is a major cause of poor microbial quality of milk, often resulting from unhygienic milk handling. Milk contamination poses public health concerns. Shiga toxin-producing
Diabetes mellitus (DM) is clinically known as diverse sets of biochemical syndromes with a basic symptom of glucose intolerance and is a major cause of morbidity and mortality worldwide. Diabetes mellitus exclusively disrupts glucose metabolism in various tissues and organs leading to complications such as retinopathy, nephropathy and brain micro-infarcts. This study investigated the positive modulatory effect of Lawsonia inermis Linn leaves on major organs involved in diabetic complications in Wister rats experimentally induced by type 1 diabetes using streptozocine. Lawsonia inermis leaves were partitioned using N-hexane, ethyl acetate and methanol. Fractions obtained were assessed for their modulatory potential. Seven groups of diabetic rats (n=5) were orally administered 100mg/kg of each of the three partitioned fractions, metformin (500mg/kg), glibenclamide (5mg/kg), while untreated hyperglycaemic and normoglycaemic rats received distilled water (ad libitum) daily for 28 days. Mean relative organ weight of the brain, heart, kidney, pancreas and liver increased significantly (p<0.05) in untreated diabetic rats when compared to Lawsonia inermis treated rats and non-diabetic control. Diabetic treated rats showed non-significant (p>0.05) increased weight in all the organs except the pancreas that decreased non-significantly when compared to normoglycemic rats. The histopathology results showed that Lawsonia inermis improved the organ damage seen in diabetic complications through prevention of organomegaly and improvement in histoarchitectural appearance that is devoid of lesions when compared to untreated diabetic control with various lesions. Conclusively, Lawsonia inermis Linn leaves improve significant reduction in organ damage during course of Type 1 diabetes mellitus.
The Ceylon Journal of Science is a peer-reviewed journal published quarterly by the University of Peradeniya, Sri Lanka in March, June, September and December. It is aimed at publishing high quality research articles on topics related to different disciplines in Science. The journal accepts original research articles, book reviews, reviews and mini-reviews, short communications, opinions, research notes, and commentaries and notes. The Journal has its own website https://site.pdn.ac.lk/cjs/. The journal strictly adheres to publication ethics as emphasized by the Committee on Publication Ethics (COPE). It is indexed in Sri Lanka Journals Online (SLJOL), Directory of Open Access Journals (DOAJ), Google Scholar and Zoological Records. According to the Google Scholar;H5-Index: 12H5-Median: 15According to the Exaly (1970 – 2021);Impact Factor: 0.6 (top 19%)Extended IF: 0.6 (top 19%)H-Index: 8 (top 28%)Citations/paper: 1.42
The leaves of Lawsonia inermis Linn are used in the treatment of many diseases such as diabetes, poliomyelitis, measles and gynecological disorders such as menorrhagia, vaginal discharge and leucorrhoea. This study was designed to investigate the safety evaluation of Lawsonia inermis Linn leaves (acutely and sub-chronically) on physiological, biochemical and histopathological changes seen in Wistar rat. Acutely, female rats were divided into four groups (n=3) and treated as thus A (untreated control); B (1000 mg/kg); C (2000 mg/kg) and D (5000 mg/kg). Sub-chronically, 25 male Wistar rats were grouped into five (n=5). Groups: A (control), B (100 mg/kg); C (200 mg/kg); D (400 mg/kg) and E (800 mg/kg). Lawsonia inermis Linn leaves have a wide safety margin (>5000mg/kg) and no mortality or visible toxic reaction was observed in acute phase. Lawsonia inermis extract did not inhibit physiological weight gain, except the highest dose that caused some weight loss. Haematological result showed that PVC, RBC, haemoglobin and platelets had no significant (P>0.05) effect unlike white blood cell and differentials (neutrophils, lymphocytes and monocytes) which decrease significantly (P <0.05) across all the treated groups compared to untreated control. Serum chemistry showed a significant (P <0.05) decrease AST. ALT, ALP, creatinine, urea, Total protein and Total bilirubin had no significant (P <0.05) effects. Serum electrolytes; calcium ion, potassium ion, sodium ion and chloride ion had no significant (P <0.05) changes. Lawsonia inermis is safe at acute administered dosages while nephrotoxicity and spermiotoxicity may occur following subchronic administration.
