activity in both OVCA lines and in OCI-C5X (Fig 4B). Thus, Bmi1 upregulation by VEGFA results from decreased inhibitory occupancy of the BMI1 3′ UTR. Click here to expand this figure. Figure EV4. VEGFA decreases miR-128-2 expression but not that of miR-128-1PEO1R cells were treated with VEGFA for 7 days and then miR-128-1 and miR-128-2 levels assayed by qPCR. Data are graphed as mean ± SEM. All assays were performed in triplicate biologic experiments with at least three technical repeats within each assay. Differences between two groups were assayed by Student's t-test. *P = 0.00011. Download figure Download PowerPoint Figure 4. VEGFA downregulates miR-128 expression in a Src-dependent manner VEGFA treatment for 7 days decreases miR-128 expression as assayed by qPCR. *P = 0.03, **P = 0.0000003, ‡P = 0.01. VEGFA increases BMI1 3′ UTR luciferase activity. *P = 0.00015, **P = 0.00046, ‡P = 0.0022. Effects of VEGFA alone, of saracatinib (AZD0530, 1 μM) alone, or saracatinib added during the final 48 h of 7-day VEGFA treatment on miR-128 expression compared with mock-treated controls (Ctrl). PEO1R; *P = 0.0005, **P = 0.0005, ‡P = 0.5522, OVCAR8; *P = 0.0359, **P < 0.0001, ‡P < 0.0001, OCI-C5X; *P = 0.0064, **P = 0.0113, ‡P = 0.017. Effects of VEGFA alone for 7 days, of siRNA to SRC (siSRC) alone, or siSRC transfection 48 h prior to addition VEGFA for 7 days on miR-128 expression compared with mock-treated controls (Ctrl). PEO1R; *P = 0.019, **P = 0.0008, ‡P = 0.047, OCI-C5X; *P = 0.027, **P = 0.016, ‡P = 0.024. Cells were transduced with either siSRC or control siRNA for 48 h prior to VEGFA addition for 7 days (± siSRC), or treated with antagomiR-128 for 48 h with or without siSRC and plated into sphere assays. *P = 0.0026, **P = 0.052, ‡P = 0.076, #P = 0.0014, †P = 0.014. AntagomiR-128 decreases miR-128 expression as assayed by qPCR. *P = 0.012. Effects of 7 days of VEGFA ± 1 μM 5′-azacytidine (5′aza) on miR-128 expression in lines indicated. PEO1R; *P = 0.0451, **P < 0.0001, ‡P < 0.0001, OCI-C5X; *P = 0.0048, **P = 0.0003, ‡P = 0.0033. Data information: All graphed data show mean ± SEM for at least 3 different biologic experiments with at least three technical repeats within each assay. Differences between two groups were assayed by Student's t-test, and multiple treatment groups were compared by ANOVA. See also Fig EV4. Download figure Download PowerPoint To test whether Src activation drives VEGFA-mediated miR-128 loss, cells were treated with or without VEGFA, and with or without saracatinib (AZD0530). Saracatinib increased basal miR-128 and abrogated miR-128 downregulation by VEGFA in all three models (Fig 4C). Effects of the Src family kinase inhibitor, saracatinib, were verified using siRNA-mediated SRC knockdown. Since saracatinib effectively inhibits several Src kinase family members, the requirement for Src was verified using SRC knockdown by siRNA with three different oligonucleotides. SRC knockdown increased basal miR-128 expression, and SRC siRNA transfection 48 h prio
'/%3e%3cpath fill='%23c8b100' stroke='none' d='M166.42 264.65c1.99-.72 3.29-1.58 2.66-3.14-.41-1-1.43-1.19-2.97-.63l-2.71.99 2.44 6.03c.27-.12.54-.24.81-.34.28-.1.57-.18.85-.26l-1.08-2.64v-.01zm-1.18-2.91.69-.25c.57-.21 1.21.1 1.5.8.21.53.16 1.13-.5 1.55-.21.13-.46.23-.7.33l-.99-2.43m7.54-2.52c-.29.08-.57.16-.86.22-.29.05-.59.09-.88.12l1.41 6.28 4.38-.88c-.05-.12-.12-.26-.14-.38-.03-.14-.03-.28-.04-.41-.77.22-1.61.46-2.61.66l-1.26-5.61m8.78 5.41c.82-2.28 1.82-4.46 2.81-6.67-.18.03-.36.06-.54.07s-.37.01-.54 0c-.53 1.61-1.18 3.21-1.87 4.8-.82-1.51-1.73-2.99-2.43-4.51-.34.04-.69.09-1.03.12-.34.02-.7.01-1.04.02 1.26 2.06 2.48 4.11 3.64 6.23.16-.03.32-.06.5-.08.16-.01.33.01.5.02m9.16-4.83c.15-.31.31-.6.48-.89-.24-.22-.96-.55-1.81-.63-1.79-.18-2.81.61-2.93 1.69-.26 2.26 3.31 2.07 3.14 3.57-.07.64-.75.9-1.48.83-.81-.08-1.41-.53-1.51-1.19l-.22-.02c-.12.39-.29.77-.48 1.15.53.34 1.21.53 1.85.59 1.83.19 3.22-.54 3.35-1.74.23-2.15-3.37-2.27-3.23-3.54.06-.53.47-.88 1.4-.79.67.07 1.08.43 1.26.95l.18.02m119.58 5.18c.62-2.33 1.41-4.58 2.19-6.87-.17.05-.35.09-.53.11-.17.03-.36.04-.54.05-.37 1.64-.88 3.29-1.42 4.94-.96-1.44-2-2.84-2.83-4.3-.34.07-.68.15-1.02.2s-.69.07-1.04.11c1.45 1.94 2.85 3.89 4.2 5.91.16-.04.32-.1.5-.12.16-.02.33-.02.49-.03m6.18-6.82c-.29.01-.59.04-.88.03-.3 0-.6-.04-.89-.06l-.12 6.41 4.49.08c-.03-.13-.06-.28-.06-.41s.04-.27.07-.4c-.81.05-1.68.1-2.71.08l.1-5.73m7.04 1.05c.72.06 1.41.19 2.1.31-.01-.13-.03-.27-.02-.41.01-.13.06-.26.1-.39l-6.07-.5c.01.14.03.27.02.4-.01.14-.06.27-.1.4.62-.02 1.37-.02 2.21.05l-.53 5.77c.29 0 .59 0 .88.03.3.02.59.07.88.11l.53-5.77m2.49 6.32c.29.05.59.09.88.15.28.06.57.15.85.23l.72-2.94.08.01c.16.41.38.9.49 1.19l.9 2.22c.36.06.71.11 1.05.18.36.08.7.18 1.04.28l-.31-.67c-.48-1-.99-2.01-1.41-3.02 1.12.04 1.98-.36 2.2-1.26.15-.62-.1-1.11-.68-1.53-.44-.31-1.28-.47-1.83-.6l-2.44-.53-1.54 6.29m3.14-5.42c.71.16 1.59.27 1.59 1.07-.01.21-.03.35-.06.48-.23.94-.94 1.26-2.13.91l.6-2.46m8.42 7.35c-.05.69-.18 1.37-.31 