Single-molecule MicroRNA Electrochemiluminescence Detection Using Cyclometalated Dinuclear Ir(III) Complex with Synergistic Effect

The realization of electrochemiluminescence (ECL) detection at single-molecule level is a longstanding goal of ECL assay that requires novel ECL probe with significantly enhanced luminescence. Here, synergistic effect of electrochemiluminescence (ECL) is observed unprecedentedly in a new cyclometalated dinuclear Ir(III) complex [Ir2(dfppy)4(imiphenH)]PF6 (1PF6, PF6- = hexafluorophosphate) in which two {Ir(dfppy)2}+ units are bridged by an imiphenH- ligand. The ECL intensity from complex 1PF6 is 4.4 and 28.7 times as high as that of its reference mononuclear complexes 2 and 3PF6, respectively. Theoretical calculation reveals that the S0 to S1 excitation is a local excitation in 1•PF6 with two electron-coupled Ir(III) centers, which contributes to the enhanced ECL. The synergistic effect of ECL in 1PF6 can be used to detect microRNA 21 at single-molecule level (microRNA 21: UAGCUUAUCAGACUGAUGUUGA), with detectable ECL emission from this complex intercalated in DNA/microRNA 21 duplex as low as 90 helix m...