TPTE “Cancer/Testis” antigen is a candidate target for immunotherapy in epithelial ovarian carcinoma

2583 Background: Cancer/testis (CTA) antigens expression is highly tissue-restricted, immunogenic in cancer patients, and are novel targets for cancer vaccine.These CTA are expressed in different tumors and normal testes, but not in other normal tissues. Transmembrane phosphatase with tensin homology (TPTE) is a novel, 2761 bp long CTA located on chromosome 21p11 and shares significant homology with tumor suppressor protein PTEN. Our study goals were to determine TPTE expression in epithelial ovarian carcinoma (EOC) and examine for correlation with clinical outcome. Methods: Frozen specimens were obtained from 100 patients with EOC treated between 1995 and 2003. Following isolation of total RNA, one-step reverse transcriptase PCR (RT-PCR) was performed on the EOC tissues, 8 cancer cell lines (IOSE, HOSE, OVCA-3, OV-2774, SKOV-6, OVCA-429 and SKOV-3) and 16 normal tissues. A 433 bp TPTE specific PCR product was amplified using TPTE specific sense 5’TTTATTCGATTCCTCGTTATGTACG3’ and antisense 5’ACATAATTCTTTCC...