2.1.3.14.61.27.9.44.3.16.57.34.86.52l.6-7.23c-.14-.06-.27-.12-.41-.19-.13-.07-.25-.15-.37-.24l-6.38 4.05c.17.08.35.16.51.25.17.09.31.19.47.28.54-.45 1.1-.82 1.74-1.3l2.39 1.31v.01zm-1.81-1.66 2.13-1.37-.25 2.4-1.88-1.03'/%3e%3cpath fill='%23ad1519' stroke-width='.26' d='M249.65 182.72c6.64 0 12.56.99 16.41 2.51 2.2 1 5.16 1.73 8.4 2.17 2.47.33 4.81.39 6.85.24 2.73-.06 6.67.74 10.62 2.48 3.26 1.45 5.99 3.21 7.8 4.91l-1.57 1.4-.45 3.96-4.3 4.92-2.15 1.83-5.09 4.07-2.6.21-.79 2.25-32.91-3.86-33.02 3.86-.79-2.25-2.61-.21-5.08-4.07-2.15-1.83-4.3-4.92-.44-3.96-1.58-1.4c1.82-1.7 4.54-3.46 7.8-4.91 3.95-1.74 7.89-2.54 10.62-2.48 2.04.15 4.38.09 6.85-.24 3.24-.44 6.2-1.17 8.4-2.17 3.86-1.52 9.44-2.51 16.08-2.51z'/%3e%3cg fill='%23c8b100'%3e%3cpath d='m225.34 191.42 1.38 1.11 2.08-3.4c-2.25-1.38-3.8-3.78-3.8-6.51 0-.31.02-.61.06-.91.21-4.34 5.5-7.92 12.2-7.92 3.48 0 6.63.95 8.84 2.48.06-.67.12-1.25.21-1.86-2.43-1.42-5.6-2.28-9.05-2.28-7.71 0-13.74 4.39-14.03 9.57-.03.31-.05.61-.05.92 0 2.76 1.26 5.26 3.26 6.99l-1.1 1.81'/%3e%3cpath d='M225.43 191.46c-2.63-1.97-4.27-4.64-4.27-7.58 0-3.38 2.22-6.4 5.58-8.41-2.07 1.67-3.33 3.83-3.51 6.23-.03.31-.05.61-.05.92 0 2.76 1.26 5.26 3.26 6.99l-1.01 1.85'/%3e%3cpath d='M202.21 194.89c-1.48-1.65-2.38-3.79-2.38-6.12 0-1.41.33-2.75.91-3.95 2.13-4.38 8.82-7.57 16.76-7.57 2.16 0 4.23.23 6.14.67-.42.46-.75.97-1.08 1.48-1.59-.31-3.29-.48-5.06-.48-7.27 0-13.36 2.83-15.12 6.65a7.33 7.33 0 0 0-.73 3.2c0 2.32 1.09 4.4 2.79 5.82l-2.63 4.3-1.41-1.12 1.81-2.88z'/%3e%3cpath d='M204.9 180.48c-1.91 1.21-3.36 2.69-4.16 4.34-.58 1.2-.91 2.54-.91 3.95 0 2.33.9 4.47 2.38 6.12l-1.6 2.59c-1.53-1.96-2.42-4.26-2.42-6.7 0-4.2 2.67-7.87 6.71-10.3zm45.14-9.21c1.76 0 3.28 1.16 3.64 2.73.23 1.38.38 2.95.41 4.62.01.18-.01.35-.01.52 0 .2.04.41.05.61.06 3.52.56 6.62 1.27 8.52l-5.36 5.14-5.43-5.14c.72-1.9 1.22-5 1.29-8.52 0-.2.04-.41.04-.61 0-.17-.01-.34-.01-.52.03-1.67.18-3.24.41-4.62.36-1.57 1.94-2.73 3.7-2.73z'/%3e%3cpath d='M250.04 172.94c.91 0 1.68.58 1.87 1.39.23 1.31.37 2.8.4 4.38 0 .16-.01.32-.01.48 0 .2.03.39.04.59.05 3.32.53 6.25 1.21 8.05l-3.54 3.35-3.54-3.35c.67-1.8 1.15-4.73 1.21-8.05 0-.2.04-.39.04-.59 0-.16-.01-.32-.01-.48.03-1.58.17-3.07.4-4.38.18-.81 1.02-1.39 1.93-1.39zm24.66 18.48-1.39 1.11-2.08-3.4c2.26-1.38 3.81-3.78 3.81-6.51 0-.31-.02-.61-.06-.91-.21-4.34-5.5-7.92-12.2-7.92-3.49 0-6.63.95-8.84 2.48-.06-.67-.12-1.25-.22-1.86 2.44-1.42 5.6-2.28 9.06-2.28 7.71 0 13.74 4.39 14.03 9.57.03.31.05.61.05.92 0 2.76-1.27 5.26-3.27 6.99l1.11 1.81'/%3e%3cpath d='M274.61 191.46c2.63-1.97 4.27-4.64 4.27-7.58 0-3.38-2.22-6.4-5.58-8.41 2.07 1.67 3.33 3.83 3.51 6.23.03.31.05.61.05.92 0 2.76-1.27 5.26-3.27 6.99l1.02 1.85'/%3e%3cpath d='M297.83 194.89c1.47-1.65 2.38-3.79 2.38-6.12 0-1.41-.33-2.75-.91-3.95-2.14-4.38-8.82-7.57-16.76-7.57-2.16 0-4.23.23-6.15.67.43.46.76.97 1.09 1.48 1.58-.31 3.29-.48 5.06-.48 7.27 0 13.35 2.83 15.11 6.65.47.97.73 2.06.73 3.2 0 2.32-1.09 4.4-2.79 5.82l2.63 4.3 1.42-1.12-1.81-2.88z'/%3e%3cpath d='M295.14 180.48c1.91 1.21 3.36 2.69 4.16 4.34.58 1.2.91 2.54.91 3.95 0 2.33-.91 4.47-2.38 6.12l1.6 2.59c1.53-1.96 2.41-4.26 2.41-6.7 0-4.2-2.67-7.87-6.7-10.3z'/%3e%3cellipse cx='250.05' cy='167.3' fill='%23005bbf' stroke-width='.26' rx='4.43' ry='4.2'/%3e%3cpath stroke-width='.26' d='M248.89 155.54v2.26h-2.42v2.3h2.42v6.61h-3.05c-.03.21-.22.37-.22.59 0 .58.12 1.14.35 1.64 0 .02.02.02.03.03h8.12c0-.01.02-.01.03-.03.22-.5.35-1.06.35-1.64 0-.22-.19-.38-.22-.59h-2.96v-6.61h2.42v-2.3h-2.42v-2.26h-2.43z'/%3e%3c/g%3e%3cg fill='%23fff'%3e%3cellipse cx='250.04' cy='188.94' rx='1.91' ry='1.8'/%3e%3cellipse cx='250.04' cy='185.4' rx='1.91' ry='1.8'/%3e%3cellipse cx='250.04' cy='181.6' rx='1.52' ry='1.44'/%3e%3cellipse cx='250.04' cy='178.18' rx='1.1' ry='1.04'/%3e%3cellipse cx='250.04' cy='175.18' rx='.88' ry='.83'/%3e%3cellipse cx='198.94' cy='198.67' rx='1.1' ry='1.04'/%3e%3cellipse cx='197.44' cy='196.02' rx='1.1' ry='1.04'/%3e%3cellipse cx='196.44' cy='192.94' rx='1.1' ry='1.04'/%3e%3cellipse cx='196.31' cy='189.64' rx='1.1' ry='1.04'/%3e%3cellipse cx='197.12' cy='186.4' rx='1.1' ry='1.04'/%3e%3cellipse cx='198.81' cy='183.45' rx='1.1' ry='1.04'/%3e%3cellipse cx='201.06' cy='181.02' rx='1.1' ry='1.04'/%3e%3cellipse cx='203.68' cy='179.01' rx='1.1' ry='1.04'/%3e%3cellipse cx='206.8' cy='177.36' rx='1.1' ry='1.04'/%3e%3cellipse cx='210.04' cy='176.19' rx='1.1' ry='1.04'/%3e%3cellipse cx='213.66' cy='175.54' rx='1.1' ry='1.04'/%3e%3cellipse cx='217.1' cy='175.36' rx='1.1' ry='1.04'/%3e%3cellipse cx='220.47' cy='175.48' rx='1.1' ry='1.04'/%3e%3cellipse cx='224.21' cy='190.32' rx='1.1' ry='1.04'/%3e%3cellipse cx='222.34' cy='187.65' rx='1.1' ry='1.04'/%3e%3cellipse cx='221.35' cy='184.75' rx='1.1' ry='1.04'/%3e%3cellipse cx='221.47' cy='181.57' rx='1.1' ry='1.04'/%3e%3cellipse cx='222.16' cy='178.37' rx='1.1' ry='1.04'/%3e%3cellipse cx='223.84' cy='175.48' rx='1.1' ry='1.04'/%3e%3cellipse cx='226.4' cy='173.47' rx='1.1' ry='1.04'/%3e%3cellipse cx='229.39' cy='171.81' rx='1.1' ry='1.04'/%3e%3cellipse