Exploring the Binding of Calothrixin A to the G-Quadruplex from the c-myc Oncogene Promotor

Calothrixin A, a bioactive pentacyclic metabolite from the cyanobacteria Calothrix, has potent antiproliferative behaviour against several cancer cell lines. The in vitro binding of calothrixin A to the DNA quadruplex formed at the promotor region of c-myc was investigated by monitoring changes in the fluorescence emission of 2-aminopurine (2Ap)-substituted analogues of the native Pu22 sequence d(TGAGGGTGGGGAGGGTGGGGAA) on titration with calothrixin A and N-methoxymethyl-calothrixin B. Calothrixin A binds to Pu22 and its constituent loop isomers with a micromolar dissociation constant whereas N-methoxymethyl-calothrixin B has over an order of magnitude lower affinity. Competitive displacement experiments with double-stranded DNA showed preferential binding of calothrixin A to the Pu22 quadruplex compared with double-stranded DNA. The association of calothrixin A with DNA quadruplexes is the first direct evidence that calothrixin A binds to DNA and may aid in the understanding of the bioactivity of the calothrixins.