Pregnancy toxaemia is often associated with negative energy balance, and ewes carrying multiple lambs are at risk due to high energy requirements. Deficient nutritional intake with a consequent body fat mobilization for energy, results in production of reactive oxygen species which leads to pathologic changes. This study aimed to evaluate the pathology and oxidative stress changes associated with pregnancy toxaemia in ewes. A total of 33 animals aged 2-3 years with mean weight of 40 ± 0.43 to 60 ± 0.50 kg, were selected from different private breeders’farms in Ilorin. Twenty-three animals that showed signs of pregnancy toxaemia (recumbence, weakness, and restlessness) were selected and labeled as group A. Ten healthy non-pregnant ewes were also labeled as group B. There was a significant increase in packed cell volume (PCV%), mean corpuscular volume (MCV), and glucose level in ewes with pregnancy toxaemia, while there was a significant decrease in superoxide dismutase (SOD), and catalase (CAT) levels in pregnancy toxaemia group. Postmortem findings included, congested ocular mucous membrane, congested and enlarged lungs, liver and spleen, congested intestinal mucosa and brain meninges, enlarged heart and dilated ventricles, atrophy of fat along the coronary grove of the heart, pale and enlarged liver, excess abdominal fat, and two dead fetuses. On the other hand, the histopathological examination of the pregnancy toxaemia group showed livers with oedematous areas and regular border vacuoles. The lungs were also congested and oedematous There is tubular necrosis and areas of congestion in the kidneys. In conclusion, this study reveals significant hematological and biochemical changes indicative of oxidative stress, alongside pathological findings in various organs such as the liver, lungs, and kidneys. These results underscore the complexity of pregnancy toxaemia and emphasize the need for further research to develop better management strategies.
Abstract Dermatophilus congolensis, the aetiological agent of dermatophilosis, is a pleomorphic, Gram‐positive actinomycete, which infects animals and humans. Often, there is a wrong diagnosis of the infection in animals because of the close resemblance of the organism with other members of the family Actinomycetaceae . In this study, molecular tools were applied to suspected isolates of D . congolensis obtained from naturally infected cattle in Nigeria for confirmation of dermatophilosis. DNA extraction from 54 suspected pure colonies of D . congolensis was carried out using the QIA amp ® DNA Mini extraction kit. PCR targeted at the 16S rRNA gene was employed for the confirmation of D . congolensis using 5′‐ ACATGCAAGTCGAACGATGA ‐3′ and 5′‐ ACGCTCGCACCCTACGTATT ‐3′ as forward and reverse primers, respectively. Positive amplicons were then sequenced directly using Big Dye Terminator Cycle Sequencing Kit with the forward primers and AmpliTaq‐ FS DNA Polymerase. Nucleotide sequences were aligned using bioedit (Ibis Biosciences Carlsbad, CA USA) and the phylogenetic analysis was carried out using mega 5.2 (Center for Evolutionary Medicine and Informatics, The Biodesign Institute, Tempe, Arizona, USA) software programme. The aligned nucleotide sequences of 10 positive D . congolensis isolates had between 94% to 99% homology with the sequences of D . congolensis satellite DNA in GenBank. This result also revealed that the sequenced D . congolensis are of different strains. Phylogenetic analysis revealed that D . congolensis , though closely related to Nocardia brasiliensis ( NR 074743.01) and Streptomyces sp. ( JN 400114.1), belongs to different genus. In conclusion, molecular tools employed in the study were able to confirm the identity of the test organisms as D . congolensis . It can also be concluded that two strains of D . congolensis obtained from the study can still be accommodated within the previously listed strains available in GenBank while the remaining eight may be different strains of D . congolensis not yet listed in GenBank.
Introduction: Salmonellosis constitutes a major threat to poultry industry in Nigeria. The study investigated the roles of rodents, lizards and fomites in the transmission of Salmonella in poultry farms. Methods: A total of 320 samples consisting of litter (n = 70), feed (n = 50), water from drinkers (n = 50), cloacal swabs from chicken (n = 50), faeces from rodents (n = 50) and faeces from lizards (n = 50), were collected from selected poultry farms in Maiduguri, Borno State between March and August, 2011. The samples were subjected to standard bacteriological analyses and presumptive Salmonella isolates were serotyped using slide agglutination technique. Results: A total of 31 (9.7%) Salmonella isolates comprising 7 serovars were obtained. Salmonella serovars Kentucky and Enteritidis were the major serovars recovered from all sample sources and these represent 3.4 % (n= 11) and 3.1 % (n= 10) respectively. These serovars were the predominant in rodents and lizards and were equally isolated from chicken and other samples, however, Salmonella Hadar was only isolated from litters, but not from chicken or other environmental samples (feed or water). Significance: It was concluded that rodents and lizards play significant roles in poultry Salmonella infection via environmental contamination. Farmers should focus more attention on these agents of Salmonella carriage in the poultry environment.
A survey on the prevalence of tuberculosis in cattle slaughtered in Maiduguri Central abattoir was carried out during the month of May to June 2008. This involves detailed investigation of the cattle slaughtered in the abattoir for the presence of tuberculous lesions, analysis and interpretation of the data obtained from abattoir records for the period under investigation. Out of the 265,722 cattle slaughtered during the period of the survey, 2,902(1.1%) were positive for pulmonary tuberculosis. The annual prevalence during the study varied between 0.5- 6.4%. The monthly (mean) prevalence of bovine tuberculosis was highest in the month of July, with prevalence rate of 1.4%. It was observed that there was no seasonal difference in the prevalence of bovine tuberculosis.Keywords: Mycobacterium bovis, retrospective, Bovine, tuberculosis, abattoir.