cx='232.7' cy='170.82' rx='1.1' ry='1.04'/%3e%3cellipse cx='236.13' cy='170.23' rx='1.1' ry='1.04'/%3e%3cellipse cx='239.5' cy='170.28' rx='1.1' ry='1.04'/%3e%3cellipse cx='242.99' cy='170.87' rx='1.1' ry='1.04'/%3e%3cellipse cx='246.23' cy='171.99' rx='1.1' ry='1.04'/%3e%3cellipse cx='253.8' cy='171.99' rx='1.1' ry='1.04'/%3e%3cellipse cx='257.04' cy='170.87' rx='1.1' ry='1.04'/%3e%3cellipse cx='260.54' cy='170.28' rx='1.1' ry='1.04'/%3e%3cellipse cx='263.9' cy='170.23' rx='1.1' ry='1.04'/%3e%3cellipse cx='267.34' cy='170.82' rx='1.1' ry='1.04'/%3e%3cellipse cx='270.64' cy='171.81' rx='1.1' ry='1.04'/%3e%3cellipse cx='273.64' cy='173.47' rx='1.1' ry='1.04'/%3e%3cellipse cx='276.19' cy='175.48' rx='1.1' ry='1.04'/%3e%3cellipse cx='277.88' cy='178.37' rx='1.1' ry='1.04'/%3e%3cellipse cx='278.57' cy='181.57' rx='1.1' ry='1.04'/%3e%3cellipse cx='278.69' cy='184.75' rx='1.1' ry='1.04'/%3e%3cellipse cx='277.69' cy='187.65' rx='1.1' ry='1.04'/%3e%3cellipse cx='275.83' cy='190.32' rx='1.1' ry='1.04'/%3e%3cellipse cx='279.57' cy='175.48' rx='1.1' ry='1.04'/%3e%3cellipse cx='282.94' cy='175.36' rx='1.1' ry='1.04'/%3e%3cellipse cx='286.38' cy='175.54' rx='1.1' ry='1.04'/%3e%3cellipse cx='290' cy='176.19' rx='1.1' ry='1.04'/%3e%3cellipse cx='293.24' cy='177.36' rx='1.1' ry='1.04'/%3e%3cellipse cx='296.36' cy='179.01' rx='1.1' ry='1.04'/%3e%3cellipse cx='298.97' cy='181.02' rx='1.1' ry='1.04'/%3e%3cellipse cx='301.22' cy='183.45' rx='1.1' ry='1.04'/%3e%3cellipse cx='302.91' cy='186.4' rx='1.1' ry='1.04'/%3e%3cellipse cx='303.72' cy='189.64' rx='1.1' ry='1.04'/%3e%3cellipse cx='303.6' cy='192.94' rx='1.1' ry='1.04'/%3e%3cellipse cx='302.6' cy='196.02' rx='1.1' ry='1.04'/%3e%3cellipse cx='301.1' cy='198.67' rx='1.1' ry='1.04'/%3e%3c/g%3e%3cg fill='%23c8b100'%3e%3cpath d='M250.15 226.18c-12.26-.02-23.25-1.47-31.09-3.83-.57-.18-.87-.7-.84-1.25-.01-.52.29-1 .84-1.17 7.84-2.36 18.83-3.81 31.09-3.83 12.27.02 23.25 1.47 31.09 3.83.55.17.84.65.83 1.17.03.55-.27 1.07-.83 1.25-7.84 2.36-18.82 3.81-31.09 3.83'/%3e%3cpath d='M250.07 216.09c-12.41.03-23.55 1.58-31.39 4 .65-.31.59-1.12-.22-3.2-.98-2.53-2.5-2.42-2.5-2.42 8.66-2.56 20.73-4.16 34.16-4.18 13.44.02 25.6 1.62 34.27 4.18 0 0-1.53-.11-2.51 2.42-.81 2.08-.87 2.89-.21 3.2-7.84-2.42-19.19-3.97-31.6-4'/%3e%3cpath d='M250.12 210.3c-13.43.02-25.5 1.62-34.16 4.18-.58.17-1.19-.05-1.38-.6s.12-1.18.7-1.35c8.71-2.67 21.08-4.35 34.84-4.38 13.77.03 26.19 1.71 34.9 4.38.58.17.89.8.7 1.35s-.8.77-1.38.6c-8.67-2.56-20.78-4.16-34.22-4.18'/%3e%3cpath d='m250.2 199.78 1.23.22c-.19.5-.24 1.05-.24 1.63 0 2.57 2.21 4.65 4.92 4.65 2.18 0 4.04-1.35 4.67-3.21.08.05.47-1.68.68-1.66.17.02.15 1.8.22 1.77.31 2.34 2.46 3.93 4.87 3.93 2.71 0 4.91-2.08 4.91-4.65 0-.19-.01-.38-.04-.57l1.54-1.52.83 1.94c-.33.61-.46 1.3-.46 2.03 0 2.46 2.1 4.44 4.69 4.44 1.63 0 3.06-.78 3.9-1.97l.99-1.25-.01 1.53c0 1.55.66 2.93 2.16 3.18 0 0 1.73.1 4.03-1.7 2.29-1.8 3.55-3.29 3.55-3.29l.2 1.8s-1.9 2.95-3.97 4.15c-1.14.66-2.86 1.35-4.23 1.13-1.44-.24-2.48-1.4-3.01-2.74-1.03.61-2.25.97-3.55.97-2.81 0-5.33-1.54-6.32-3.86-1.29 1.4-3.09 2.25-5.2 2.25-2.24 0-4.29-1.01-5.57-2.56a7.198 7.198 0 0 1-4.88 1.87c-2.48 0-4.69-1.22-5.94-3.05-1.25 1.83-3.46 3.05-5.94 3.05-1.89 0-3.61-.71-4.87-1.87-1.28 1.55-3.34 2.56-5.58 2.56-2.11 0-3.9-.85-5.19-2.25-1 2.32-3.52 3.86-6.32 3.86-1.31 0-2.52-.36-3.55-.97-.54 1.34-1.57 2.5-3.02 2.74-1.36.22-3.08-.47-4.22-1.13-2.08-1.2-3.98-4.15-3.98-4.15l.2-1.8s1.27 1.49 3.56 3.29c2.29 1.81 4.02 1.7 4.02 1.7 1.51-.25 2.16-1.63 2.16-3.18l-.01-1.53.99 1.25c.84 1.19 2.28 1.97 3.9 1.97 2.59 0 4.69-1.98 4.69-4.44 0-.73-.13-1.42-.46-2.03l.83-1.94 1.54 1.52c-.02.19-.04.38-.04.57 0 2.57 2.2 4.65 4.91 4.65 2.42 0 4.56-1.59 4.88-3.93.06.03.05-1.75.22-1.77.2-.02.6 1.71.67 1.66.64 1.86 2.49 3.21 4.68 3.21 2.71 0 4.91-2.08 4.91-4.65 0-.58-.03-1.13-.24-1.63l1.29-.22'/%3e%3cpath d='M208.37 206.32a2.24 2.24 0 0 0-.72-1.06c-.79-.68-1.84-.79-2.36-.25-.07.07-.13.17-.17.25 0 0-1.11-2.08-2.41-2.78-1.29-.7-3.49-.52-3.49-.52 0-1.6 1.3-2.89 2.99-2.89.99 0 1.92.41 2.48 1.11l.23-1.07s1.36.27 1.98 1.82-.06 3.8-.06 3.8.34-.96.85-1.61c.51-.64 1.81-1.34 2.49-1.66.67-.31 1.37-.79 1.37-.79s.03.18.05.61c.03.51-.01.83-.01.83 1.24-.17 2.69.04 3.83.48-.49.95-1.41 1.84-2.62 2.3 0 0 .44.36.83.75.34.34.44.49.44.49s-.85.13-1.27.19c-.43.05-1.84.28-2.69.22-.62-.04-1.32-.14-1.74-.22'/%3e%3cpath fill='%23ad1519' d='M205.29 205.01c.52-.54 1.57-.43 2.36.25.8.67 1.02 1.66.51 2.19-.51.54-1.57.42-2.36-.25-.79-.68-1.02-1.66-.51-2.19'/%3e%3cpath fill='%23fff' d='M216.39 205.91c-.28-.83-.03-1.65.57-1.83.6-.19 1.32.33 1.6 1.16s.03 1.65-.57 1.84c-.6.18-1.31-.34-1.6-1.17'/%3e%3cpath d='M226.12 201.86c-.33-.27-.59-.64-.67-1.08s.01-.87.23-1.23c0 0-.88-.44-1.83-.69-.72-.19-1.99-.2-2.37-.2-.38-.02-1.15-.03-1.15-.03s.07.17.28.55c.27.46.5.75.5.75-1.27.29-2.35 1.12-3.03 2.09.99.68 2.3 1.1 3.6.97 0 0-.12.34-.2.86-.06.43-.06.61-.06.61s.71-.26 1.07-.39c.35-.13 1.54-.55 2.15-.96.8-.54 1.48-1.25 1.48-1.25'/%3e%3cpath d='M225.68 191.65c1.06.67 1.98 1.79 2.3 3.03 0 0 .13-.25.71-.59.59-.33 1.09-.32 1.09-.32s-.17.97-.25 