Analysis of Interaction between Dendriplexes and Bovine Serum Albumin
Dzmitry ShcharbinElżbieta Pędziwiatr‐WerbickaLouis ChoncoJesús F. Bermejo-MartínPaula OrtegaF. Javier de la MataRamón EritjaRafael GómezBarbara Klajnert‐MaculewiczMaria BryszewskaMaría Ángeles Muñoz‐Fernández
53
Citation
13
Reference
10
Related Paper
Citation Trend
Abstract:
Dendrimers are new nanotechnological carriers for gene delivery. Short oligodeoxynucleotides (ODNs) are a new class of antisense therapy drugs for cancer and infectious or metabolic diseases. The interactions between short oligodeoxynucleotides (GEM91, CTCTCGCACCCATCTCTCTCCTTCT; SREV, TCGTCGCTGTCTCCGCTTCTTCCTGCCA; unlabeled or fluorescein-labeled), novel water-soluble carbosilane dendrimers, and bovine serum albumin were studied by fluorescence and gel electrophoresis. The molar ratios of the dendrimer/ODN dendriplexes ranged from 4 to 7. The efficiency of formation and stability of the dendriplexes depended on electrostatic interactions between the dendrimer and the ODNs. Dendriplex formation significantly decreased the interactions between ODNs and albumin. Thus, the formation of dendriplexes between carbosilane dendrimers and ODNs may improve ODN delivery.Keywords:
Bovine serum albumin
Serum Albumin
Human serum albumin
Methoxypolyethylene glycols of 1900 and 5000 daltons have been attached covalently to bovine serum albumin using cyanuric chloride as the coupling agent. When sufficient polymer is attached, the modified bovine serum albumin appears to lose its immunogenicity in the rabbit and, on intramuscular or intravenous injection, elicits antibodies neither to itself nor to native bovine serum albumin. It does not react with antibodies raised against native bovine serum albumin. Bovine serum albumin to which methoxypolyethylene glycol has been attached exhibits a blood circulating life in the rabbit rather similar to native bovine serum albumin, except that it is not removed from circulation by the eventual development of antibodies. Modified bovine serum albumins which had been iodinated with 125I, or prepared with [14C]cyanuric chloride, were injected intravenously in rabbits. Both labels appeared almost quantitatively in the urine after 30 days. The modified bovine serum albumins showed substantial changes in properties, such as solubility, electrophoretic mobility in acrylamide gel, ion exchange chromatography, and sedimentation, as compared with the unmodified protein.
Cyanuric chloride
Bovine serum albumin
Serum Albumin
Blood serum
Cite
Citations (1,320)
Bovine serum albumin
Serum Albumin
Cite
Citations (4)
Delayed type hypersensitivity (DTH) to bovine serum albumin (BSA) and to lipid-conjugated BSA were studied comparatively. Unlike the case of BSA with which no DTH can be detected with native antigen, injection of butyric-conjugated BSA (Bu-BSA) in sensitized mice provokes a typical DTH for an early and limited period. Alum-precipitated Bu-BSA (Al-Bu-BSA) provokes from the beginning a stronger DTH which persists a much longer period.
Bovine serum albumin
Serum Albumin
Cite
Citations (2)
The binding of glycyrrhizin (GLZ) to human serum and human serum albumin (HSA) was examined by an ultrafiltration technique. Specific and nonspecific bindings were observed in both human serum and HSA. The association constants (K) for the specific binddings were very similar : 1.31×105M-1 in human serum and 3.87×105M-1 in HSA. The number of binding sites (n) and the linear binding coefficient (Φ) in HSA were 1.95 and 3.09×103M-1, respectively.When the human serum protein concentration ws assumed to be 4.2% (equal to the measured serum albumin concentration), n in human serum was 3.09, which is similar to the n value in HSA, and Φ in human serum was 0.71×103M-1, which is reasonably close to that for HSA. The binding pattern of GLZ with human serum protein on Sephadex G-200 column chromatography showed that GLZ binds to only the albumin fraction.It was concluded that the GLZ-binding sites in human serum exist mainly on albumin and GLZ binds to specific and nonspecific binding sites at lower and higher concentrations that approximately 2mM, respectively.
Human serum albumin
Glycyrrhizin
Sephadex
Serum Albumin
Ultrafiltration (renal)
Human albumin
Cite
Citations (17)
The lipid A component of bacterial lipopolysaccharides (endotoxins), when complexed to bovine serum albumin (BSA) or human serum albumin (HSA), was shown to be a potent pyrogen. Furthermore, rabbits could be protected against endotoxin fever by immunization with both lipid A·BSA and lipid A·HSA complexes. The results presented in this paper show that lipid A is responsible for the pyrogenic activity of endotoxins and their ability to induce pyrogenic immunity.
Bovine serum albumin
Lipid A
Serum Albumin
Human serum albumin
Cite
Citations (65)
Bovine serum albumin
Serum Albumin
Cite
Citations (14)
The association equilibria for complex formation between serum albumin (bovine, rat) and the optical isomers of methamphetamine (MAMP) was determined using an ultrafiltration method. It was found that serum albumin/d-MAMP and serum albumin/l-MAMP complexes had distinctly different Scatchard plots with bovine and rat albumin. The binding parameters of each association equilibrium were estimated from the Scatchard plots by Rosenthal's graphic method. This distinguished two kinds of specific binding sites in terms of the association equilibrium between bovine serum albumin and d-MAMP, and one binding site for rat serum albumin and d-MAMP. One specific binding site was found between serum albumin and l-MAMP in both bovine and rat. Molar ellipticities, [θ], of peaks were decreased in the CD spectra of the complexes formed between bovine serum albumin and d-MAMP or l-MAMP when compared with the CD spectrum of bovine serum albumin alone. However, no difference in [θ] was found between the CD spectra of the enantiomers of MAMP in the measured wavelength range. The non-specific binding site was distinct from the specific binding site and resulting from altered tertiary structure of the albumin molecule. Chirality 10:742–746, 1998. © 1998 Wiley-Liss, Inc.
Bovine serum albumin
Serum Albumin
Cite
Citations (0)
Bovine serum albumin
Serum Albumin
Cite
Citations (3)