ETHANOL PRESERVATION OF FIRE ANTS ALLOWS RETROSPECTIVE SCREENING FOR SOLENOPSIS INVICTA VIRUS-1

Solenopsis invicta virus-1 (SINV-1) is a positive-strand RNA virus assigned to the Dicistroviridae (Mayo 2002) that appears to infect ants only in the Solenopsis genus (Valles et al. 2007). SINV1 infection has been associated with brood death among colonies of Solenopsis invicta , but whether it is the causative agent of mortality is not known (Valles et al. 2004). Thus, it is hoped that SINV-1 may be able to be exploited for use as a microbial control agent, or as a mode of delivering genes or inhibitors to study functional genomics in this ant pest. Because the virus was only recently discovered and it is the only currently known virus to infect S. invicta , basic knowledge about its biology is lacking. Epidemiologic and phylogenetic studies would certainly benefit if the virus could be examined in archived samples. To address this question, we archived SINV-1-positive S. invicta worker ants in 95% ethanol and tested the ants for the presence of SINV-1 on an irregular basis over a 2-year period. In addition, we examined 2propanoland ethanol-archived S. invicta samples from 1999 and 2001, respectively, for the presence of SINV-1. In February 2005, 2 groups of approximately 300 worker ants from a colony of S. invicta previously determined to be SINV-1-positive (collected from Gainesville, FL) were placed into a 7-ml scintillation vial containing 5 ml of 95% ethanol and stored at room temperature. On an irregular basis over the next 2 years, RNA was extracted from a group of 20 workers from each vial. RNA was extracted by the Trizol (Invitrogen, Carlsbad, CA) method as described previously (Valles & Strong 2005). cDNA was synthesized and subsequently amplified by the One-Step RT-PCR kit (Invitrogen) with oligonucleotide primers p114 (5’ CTTGATCGGGCAGGACAAATTC) and p116 (5’ GAACGCTGATAACCAATGAGCC). Samples were considered positive for virus when a visible amplicon of anticipated size (646 nt) was present after separation on 1.2% agarose gel containing ethidium bromide. Positive and negative controls were included for each time point. RT-PCR was conducted in a PTC 100 thermal cycler (MJ Research, Waltham, MA) under the following optimized temperature regime: 1 cycle at 45°C for 30 min, 1 cycle at 94°C for 2 min, 35 cycles of 94°C for 15 s, 54°C for 15 s, 68°C for 30 s, followed by a final elongation step of 68°C for 5 min. Additional alcohol-archived S. invicta ant samples from previous surveys of Florida were examined for the presence of SINV-1 by RT-PCR. Samples from 2001 were archived in 95% ethanol, and those from 1999 were archived in 70% 2-propanol. Table 1 summarizes the results of ethanol preservation on SINV-1 detection in S. invicta . At every time point over the course of the 2-year