1.32c-.09.34-.09 1.38-.32 2.32-.23.93-.63 1.68-.63 1.68-.42-.34-.99-.51-1.58-.41-.58.1-1.06.44-1.32.9 0 0-.66-.58-1.21-1.38-.55-.81-.93-1.78-1.13-2.08-.21-.3-.72-1.15-.72-1.15s.47-.18 1.14-.05c.67.12.88.32.88.32-.14-1.28.28-2.62 1.04-3.59'/%3e%3cpath d='M228.97 201.38a1.727 1.727 0 0 0-.42-2.3s.67-.71 1.47-1.26c.6-.41 1.8-.82 2.15-.95.36-.13 1.07-.4 1.07-.4s0 .18-.06.61c-.08.52-.2.87-.2.87 1.3-.14 2.62.29 3.61.98-.69.97-1.77 1.79-3.04 2.08 0 0 .23.28.5.74.21.39.28.56.28.56l-1.15-.03c-.38 0-1.65-.01-2.37-.2-.95-.25-1.84-.69-1.84-.69'/%3e%3cellipse cx='227.37' cy='200.45' fill='%23ad1519' rx='2.17' ry='2.06'/%3e%3cpath fill='%23fff' d='M237.76 201.77c-.11-.87.31-1.63.93-1.7.63-.07 1.23.57 1.34 1.44.11.86-.3 1.63-.93 1.7-.62.07-1.22-.57-1.34-1.44'/%3e%3cpath d='M248.5 199.83c-.32-.36-.53-.82-.53-1.33 0-.5.19-.97.51-1.32 0 0-.89-.67-1.89-1.12-.77-.35-2.18-.59-2.6-.67l-1.28-.24s.04.2.2.67c.2.56.4.93.4.93-1.47.08-2.85.81-3.81 1.76.96.94 2.34 1.66 3.81 1.75 0 0-.2.36-.4.93-.16.46-.2.67-.2.67l1.28-.24c.42-.08 1.83-.32 2.6-.67 1-.46 1.91-1.11 1.91-1.11'/%3e%3cpath d='M250.11 188.36c1.05.95 1.85 2.36 1.95 3.82 0 0 .19-.27.91-.53.73-.26 1.28-.16 1.28-.16s-.39 1.05-.55 1.42c-.17.37-.39 1.53-.84 2.53-.44 1-1.05 1.76-1.05 1.76-.4-.45-1-.75-1.67-.75-.68 0-1.27.3-1.67.75 0 0-.61-.76-1.05-1.76-.45-1-.67-2.16-.84-2.53s-.56-1.42-.56-1.42.56-.1 1.28.16.92.53.92.53c.1-1.46.86-2.87 1.89-3.82'/%3e%3cpath d='M251.76 199.83c.33-.36.53-.82.53-1.33 0-.5-.19-.97-.51-1.32 0 0 .89-.67 1.9-1.12.76-.35 2.17-.59 2.6-.67l1.26-.24s-.02.2-.19.67c-.2.56-.4.93-.4.93 1.47.08 2.86.81 3.81 1.76-.95.94-2.33 1.66-3.81 1.75 0 0 .2.36.4.93.16.46.19.67.19.67l-1.26-.24c-.43-.08-1.84-.32-2.6-.67-1.01-.46-1.92-1.11-1.92-1.11'/%3e%3cellipse cx='250.14' cy='198.5' fill='%23ad1519' rx='2.17' ry='2.06'/%3e%3cpath fill='%23fff' d='M262.58 201.77c.11-.87-.3-1.63-.93-1.7s-1.23.57-1.34 1.44c-.11.86.31 1.63.93 1.7.63.07 1.23-.57 1.34-1.44'/%3e%3cpath d='M271.38 201.38c-.22-.35-.32-.79-.25-1.23.09-.44.33-.81.67-1.07 0 0-.67-.71-1.47-1.26-.61-.41-1.8-.82-2.16-.95-.35-.13-1.06-.4-1.06-.4s-.01.18.06.61c.08.52.19.87.19.87-1.29-.14-2.61.29-3.6.98.68.97 1.77 1.79 3.03 2.08 0 0-.23.28-.49.74-.22.39-.28.56-.28.56l1.14-.03c.38 0 1.66-.01 2.37-.2.95-.25 1.84-.69 1.84-.69'/%3e%3cpath d='M274.67 191.65c-1.06.67-1.98 1.79-2.31 3.03 0 0-.12-.25-.71-.59-.58-.33-1.09-.32-1.09-.32s.17.97.26 1.32c.09.34.09 1.38.31 2.32.23.93.64 1.68.64 1.68.42-.34.99-.51 1.57-.41.59.1 1.06.44 1.33.9 0 0 .66-.58 1.21-1.38.54-.81.92-1.78 1.12-2.08.21-.3.72-1.15.72-1.15s-.47-.18-1.14-.05c-.67.12-.88.32-.88.32.15-1.28-.28-2.62-1.03-3.59'/%3e%3cpath d='M274.22 201.86c.34-.27.6-.64.67-1.08.09-.44 0-.87-.22-1.23 0 0 .88-.44 1.83-.69.72-.19 1.99-.2 2.36-.2.39-.02 1.15-.03 1.15-.03s-.06.17-.28.55c-.26.46-.49.75-.49.75 1.26.29 2.34 1.12 3.03 2.09-.99.68-2.31 1.1-3.6.97 0 0 .11.34.19.86.06.43.06.61.06.61s-.71-.26-1.06-.39c-.36-.13-1.55-.55-2.16-.96-.79-.54-1.48-1.25-1.48-1.25'/%3e%3cellipse cx='272.98' cy='200.45' fill='%23ad1519' rx='2.17' ry='2.06'/%3e%3cpath fill='%23fff' d='M283.96 205.91c.28-.83.03-1.65-.57-1.83-.6-.19-1.32.33-1.61 1.16-.28.83-.03 1.65.57 1.84.6.18 1.32-.34 1.61-1.17'/%3e%3cpath d='M291.97 206.32c.11-.37.36-.75.72-1.06.79-.68 1.85-.79 2.36-.25.07.07.14.17.18.25 0 0 1.1-2.08 2.4-2.78s3.5-.52 3.5-.52c0-1.6-1.31-2.89-3-2.89-.99 0-1.92.41-2.47 1.11l-.23-1.07s-1.36.27-1.98 1.82.05 3.8.05 3.8-.33-.96-.84-1.61c-.51-.64-1.81-1.34-2.49-1.66-.68-.31-1.37-.79-1.37-.79s-.03.18-.06.61c-.02.51.02.83.02.83-1.25-.17-2.7.04-3.83.48.48.95 1.4 1.84 2.61 2.3 0 0-.43.36-.83.75-.33.34-.43.49-.43.49s.85.13 1.27.19c.43.05 1.84.28 2.68.22.63-.04 1.32-.14 1.74-.22'/%3e%3cpath fill='%23ad1519' d='M295.05 205.01c-.51-.54-1.57-.43-2.36.25-.79.67-1.02 1.66-.51 2.19.51.54 1.57.42 2.36-.25.79-.68 1.02-1.66.51-2.19'/%3e%3c/g%3e%3cg fill='none'%3e%3cpath fill='%23ad1519' stroke-linejoin='round' d='M250.12 224.57c-11.06-.01-21.07-1.29-28.68-3.26 7.61-1.97 17.62-3.17 28.68-3.19 11.07.02 21.13 1.22 28.74 3.19-7.61 1.97-17.67 3.25-28.74 3.26z'/%3e%3cpath stroke-width='.05' d='M258.04 224.28v-6.01m-3.02 6.21.04-6.37m-2.24 6.45v-6.49'/%3e%3cpath stroke-width='.09' d='M250.95 224.64v-6.57'/%3e%3cpath stroke-width='.14' d='M249.16 224.64v-6.57'/%3e%3cpath stroke-width='.18' d='M247.48 224.64v-6.57'/%3e%3cpath stroke-width='.23' d='M245.81 224.64v-6.57'/%3e%3cpath stroke-width='.28' d='M244.32 224.64v-6.57'/%3e%3cpath stroke-width='.33' d='m241.48 224.28-.04-5.97m1.39 6.05v-6.25'/%3e%3cpath stroke-width='.37' d='M238.86 224.01v-5.5m1.33 5.66-.04-5.86'/%3e%3cpath stroke-width='.42' d='M235.35 223.7v-4.84m1.15 4.92v-5.08m1.19 5.24v-5.28'/%3e%3cpath stroke-width='.46' d='M234.12 223.66v-4.68'/%3e%3cpath stroke-width='.51' d='M232.97 223.42v-4.36'/%3e%3cpath stroke-width='.56' d='M231.74 223.31v-4.06'/%3e%3cpath stroke-width='.6' d='m229.22 222.95-.04-3.22m1.33 3.38v-3.62'/%3e%3cpath stroke-width='.63' d='M227.93 222.68v-2.84'/%3e%3cpath stroke-width='.68' d='M226.74 222.45v-2.36'/%3e%3cpath stroke-width='.73' d='M225.45 222.13v-1.85'/%3e%3cpath