Contribution of western and eastern species to the Iranian pear germplasm revealed by the characterization of S-genotypes.

Iran is recognized as an important source of genetic diversity of pear germplasm including native and introduced species. It is located in the Mid-Asian, center of diversification of the genus Pyrus, where several species have originated; moreover, the Silk Road historically favoured an intense exchange of cultivated crops and agricultural technologies during the course of trade and cultural transmission between ancient China and central/West Asia. Thus, Iran is maybe one of the first places where specimens of Pyrus communis imported from Europe could have come into contact with Pyrus pyrifolia, syn. P. serotina genotypes coming from eastern Asian countries. Moreover, pear species exhibit the S-RNase-based gametophytic self-incompatibility system that prevents self-fertilization thus forcing out-crossing. Since there is no major barrier for hybridization in Pyrus, several different species might have contributed to the makeup of the Iranian traditional germplasm. The characterization of self-incompatibility ribonucleases in Iranian P. communis cultivars and landrace genotypes revealed that, in addition to the pool of alleles previously detected in European cultivars, the Iranian germplasm shows the presence of alleles most likely introduced via hybridization with cultivated or wild Pyrus species. INTRODUCTION The Pyrus species belong to the subfamily Pomoideae of the Rosaceae which exhibit the so-called S-RNase based gametophytic self-incompatibility(GSI) system; this system controls pollen-pistil recognition through the action of at least two genes that are encoded at a single locus (S-locus) (De Franceschi et al., 2012). As the incompatibility mechanism prevents self-fertilization, and also the allelic composition at the S-locus determines the cross-compatibility between cultivars, knowledge of the S-genotypes of cultivars is important to guarantee efficient cross pollination in orchards and to select correct crossing combinations in breeding programs. The first characterization of the S-RNase in Rosaceae was reported by Sassa and co-workers in Japanese pear (Sassa et al., 1992). The subsequent characterization of multiple S-RNase alleles in Pyrus species facilitated further research on S-genotyping and breeding programs by cloning cDNA and genomic sequences (Ushijima et al., 1998; Zuccherelli et al., 2002; Sanzol, 2002; Takasaki et al., 2004; Sanzol et al., 2006; Moriya et al., 2007; Sanzol and Robbins, 2008; Goldway et al., 2009; Saito et al., 2011). The S-RNase gene is hetero-allelic, highly polymorphic and characteristic for each haplotype, showing enough variation to allow the development of molecular markers for S-genotyping (Goldway et al., 2009). This gene has five consensus conserved regions (C1, C2, C3, RC4, and C5) and the highly conserved non-canonical hexapeptide (IIWPNW) region located exactly downstream of the hyper-variable region (HVR), which can be used to design consensus primer pairs directed to amplify a large number of alleles for S-genotyping through a PCR assay (Sanzol, 2009). Moreover, the results of S-genotyping of wild pear by Wolko et al. (2010) showed that several alleles of Pyrus pyraster display a high degree of homology with the S-RNase alleles of Pyrus communis, Proc. I IS on Fruit Culture and Its Traditional Knowledge along Silk Road Countries Ed.: D. Avanzato Acta Hort. 1032, ISHS 2014 160 but they are not the same, hence their transfer must have occurred a long time ago. It has been proposed that the high S-allele diversity found in the wild pear population could be due to a high immigration rate of new S-alleles, which would subsequently experience positive frequency dependent (balancing) selection. Thus, the gene flow from neighboring wild populations or cultivated varieties could potentially increase the S-allele diversity in a population of wild pear (Hoebee et al., 2011). Iran is located in the Mid-Asian center of diversification, where species such as Pyrus glabra Boiss., Pyrus korshinskyi Litv., Pyrus longipes Coss. & Dur., Pyrus pashia D. Don., Pyrus regelii Rehd., and Pyrus salicifolia Pall. have originated (Kole, 2011). Moreover, as a country on the Silk Road, Iran has historically been involved in commercial exchanges between Europe and the middle and East Asian countries; it is flanked on the one side by the East Asian zone, center of origin of some important cultivated species such as Pyrus ussuriensis Maxim, Pyrus × bretschneideri Rehd. and especially P. pyrifolia (syn. P. serotina); and on the other side by Turkey and Europe, center of origin of P. communis L. (Kole, 2011). In such a position, many different species might have contributed to the Iranian traditional pear germplasm. Most notably, some of the most important Iranian cultivars are supposed to have originated by hybridization of European pear with other cultivated species, among which P. pyrifolia (syn. P. serotina) is supposed to have played the most relevant role (Sharifani et al., 2008; Erfani et al., 2012). In the present study 40 Iranian pear cultivars and wild genotypes, plus 20 European pear cultivars used as references, were genotyped using consensus and allele-specific primers, adopting the PCR-based genotyping assay described by Sanzol (2009). To assess the contribution of Japanese pear, the method was implemented to allow the detection of the most common S-RNase alleles from P. serotina. The results highlighted moreover the presence of two alleles of P. serotina in cultivars and genotypes of P. communis. MATERIALS AND METHODS Plant Material and DNA Extraction Sixty Pyrus genotypes including European and Iranian pear cultivars and landrace genotypes were analyzed in this study (Table 1). Healthy leaf material was gathered from trees maintained at the Seed and Plant Improvement Institute (SPII; Karaj, Iran), Gilan Agricultural & Natural Resources Research Center (GANRC; Gilan, Iran), West Azerbaijan Agricultural & Natural Resources Research Center (WANRC; Uromia, Iran), Research Institute of Forests & Rangelands (RIFR; Tehran, Iran), Dipartimento di Scienze Agrarie (Dipsa; Bologna, Italy) and Centro de Investigacion y Tecnologia Agroalimentaria de Aragon (CITA, Zaragoza, Spain). Leaves were deep-frozen at -80°C and lyophilized in a Heto lyophilizer (HITOSICC, Heto-Holten A/S, Denmark). For extraction of DNA, leaf tissue (0.05 g) of each genotype was ground to fine powder with a mechanical mill (Mixer Mill MM 300, Retsch GmbH & Co. KG) and DNA was extracted following a modified Cetyl Trimethyl Ammonium Bromide (CTAB) protocol (Maguire et al., 1994). DNA concentration and purity were assessed using a Nanodrop ND-1000 UV-Vis spectrophotometer (NanoDrop Technology, Rockland, DE). S-Genotyping Assay, Cloning and Sequence Analysis The PCR-based method described by Sanzol (2009) for the detection of 20 European pear S-RNase alleles was implemented with additional allele-specific primer pairs directed to amplify alleles PcS116, PcS117 and PcS125 from P. communis and also P. pyrifolia (syn. P. serotina) PpS1 to PpS9 (Table 2). All the designed primers were developed using Primer3 (Untergasser et al., 2012). PCR with the consensus Primers PycomC1F1 (5’attttcaatttacgcagcaatatcagc3’) and PycomC5R1 (5’ ctgcaaaggacctcaacc aattc 3’) and allele-specific primer pairs was performed under the following condition: 50 ng genomic DNA, 1× PCR reaction buffer, 2 mM MgCl2, 0.6 unit Taq DNA polymerase (Applied biosystem, Amplitaq Gold DNA Polymerase), 0.2 mM each dNTP