Erratum: Corrigendum: Characterization of a P1-like bacteriophage carrying CTX-M-27 in Salmonella spp . resistant to third generation cephalosporins isolated from pork in China

Scientific Reports 7: Article number: 40710; published online: 18 January 2017; updated: 26 April 2017 This Article contains errors in the Materials and Methods section under subheading ‘Prevalence investigation of P1-like bacteriophage in Salmonella isolates’, where incorrect primers were quoted. “The presence of the insertion sequence on the other nontypeable plasmids carrying bla CTX-M-27 gene was detected using the following primers: IS-fw (AGAATCATCGC CGAAGGGCTGTAACTGGTTTT) and IS-rev (GCGAACATCATCCGTTGCACT CTCTTTGT)”.