stroke-width='.77' d='M224.12 221.98v-1.38'/%3e%3cpath stroke-width='.91' d='M222.72 221.66v-.67'/%3e%3cpath d='M220.12 221.66c7.75-2.18 18.29-3.52 30-3.54 11.72.02 22.31 1.36 30.06 3.54'/%3e%3cpath fill='%23ad1519' d='m216.72 217.16 1.22-1.59 3.37.43-2.69 1.96-1.9-.8'/%3e%3cpath fill='%23fff' d='M224.03 215.28c0-.58.49-1.04 1.1-1.04s1.1.46 1.1 1.04c0 .57-.49 1.04-1.1 1.04s-1.1-.47-1.1-1.04'/%3e%3cpath fill='%23058e6e' d='m233.64 215.07-2.36.27c-.61.07-1.17-.33-1.24-.9-.08-.57.35-1.09.96-1.15l2.37-.28 2.42-.28c.6-.07 1.15.33 1.22.9s-.36 1.09-.96 1.16l-2.41.28'/%3e%3cpath fill='%23fff' d='M240.54 213.35c0-.58.49-1.04 1.1-1.04.6 0 1.1.46 1.1 1.04 0 .57-.5 1.04-1.1 1.04-.61 0-1.1-.47-1.1-1.04'/%3e%3cpath fill='%23ad1519' d='M250.15 214.16h-3.29c-.6 0-1.11-.46-1.11-1.03 0-.58.49-1.04 1.1-1.04h6.64c.61 0 1.1.46 1.1 1.04 0 .57-.51 1.03-1.11 1.03h-3.33'/%3e%3cpath fill='%23fff' d='M257.56 213.35c0-.58.5-1.04 1.1-1.04.61 0 1.1.46 1.1 1.04 0 .57-.49 1.04-1.1 1.04-.6 0-1.1-.47-1.1-1.04'/%3e%3cpath fill='%23058e6e' d='m266.66 215.07 2.36.27c.6.07 1.17-.33 1.24-.9s-.36-1.09-.96-1.15l-2.37-.28-2.42-.28c-.61-.07-1.15.33-1.22.9-.08.57.36 1.09.96 1.16l2.41.28'/%3e%3cpath fill='%23fff' d='M274.07 215.28c0-.58.49-1.04 1.1-1.04s1.1.46 1.1 1.04c0 .57-.49 1.04-1.1 1.04s-1.1-.47-1.1-1.04'/%3e%3cpath fill='%23ad1519' d='m283.57 217.16-1.21-1.59-3.37.43 2.69 1.96 1.89-.8'/%3e%3c/g%3e%3cg stroke-width='.52'%3e%3cpath fill='%23ccc' d='M250.49 344.33c-13.08 0-26.05-3.2-36.95-8.54-8.03-3.98-13.36-12-13.36-21.19v-33.3H300.6v33.3c0 9.19-5.32 17.21-13.36 21.19-10.9 5.34-23.66 8.54-36.75 8.54z'/%3e%3cpath fill='%23ffd691' d='M252.91 329.55c2.09.63 3.15 2.19 3.15 4.01 0 2.38-2.3 4.18-5.3 4.18-2.99 0-5.42-1.8-5.42-4.18 0-1.79 1-3.8 3.08-3.94 0 0-.06-.19-.24-.5-.22-.23-.64-.66-.64-.66s.79-.15 1.25.02c.46.18.77.47.77.47s.21-.43.52-.76c.3-.33.7-.53.7-.53s.46.38.61.64c.15.27.25.59.25.59s.42-.35.79-.49c.37-.15.84-.26.84-.26s-.13.46-.22.69-.14.72-.14.72'/%3e%3cpath fill='%23058e6e' d='M250.32 340.32s-3.98-2.68-5.7-3.04c-2.21-.47-4.69-.09-5.76-.15.03.03 1.29.93 1.84 1.48s2.39 1.65 3.43 1.91c3.22.81 6.19-.2 6.19-.2m1.14.24s2.54-2.66 5.21-3.02c3.15-.44 5.22.26 6.44.58.03 0-1.01.49-1.56.87-.55.37-1.97 1.57-4.14 1.59-2.18.03-4.58-.23-4.97-.17-.4.06-.98.15-.98.15'/%3e%3cpath fill='%23ad1519' d='M250.69 337.28c-1-.93-1.62-2.25-1.62-3.72 0-1.46.62-2.78 1.63-3.71a5.08 5.08 0 0 1-.01 7.43'/%3e%3cpath fill='%23058e6e' d='M249.68 342.71s.61-1.52.67-2.83c.06-1.09-.15-2.17-.15-2.17h.8s.39 1.16.39 2.17c0 1.02-.18 2.37-.18 2.37s-.55.08-.73.17c-.19.09-.8.29-.8.29'/%3e%3cg fill='%23c8b100'%3e%3cpath fill='%23ad1519' d='M250.32 314.57c0 13.16-11.16 23.82-25.05 23.82s-25.15-10.66-25.15-23.82v-33.35h50.2v33.35'/%3e%3cpath d='M200.03 314.12c.15 7.02 2.95 12.25 5.73 15.67v-49.47h-5.66l-.07 33.8zm11.05 20.11c1.57.83 3.72 2.22 6.03 2.77l-.15-56.96h-5.88v54.19zm11.2 4.02c2.3.23 4.01.19 5.87 0v-58.21h-5.87v58.21zm11.04-1.25c2.3-.46 4.9-1.89 6.03-2.63v-54.33h-5.88l-.15 56.96zm11.49-7.76c2.45-2.18 4.75-7.12 5.59-12.76l.14-36.44h-5.87l.14 49.2z'/%3e%3c/g%3e%3cpath fill='%23ad1519' d='M300.65 281.22v33.35c0 13.16-11.28 23.82-25.17 23.82-13.9 0-25.16-10.66-25.16-23.82v-33.35h50.33'/%3e%3cpath id='e' fill='%23c8b100' stroke='%23c8b100' stroke-width='.26' d='M272.71 306.14c.05-.14.12-.27.19-.4l-4.26-4.74-1.67.72-3.06-3.39 1-1.46-5.34-5.99c-.07.02-.2.02-.27.04l.03 4.02 1.75.5v4.46l-1.75.48-.03 4.08c.84.26 1.48.88 1.74 1.67l3.21.01.51-1.67h4.72l.5 1.67zm-6.98-18.5v1.61h2.76v-1.61zm-7.3 20.37c.64 0 1.16-.49 1.16-1.1s-.52-1.11-1.16-1.11c-.65 0-1.17.5-1.17 1.11s.52 1.1 1.17 1.1zm15.99-9.73-1.76-.48v-4.46l1.76-.5-.01-1.92c-.85-.25-1.51-.87-1.79-1.67h-2.68l-.51 1.67h-4.71l-.51-1.67h-3.09c-.08.22-.17.42-.29.61l5.38 5.96 1.67-.71 3.06 3.4-1 1.45 4.18 4.64c.09-.04.18-.08.28-.12zm-7.25-1.39-1.29 1.04 1.77 1.98 1.29-1.05zm8.004 36.186c-1.24-.065-2.255-.902-2.514-2.016-1.67-.23-3.25-.66-4.73-1.3l.84-1.43c1.29.55 2.66.91 4.08 1.11.31-.66.86-1.16 1.58-1.4l.01-5.62-1.76-.49v-4.46l1.76-.48v-7.64a.882.882 0 0 1-.2-.09l-3.98 4.42 1 1.44-3.06 3.4-1.67-.71-3.3 3.67c.57.87.55 2-.11 2.85a15.58 15.58 0 0 0 3.24 2.75l-.84 1.44c-1.42-.89-2.7-1.99-3.79-3.22-.87.26-1.86.11-2.6-.5-1.15-.93-1.29-2.56-.3-3.64l.14-.16c-.69-1.56-1.16-3.24-1.32-5l1.71.01c.14 1.5.51 2.93 1.09 4.27.49-.06 1-.01 1.46.16l3.32-3.68-1-1.45 3.06-3.4 1.67.72 3.99-4.43a2.15 2.15 0 0 1-.21-.46l-2.76.01-.5 1.67h-4.72l-.51-1.67-3.24-.01c-.27.76-.9 1.36-1.69 1.62l-.01 4.04-1.71-.01v-4.01c-1.1-.33-1.91-1.31-1.91-2.47 0-1.15.82-2.15 1.92-2.48l.01-4.05-1.76-.48v-4.46l1.76-.5v-4.05c-1.08-.35-1.84-1.32-1.84-2.45 0-1.43 1.22-2.58 2.73-2.58 1.22 0 2.25.74 2.61 1.78h3.09l.51-1.67h4.71l.51 1.67h2.68c.357-1.031 1.363-1.767 2.559-1.78l.071 8.37h-.85v2.61h.845l-.021 21.59h-.784v2.61h.78zm-5.914-18.306-1.29-1.04-1.78 1.98 1.29 1.04zm-9.96-18.44h-1.69l-.01 2.61h1.7zm9.16 11.41v-1.6h-2.85v1.6zm-10.6 9.69-1.76-.39-.25-4.45 1.75-.58v2.56c0 .99.09 1.92.26 2.86zm1.46-5.52 1.75.41s.09 2.87.05 2.22c-.04-.74.19 2.24.19 2.24l-1.76.58c-.18-.9-.24-1.84-.24-2.79zm10.81 