Rt-lamp rapid detection of citrus tristeza virus

The invention belongs to the field of biotechnology and discloses an RT-LAMP detection method for citrus tristeza viruses. Based on RT-LAMP and the gene sequence of different stains of CTV issued by GenBank, four specific primers required by the RT-LAMP detection method are designed in accordance with the conserved regions of the sequences of the viruses, and the sequences of the four primers areshown below: F3: CGAAGTGGATTTGTCTGACA; B3: GGAATCCCTGCATCTAGCG; FIP:ACTCGAAGGGCGTTAGTACGGCTTTGGACTGACGTCGTGTT; and BIP: CTGGGGTAGGACTAACGATGCCGACGTCCGCCATAACTCAA. The four primers are completely matched with 6 regional sequences in a target sequence respectively. Experiment results indicate that the sensitivity of the method is 100 times higher than a common reverse transcription-polymerase chainreactions (RT-PCR) method and has high virus early diagnosis accuracy. The result obtained by the method is consistent with that obtained by the RT-PCR detection method, but more sensitive and accurate than that obtained by a direct tissue blot immuno-assay (DTBIA) method. The method can quickly, accurately and sensitively detect CTV, and is suitable for quick detection of a sample, CTV spread monitoring, virus-free seedling identification and tristeza virus identification.