Malathion aptamer, derivative and application thereof

The invention relates to the technical field of biology, and in particular relates to a malathion aptamer, a derivative and application thereof. The nucleotide sequence of the malathion aptamer is TCTTGATCTGTAGTCCTGCAGCGATTCAAGACGGATACCCGT CACGCGGCTGC or the complementary sequence thereof. Malathion is detected and analyzed by the steps of: incubating the malathion aptamer and a target solution; then adding a molecular beacon and incubating again; and finally detecting the fluorescence intensity of the system, comparing with a blank control group and calculating the fluorescent inhibition ratio. The malathion aptamer obtained by screening by a systematic evolution of ligands by exponential enrichment (SELEX) technology has the advantages of high specificity, high affinity, high stability, convenience for use and the like, and can be applied to detection and analysis on malathion.