16.93.39-1.7c-1.52-.48-2.93-1.18-4.17-2.09l-1.26 1.11c1.48 1.15 3.19 2.08 5.04 2.68zm-.85 1.44-1.3 1.22c-1.47-.54-2.86-1.26-4.12-2.11l.38-1.77c1.5 1.13 3.21 2.03 5.04 2.66z'/%3e%3cuse xlink:href='%23e' transform='matrix(-1 0 0 1 550.43 0)'/%3e%3cpath fill='%23058e6e' stroke='none' d='M272.59 306.94c0-1.44 1.23-2.6 2.74-2.6s2.73 1.16 2.73 2.6c0 1.43-1.22 2.58-2.73 2.58s-2.74-1.15-2.74-2.58'/%3e%3cg fill='%23c8b100' stroke-width='.46'%3e%3cpath fill='%23ad1519' stroke-width='.52' d='M200.12 281.25h50.18v-55.72h-50.18v55.72z'/%3e%3cpath d='M217.34 238.41h-.92v-.92h-1.62v3.69h1.62v2.55h-3.47v7.39h1.85v14.79h-3.7v7.63h28.42v-7.63h-3.69v-14.79h1.85v-7.39h-3.47v-2.55h1.62v-3.69h-1.62v.92h-.93v-.92h-1.61v.92h-1.16v-.92h-1.62v3.69h1.62v2.55h-3.46v-8.09h1.84v-3.7h-1.84v.93h-.93v-.93h-1.62v.93h-.92v-.93h-1.85v3.7h1.85v8.09h-3.47v-2.55h1.62v-3.69h-1.62v.92h-.92v-.92h-1.85v.92zm-6.24 35.13h28.42m-28.42-1.85h28.42m-28.42-1.85h28.42m-28.42-1.85h28.42m-28.42-2.08h28.42m-24.72-1.62h21.03m-21.03-1.85h21.03m-21.03-2.08h21.03m-21.03-1.84h21.03m-21.03-1.85h21.03m-21.03-1.85h21.03m-21.03-1.85h21.03m-22.88-1.85h24.73m-24.73-1.85h24.73m-24.73-1.85h24.73m-24.73-1.84h24.73m-21.26-1.85h17.79m-10.63-1.85h3.47m-3.47-1.85h3.47m-3.47-1.85h3.47m-3.47-1.85h3.47m-5.32-2.31h7.16m-12.47 7.86h3.69m-5.31-2.31h6.93m-6.93 33.97v-1.85m0-1.85v-1.85m-1.85 1.85v1.85m3.47 0v-1.85m1.84 3.7v-1.85m0-1.85v-1.85m0-2.08v-1.62m0-1.85v-2.08m-1.84 7.63v-2.08m-3.47 2.08v-2.08m7.16 0v2.08m1.62-2.08v-1.62m-5.31-1.85v1.85m3.69-1.85v1.85m3.47-1.85v1.85m-1.85-1.85v-2.08m1.85-1.84v1.84m0-5.54v1.85m-1.85-3.7v1.85m1.85-3.7v1.85m-3.47-1.85v1.85m-3.69-1.85v1.85m-1.62-3.7v1.85m3.46-1.85v1.85m3.47-1.85v1.85m1.85-3.7v1.85m-3.47-1.85v1.85m-3.69-1.85v1.85m-1.62-3.69v1.84m6.93-1.84v1.84m-3.47-5.54v1.85m15.95-1.85h-3.7m5.32-2.31h-6.94m6.94 33.97v-1.85m0-1.85v-1.85m1.85 1.85v1.85m-3.47 0v-1.85m-1.85 3.7v-1.85m0-1.85v-1.85m0-2.08v-1.62m0-1.85v-2.08m1.85 7.63v-2.08m3.47 2.08v-2.08m-7.17 0v2.08m-1.62-2.08v-1.62m5.32-1.85v1.85m-3.7-1.85v1.85m-3.46-1.85v1.85m1.84-1.85v-2.08m-1.84-1.84v1.84m0-5.54v1.85m1.84-3.7v1.85m-1.84-3.7v1.85m3.46-1.85v1.85m3.7-1.85v1.85m1.62-3.7v1.85m-3.47-1.85v1.85m-3.47-1.85v1.85m-1.84-3.7v1.85m3.46-1.85v1.85m3.7-1.85v1.85m1.62-3.69v1.84m-6.94-1.84v1.84m3.47-5.54v1.85m-7.16 18.71v-2.08m0-5.54v-1.85m0 5.55v-1.85m0-5.55v-1.85m0-1.85v-1.84m0-3.7v-1.85m0-1.85v-1.85m-8.78 4.85h3.69m3.47-5.54h3.47m3.46 5.54h3.7'/%3e%3cpath d='M230.05 273.54v-4.86c0-.92-.46-3.7-4.85-3.7-4.16 0-4.62 2.78-4.62 3.7v4.86h9.47z'/%3e%3cpath d='m222.19 268.91-2.31-.23c0-.92.23-2.31.93-2.77l2.08 1.62c-.23.23-.7.92-.7 1.38zm3.93-2.31 1.16-2.08c-.46-.23-1.39-.46-2.08-.46-.46 0-1.39.23-1.85.46l1.15 2.08h1.62zm2.31 2.31 2.31-.23c0-.92-.23-2.31-.92-2.77l-2.08 1.62c.23.23.69.92.69 1.38zm-6.7-8.08v-5.09c0-1.38-.92-2.54-2.54-2.54s-2.54 1.16-2.54 2.54v5.09h5.08zm7.16 0v-5.09c0-1.38.93-2.54 2.55-2.54 1.61 0 2.54 1.16 2.54 2.54v5.09h-5.09zm-8.78-12.48.23-4.62h-4.39l.47 4.62h3.69zm6.94 0 .46-4.62h-4.39l.23 4.62h3.7zm3.46 0-.46-4.62h4.62l-.46 4.62h-3.7z'/%3e%3cpath fill='%230039f0' stroke='none' d='M228.43 273.54v-4.16c0-.7-.46-2.78-3.23-2.78-2.54 0-3.01 2.08-3.01 2.78v4.16h6.24zm-7.16-13.18v-4.39c0-1.15-.69-2.31-2.08-2.31s-2.08 1.16-2.08 2.31v4.39h4.16zm8.09 0v-4.39c0-1.15.69-2.31 2.08-2.31 1.38 0 2.08 1.16 2.08 2.31v4.39h-4.16z'/%3e%3c/g%3e%3cpath fill='%23ccc' d='M250.28 281.25h50.32v-55.72h-50.32v55.72z'/%3e%3cpath fill='%23db4446' stroke-width='.39' d='m275.93 239.26.05-.62.09-.34s-1.61.13-2.46-.11-1.61-.59-2.4-1.25c-.79-.68-1.1-1.1-1.67-1.18-1.36-.22-2.4.4-2.4.4s1.02.37 1.78 1.31 1.59 1.41 1.95 1.53c.59.18 2.66.05 3.22.07.57.03 1.84.19 1.84.19z'/%3e%3cg fill='none' stroke-width='.39'%3e%3cpath fill='%23ed72aa' d='M283.46 237s.01.72.08 1.4c.06.67-.22 1.24-.11 1.61s.16.66.3.93c.14.26.21.94.21.94s-.38-.28-.74-.54c-.35-.27-.6-.44-.6-.44l.1 1.03c.04.31.22.89.51 1.24.29.33.87.89 1.05 1.33.18.45.14 1.44.14 1.44s-.46-.75-.87-.89c-.39-.14-1.26-.62-1.26-.62s.79.79.79 1.55c0 .75-.32 1.6-.32 1.6s-.36-.68-.83-1.12c-.47-.45-1.13-.9-1.13-.9s.52 1.17.52 1.95c0 .79-.15 2.47-.15 2.47s-.39-.64-.79-.96c-.4-.31-.87-.58-1.02-.78-.14-.21.48.64.54 1.16.07.51.32 2.35 1.92 4.69.94 1.37 2.39 3.77 5.5 2.98 3.11-.78 1.96-4.97 1.3-6.92-.65-1.95-.98-4.11-.94-4.87.04-.75.58-2.97.51-3.39-.07-.41-.24-2 .14-3.28.4-1.33.73-1.85.95-2.4.21-.55.39-.86.46-1.34s.07-1.37.07-1.37.58 1.06.73 1.44c.14.38.14 1.5.14 1.5s.11-1.12.98-1.67 1.88-1.13 2.13-1.44.33-.51.33-.51-.08 1.92-.62 2.67c-.36.49-1.77 2.09-1.77 2.09s.73-.28 1.23-.3c.51-.04.87 0 .87 0s-.62.48-1.41 1.64c-.8 1.16-.47 1.26-1.05 2.22s-1.05 1-1.78 1.58c-1.08.87-.5 4.34-.36 4.86.15.51 2.03 4.76 2.07 5.79.03 1.03.21 3.33-1.6 4.8-1.16.95-3.07.96-3.51 1.23-.43.28-1.29 1.13-1.29 2.91 0 1.79.64 2.06 1.15 2.51.51.44 1.16.2 1.3.55.15.34.22.54.44.75.21.2.36.44.29.82-.08.38-.91 1.23-1.2 1.85-.29.61-.87 2.23-.87 2.47s-.07.99.18 1.37c0 0 .91 1.06.29 1.26-.4.14-.78-.25-.97-.2-.54.14-.83.47-.98.45-.36-.07-.36-.25-.4-.76-.03-.51-.01-.72-.17-.72-.22 0-.33.18-.37.45s-.04.89-.29.89-.61-.45-.83-.55-.83-.2-.87-.48c-.03-.27.36-.85.76-.96.4-.1.76-.3.51-.51-.26-.2-.51-.2-.76 0-.25.21-.79.04-.76-.27.04-.31.11-.69.07-.86-.03-.17-.47-.51.1-.82.59-.31.84.27 1.42.17s.86-.31 1.08-.65.18-1.06-.22-1.5c-.39-.45-.79-.52-.94-.8-.14-.27-.36-.92-.36-.92s.11 1.2.04 1.37-.04.89-.04.89-.39-.45-.72-.79c-.32-.34-.65-1.37-.65-1.37s-.03.96-.03 1.34c0 .37.43.72.29.86-.15.13-.83-.72-1.02-.86-.18-.14-.76-.58-1.01-1.06s-.44-1.16-.51-1.41c-.07-.24-.19-1.31-.07-1.58.18-.4.47-1.13.47-1.13h-1.41c-.76 0-1.3-.23-1.59.28s-.15 1.54.21 2.88c.37 1.33.58 1.98.48 2.22-.11.24-.58.79-.76.89-.19.11-.69.07-.91-.03-.21-.1-.57-.27-1.26-.27s-1.12.03-1.37-.03c-.26-.07-.88-.38-1.17-.31s-.79.32-.65.72c.22.61-.21.75-.51.72-.29-.04-.53-.14-.9-.24-.36-.11-.9 0-.83-.42.07-.41.22-.44.4-.74.18-.32.25-.52.04-.54-.25-.02-.51-.05-.7.11-.2.16-.51.51-.76.38-.26-.14-.46-.43-.46-1.08 0-.64-.68-1.2-.05-1.17.62.03 1.41.48 1.55.13s.06-.51-.28-.78-.76-.43-.31-.77c.45-.35.56-.35.74-.54.17-.18.41-.79.73-.64.62.3.02.73.65 1.42.62.69 1.01.94 2.06.83 1.04-.11 1.33-.24 1.33-.54 0-.29-.09-.82-.12-1.04-.02-.21.15-.99.15-.99s-.48.3-.63.59c-.13.29-.42.8-.42.8s-.11-.6-.08-1.09c.02-.29.12-.79.11-.89-.03-.27-.23-.94-.23-.94s-.16.73-.28.94c-.11.21-.16 1.07-.16 1.07s-.67-.58-.48-1.55c.13-.75-.12-1.74.11-2.06.22-.33.75-1.64 2.06-1.69 1.3-.05 2.31.05 2.77.03.45-.03 2.06-.33 2.06-.33s-2.97-1.52-3.64-1.98c-.68-.45-1.73-1.63-2.07-2.16-.34-.54-.65-1.58-.65-1.58s-.53.02-1.02.29c-.48.27-.96.67-1.24.99s-.73 1.05-.73 1.05.08-.94.08-1.23-.06-.86-.06-.86-.33 1.28-1.01 1.76c-.68.49-1.47 1.15-1.47 1.15s.08-.71.08-.88c0-.16.17-.99.17-.99s-.48.72-1.21.86c-.74.13-1.81.11-1.9.56-.08.45.2 1.07.03 1.39s-.54.54-.54.54-.42-.35-.79-.38c-.36-.03-.71.16-.71.16s-.31-.4-.19-.67c.11-.26.67-.66.54-.83-.15-.16-.6.06-.88.19-.28.14-.88.27-.82-.19.05-.45.2-.72.05-1.04-.14-.32-.05-.53.18-.61.22-.08 1.12.02 1.21-.19.08-.21-.22-.48-.82-.61-.59-.14-.88-.49-.57-.78.32-.3.4-.38.54-.64.14-.27.2-.76.74-.51.53.24.42.83.99 1.01.56.19 1.89-.08 2.17-.24s1.19-.83 1.5-.99c.31-.15 1.61-1.12 1.61-1.12s-.76-.53-1.05-.8c-.28-.27-.78-.91-1.04-1.05-.25-.13-1.5-.61-1.92-.64-.42-.02-1.72-.48-1.72-.48s.59-.19.79-.35c.19-.16.64-.56.87-.53.22.02.28.02.28.02s-1.21-.05-1.47-.13c-.25-.08-.99-.54-1.27-.54s-.84.11-.84.11.76-.48 1.38-.59c.62-.1 1.1-.08 1.1-.08s-.96-.27-1.19-.58c-.22-.33-.45-.8-.62-1.02-.17-.21-.28-.56-.59-.59s-.85.38-1.16.35-.54-.22-.57-.67c-.02-.46 0-.3-.1-.54-.12-.24-.57-.8-.15-.93.43-.14 1.33.08 1.42-.08.08-.16-.48-.65-.85-.83-.37-.19-.96-.51-.65-.78.31-.26.62-.37.79-.61s.37-.91.74-.7c.36.21.87 1.26 1.16 1.18.28-.08.3-.83.25-1.15-.06-.32 0-.88.28-.83s.51.43.96.46c.45.02 1.13-.11 1.07.21-.05.32-.31.71-.62 1.06-.3.36-.45 1.05-.25 1.5.2.46.71 1.19 1.16 1.48s1.3.51 1.84.85c.53.35 1.78 1.34 2.2 1.45s.85.32.85.32.48-.21 1.13-.21 2.14.1 2.71-.14 1.3-.64 1.08-1.15c-.23-.51-1.47-.96-1.36-1.36s.57-.43 1.33-.46c.76-.02 1.8.14 2-.94.2-1.06.26-1.68-.81-1.92-1.08-.24-1.87-.27-2.07-1.04-.2-.78-.39-.97-.17-1.18.23-.21.62-.32 1.41-.37.8-.06 1.7-.06 1.96-.25.25-.18.3-.69.61-.91.31-.21 1.53-.4 1.53-.4s1.46.71 2.8 1.71c1.21.9 2.3 2.23 2.3 2.23'/%3e%3cpath d='M269 243.39s-.8.23-1.1.67c-.37.53-.34 1.07-.34 1.07s.68-.56 1.56-.33c.87.24.96.33 1.33.3s1.27-.35 1.27-.35-.74.86-.65 1.45c.08.58.19.85.17 1.15-.06.72-.6 1.61-.6 1.61s.31-.19 1.05-.35c.73-.16 1.36-.51 1.75-.81.39-.29.9-1.02.9-1.02s-.16 1 0 1.42c.17.44.23 1.67.23 1.67s.47-.42.85-.62c.19-.11.7-.38.9-.7.14-.22.32-1.06.32-1.06s.11.9.39 1.34c.28.42.7 1.74.7 1.74s.29-.86.6-1.21.68-.8.7-1.07c.03-.27-.08-.85-.08-.85l.39.85m-11.41.61s.48-.83.93-1.1c.46-.26 1.08-.74 1.25-.8.16-.05.9-.46.9-.46m.99 5.17s1.09-.55 1.41-.75c.68-.4 1.16-1.12 1.16-1.12'/%3e%3cpath stroke-width='.26' d='M282.57 240.9s-.34-.48-.42-.65c-.09-.15-.23-.48-.23-.48'/%3e%3cpath d='M278.33 257.41s2.04 1.26 1.98 2.31c-.06 1.04-1.13 2.41-1.13 2.41'/%3e%3c/g%3e%3cpath stroke-width='.26' d='M273.05 236.24s-.17-.48-.2-.62c-.03-.13-.12-.29-.12-.29s.88 0 .85.27c-.02.27-.28.27-.34.37-.05.11-.19.27-.19.27z'/%3e%3cpath stroke-width='.05' d='m277.06 234.85-.06-.43s.77 0 1.13.26c.57.4.93 1.02.91 1.05-.1.09-.54-.27-.85-.37 0 0-.23.05-.45.05-.23 0-.34-.11-.37-.21-.03-.12.03-.3.03-.3l-.34-.05z'/%3e%3cpath stroke-width='.26' d='m273.08 240.14.33-.53.34.49-.67.04m.81-.02.4-.53.43.48-.83.05m-.36-3.29.82.29-.74.38-.08-.67m.99.27.73.18-.59.46-.14-.64'/%3e%3cpath fill='%23db4446' stroke-width='.39' d='M261.88 236.08s.48.34.85.4c.37.05.76.05.82.05.05 0 .17-.54.11-.91-.2-1.2-1.3-1.47-1.3-1.47s.33.73.17 1.07c-.23.48-.65.86-.65.86zm-2.29 1.04s-.43-.77-1.33-.67c-.9.11-1.5.81-1.5.81s1-.03 1.25.13c.37.24.48.86.48.86s.54-.32.71-.54c.16-.21.39-.59.39-.59zm-1.1 3.13s-.77.11-1.19.59c-.43.49-.36 1.4-.36 1.4s.5-.54.95-.54c.46 0 1.16.16 1.16.16s-.22-.56-.22-.8-.34-.81-.34-.81zm2.57 10.12s-.42-.45-1.16-.32c-.74.14-1.22.97-1.22.97s.63-.17 1-.08c.36.08.62.45.62.45s.34-.29.45-.45.31-.57.31-.57zm-.85 2.97s-.62-.1-1.16.33c-.53.43-.56 1.25-.56 1.25s.51-.43.91-.37c.39.05.87.27.87.27s.08-.51.11-.64c.09-.38-.17-.84-.17-.84zm1.45 2.74s-.05.79.33 1.28c.4.51 1.13.59 1.13.59s-.24-.53-.28-.8c-.06-.4.34-.75.34-.75s-.37-.38-.73-.38c-.37 0-.79.06-.79.06zm7.34 7.04s-.51-.64-1.21-.62c-.71.03-1.45.69-1.45.69s.88-.07 1.11.22c.23.3.45.67.45.67s.4-.21.57-.35c.17-.13.53-.61.53-.61zm-2.17 2.81s-.93-.14-1.39.35c-.45.48-.42 1.36-.42 1.36s.56-.61 1.07-.56 1.08.32 1.08.32-.09-.53-.15-.78c-.05-.24-.19-.69-.19-.69zm2.01 2.97s-.46.64-.12 1.15 1.05.75 1.05.75-.26-.37-.14-.8c.09-.34.67-.8.67-.8l-1.46-.3zm12.4 1.21s-.81-.19-1.27.08c-.45.26-.82 1.39-.82 1.39s.74-.62 1.28-.54c.53.08.93.3.93.3s.08-.46.02-.78c-.03-.19-.14-.45-.14-.45zm.4 2.99s-.62.64-.4 1.18c.23.54.62 1.1.62 1.1s-.02-.8.23-1.02c.37-.32 1.05-.37 1.05-.37s-.54-.48-.71-.54c-.17-.05-.79-.35-.79-.35zm3.11.94s-.31.78.28 1.28c.59.52 1.11.57 1.11.57s-.46-.81-.32-1.23c.15-.45.54-.72.54-.72s-.74-.25-.85-.22c-.11.02-.76.32-.76.32z'/%3e%3cg fill='%23c8b100' stroke-width='.26'%3e%3cpath d='m282.88 232.71-.29.02c-.01.03-.14.24-.26.35-.26.25-.65.28-.86.07a.486.486 0 0 1-.14-.41c-.17.09-.35.09-.51-.01-.26-.15-.32-.5-.14-.79.03-.06.06-.14.11-.18l-.02-.32-.35.08-.1.19c-.22.25-.54.31-.7.17a.526.526 0 0 1-.13-.27c0 .01-.09.09-.17.11-.54.13-.75-1.05-.77-1.35l-.17.25s.16.7.08 1.3c-.08.59-.29 1.19-.29 1.19.74.19 1.86.8 2.97 1.65s1.98 1.78 2.34 2.42c0 0 .58-.32 1.18-.51s1.36-.2 1.36-.2l.22-.21c-.32.05-1.58.1-1.56-.43 0-.08.07-.18.08-.18a.697.697 0 0 1-.3-.06c-.18-.13-.18-.43.02-.69l.18-.13.01-.34-.34.05c-.03.04-.11.09-.15.13-.27.23-.65.25-.86.03a.416.416 0 0 1-.11-.46.58.58 0 0 1-.45-.05c-.26-.15-.31-.52-.11-.8.09-.14.28-.31.31-.32l-.07-.3h-.01z'/%3e%3cpath fill='%23000' stroke-width='.05' d='M280.63 233.4c.05-.07.15-.06.23 0s.1.16.06.21c-.05.06-.15.06-.24-.01-.07-.05-.1-.15-.05-.2zm.95.79-.33-.25c-.06-.04-.07-.12-.04-.16.04-.04.12-.04.18 0l.33.26.33.25c.05.04.08.12.04.16s-.12.04-.18 0l-.33-.26m-1.74-1.19-.26-.15c-.07-.04-.1-.12-.07-.17s.11-.06.17-.02l.26.16.26.15c.06.03.09.11.07.16-.03.05-.11.06-.17.02l-.26-.15m-1.04-.71c.05-.06.16-.06.24 0 .08.07.1.16.05.22-.05.05-.15.05-.23-.01s-.1-.15-.06-.21zm3.83 2.63c.05-.05.03-.14-.05-.21-.08-.06-.19-.06-.24 0-.04.05-.02.15.06.21s.18.06.23 0zm.57.66.22.21c.05.05.13.07.18.03.04-.04.04-.11-.01-.16l-.21-.21-.22-.21c-.05-.05-.14-.07-.18-.03-.05.03-.04.11.01.16l.21.21m.95.81c.05-.06.03-.15-.05-.21-.08-.07-.18-.07-.23-.01s-.03.15.05.22c.08.05.18.06.23 0z'/%3e%3cpath d='m281.4 230.36-.59.01-.11.87.06.14.15-.01.76-.51-.27-.5'/%3e%3cpath d='m281.4 230.36-.59.01-.11.87.06.14.15-.01.76-.51-.27-.5'/%3e%3cpath d='m279.8 230.84-.02.54.92.12.15-.07-.02-.15-.53-.71-.5.27'/%3e%3cpath d='m281.7 231.92-.49.27-.54-.71-.01-.15.14-.06.93.11-.03.54'/%3e%3cpath d='M280.51 231.25c.08-.13.26-.17.39-.09.14.07.18.24.1.37s-.26.17-.39.09a.26.26 0 0 1-.1-.37zm-2.15-.9c-.02.01-.13-.46-.26-.71-.08-.19-.39-.43-.39-.43.03-.05.42-.19.87.09.38.31-.03.87-.03.87s-.09.14-.19.18z'/%3e%3cpath d='m279.39 230.66-.42.37-.68-.6.06-.08.03-.15.92-.07.09.53'/%3e%3cpath d='M278.24 230.29c.05-.15.18-.23.28-.2.11.04.15.18.1.33s-.18.23-.29.2c-.11-.04-.15-.18-.09-.33zm5.43 1.48-.59-.06-.25.85.05.14.15.01.83-.41-.19-.53'/%3e%3cpath d='m282.01 232.03-.1.54.9.23.15-.04.01-.14-.43-.79-.53.2'/%3e%3cpath d='m283.73 233.36-.53.2-.42-.78.01-.15.15-.03.89.23-.1.53'/%3e%3cpath d='M282.65 232.54c.1-.12.28-.13.4-.04.13.09.15.26.05.38s-.28.13-.41.04a.26.26 0 0 1-.04-.38zm2.99 1.07.11.55-.87.3-.16-.04-.01-.14.36-.81.57.14'/%3e%3cpath d='m285.49 235.2-.56.13-.31-.83.04-.15.15-.02.85.35-.17.52'/%3e%3cpath d='m283.97 233.66-.18.52.85.34.16-.02.03-.14-.3-.83-.56.13'/%3e%3cpath d='M284.91 234.63c.12-.11.12-.28.02-.39a.318.318 0 0 0-.41-.02c-.11.11-.12.28-.01.39.1.11.29.12.4.02zm1.38 1.8c0 .01.5.03.79.09.2.04.52.27.52.27.06-.04.12-.42-.28-.79-.39-.28-.88.22-.88.22s-.12.12-.15.21z'/%3e%3cpath d='m285.75 235.54-.29.46.76.51.09-.08.13-.04-.12-.88-.57.03'/%3e%3cpath d='M286.37 236.53c.14-.07.21-.22.15-.31s-.22-.1-.36-.02-.2.22-.14.31c.05.09.21.1.35.02z'/%3e%3c/g%3e%3cg stroke-width='.61'%3e%3cellipse cx='250.43' cy='281.01' fill='%23ad1519' rx='16.26' ry='18.3'/%3e%3cellipse cx='250.44' cy='280.97' fill='%23005bbf' rx='11.44' ry='13.42'/%3e%3cg id='f' fill='%23c8b100' stroke-width='.34'%3e%3cpath stroke-linejoin='round' d='M245.03 271.74s-1.35 1.48-1.35 2.86c0 1.39.57 2.54.57 2.54-.21-.55-.76-.94-1.41-.94-.83 0-1.5.63-1.5 1.42 0 .22.14.58.24.77l.49.99c.16-.37.54-.57.98-.57.59 0 1.08.45 1.08 1.01 0 .09-.01.17-.04.25l-1.22.01v1.03h1.09l-.81 1.61 1.07-.42.81.91.84-.91 1.07.42-.8-1.61h1.08v-1.03l-1.22-.01c-.02-.08-.02-.16-.02-.25 0-.56.47-1.01 1.06-1.01.44 0 .82.2.98.57l.49-.99c.1-.19.24-.55.24-.77 0-.79-.67-1.42-1.49-1.42-.66 0-1.21.39-1.41.94 0 0 .57-1.15.57-2.54 0-1.38-1.39-2.86-1.39-2.86z'/%3e%3cpath d='M242.87 281.11h4.36v-1.03h-4.36v1.03z'/%3e%3c/g%3e%3cuse xlink:href='%23f' x='10.63'/%3e%3cuse xlink:href='%23f' x='5.31' y='9.14'/%3e%3c/g%3e%3c/g%3e%3c/g%3e%3c/svg%3e)
'/%3e%3cuse xlink:href='%23a' transform='rotate(23.036 .093 25.536)'/%3e%3cuse xlink:href='%23a' transform='rotate(45.87 1.273 16.18)'/%3e%3cuse xlink:href='%23a' transform='rotate(69.945 .996 12.078)'/%3e%3cuse xlink:href='%23a' transform='rotate(20.66 -19.689 31.932)'/%3e%3c/svg%3e)