Smith-Lemli-Opitz syndrome

The Smith-Lemli-Opitz syndrome (SLOS) is an inborn disorder of sterol metabolism with characteristic congenital malformations and dysmorphias. All patients suffer from mental retardation. Here we identify the SLOS gene as a A7-sterol reductase (DHCR7, EC 1.3.1.21) required for the de novo biosynthesis of cholesterol. The human and murine genes were characterized and assigned to syntenic regions on chromosomes 11q13 and 7F5 by fluorescense in situ hybridization. Among the mutations found in patients with the SLOS, are missense (P51S, T93M, L99P, L157P, A247V, V326L, R352W, C380S, R404C, and G410S), nonsense (W151X), and splice site (IVS8-lG>C) mutations as well as an out of frame deletion (720-735 del). The missense mutations L99P, V326L, R352W, R404C, and G410S reduced heterologous protein expression by >90%. Our results strongly suggest that defects in the DHCR7 gene cause the SLOS. The autosomal recessive Smith-Lemli-Opitz syndrome (SLOS, MIM 270400) is a remarkable example of an inborn error of metabolism that impairs morphogenesis. Phenotypic expression is variable and comprises congenital anomalies such as microcephaly, cleft palate, syndactyly of toes 2 and 3, polydactyly, and visceral malformations as well as postnatal failure to thrive and mental retardation (1). Genitalia in severely affected boys are either ambiguous or fail to become masculinized (1). A deficiency of the ultimate step of cholesterol biosynthesis is suspected to cause the SLOS because a decrease of plasma cholesterol and the accumulation of its precursor 7-dehydrocholesterol are always observed (2). Sterol metabolism depends on the tight regulation of endogenous biosynthesis and receptor mediated transport (3). Failure to remove the A7-bond in de novo-synthesized sterols could be caused by a deficiency of the catalytic subunit, a regulatory protein, or of a cofactor of the A7-sterol reductase (DHCR7). We recently cloned the cDNA encoding the catalytic subunit of the enzyme (4). Using this cDNA, we now isolated and characterized the corresponding human and mouse genes. Among the mutations found in patients with biochemically confirmed diagnosis of SLOS were ten missense, one nonsense, and one splice acceptor site mutation as well as a 16-bp deletion. Several of the missense mutations reduced heterologous protein expression by >90%. This result strongly suggests that DHCR7 defects cause the SLOS. EXPERIMENTAL PROCEDURES Isolation and Mapping of the Human DHCR7 Gene. A P1 clone from a human genomic library (clone I.D. The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. ?1734 solely to indicate this fact. ? 1998 by The National Academy of Sciences 0027-8424/98/958181-6$2.00/0 PNAS is available online at http://www.pnas.org. ctase gene in patients with the :t, MARTIN ERDELt, JOON No LEES, YOUNG-KI PAIKt, N F. MOEBIUS*? Strasse 1, A-6020 Innsbruck, Austria; tInstitut fur Medizinische Biologic und of Biochemistry and Bioproducts Research Center Yonsei University, Seoul L and approved May 7, 1998 (received for review April 9, 1998) ICRFP700C2137Q06) was isolated by hybridizing a 32p labeled human DHCR7 cDNA probe to prespotted filters obtained from the Resource Centre/Primary Database (Berlin, Germany). Intron-exon boundaries were identified by PCR amplification of intron sequences by using cDNA sequence-derived oligonucleotides and DNA sequencing. Sites for restriction enzymes were mapped by Southern hybridization of exon-specific probes to P1 clone digests and digestion of PCR-amplicons, respectively. Cloning of the Murine cDNA and Gene. Mouse Dhcr7 cDNAs were identified in the expressed sequence tag database with the TBLASTN algorithm. The clone with the longest 5'-sequence (GenBank accession no. AA003001) was sequenced entirely and found to contain a 262-bp deletion. Another clone (GenBank accession no. AA475208) as well as two reverse transcription-PCR products from mouse liver contained the deleted region that was replaced with a BamHIXbaI fragment from clone AA475208. Vectors for heterologous expression in yeast (mD7-ORF and mD7-myc) were prepared with oligonucleotides CCGCTCGAGAAAATGGCTTCGAAATCCCAGC (introducing a XhoI site upstream of the start codon) and CCGCTCGACAGATCTTGCTTCGAAATCCCAGCAC (introducing a 5' BglII site in frame with the 9E10 c-myc epitope cassette, ref. 4). For Northern blot analysis a 32P-labeled Dhcr7 cDNA was hybridized to mouse multiple tissue Northern blots (CLONTECH). A cosmid clone (clone I.D. MPMGc121P1353Q3) was isolated from a genomic library (strain 12901a) by hybridizing the 32P-labeled Dhcr7 cDNA probe to prespotted filters obtained from the Resource Centre/Primary Database (Berlin, Germany). Genetic Analysis. All patients were diagnosed with SLOS by their physicians who provided DNA or blood samples for molecular analysis. The clinical diagnosis was biochemically confirmed by identification of 7-dehydrocholesterol in the serum by gas chromatography and mass spectrometry. Genomic DNA was prepared from cultured fibroblasts (SLO5 and SL09) or peripheral lymphocytes. Exons 3-9 were amplified by using PCR (annealing temperature 65?C) with the oligonucleotides shown in Table 2. For single strand conformation polymorphism (SSCP) analysis, 7 pt1 of a PCR reaction was subjected to electrophoresis on a Mutation Detection Enhancement (FMC) gel that was stained with silver (5). PCR products were purified on QIAquick columns (Qiagen) and cycle sequenced on an ABI377 automated sequencer (PerkinsElmer). PCR analysis of cDNA from fibroblasts with cDNA sequence-derived oligonucleotides was performed by isolating mRNA with RNAzol B (Molecular Research Center, CincinThis paper was submitted directly (Track II) to the Proceedings office. Abbreviations: DHCR7, A7-sterol reductase; SLOS, Smith-LemliOpitz syndrome; wt, wild type; TMS, transmembrane segment; SSCP, single strand conformation polymorphism. Data deposition: The sequence reported in this paper has been deposited in the GenBank database (accession no. AF057368). ?To whom correspondence should be addressed. 8181 This content downloaded from 157.55.39.163 on Wed, 21 Sep 2016 05:58:49 UTC All use subject to http://about.jstor.org/terms 8182 Genetics: Fitzky et al. nati, OH), and transcribing cDNA with a 1st strand cDNA synthesis kit (Pharmacia). Fluorescence in Situ Hybridization. Fluorescence in situ hybridization was performed as described (6) by using DNA from the genomic human P1 and the murine cosmid clone, respectively. Chromosomal in situ suppression hybridization and detection by immunofluorescence was carried out on metaphase chromosome preparations from phytohemagglutinin-stimulated normal human lymphocytes and normal mouse embryo fibroblasts with biotinylated (human) or digoxigeninlabeled (mouse) probes. Fifty of 50 human and 66 of 80 mouse metaphase cells exhibited specific labeling of one or both homologs of chromosomes 11 and 7, respectively. In Vitro Mutagenesis and Heterologous Expression of Mutated cDNAs. A modified wild-type (wt) DHCR7 cDNA was constructed from mycD7-ORF (4) in pBluescriptKSII (Stratagene) by introducing a SpeI restriction site with oligonucleotide GGAATTCACTAGTCCTTAGAAGATTCCAGGC. Mutations were introduced inAccI-SacI (296T>C) and SacISpel (976G>T, 1054C>T, 1210C>T, 1228G>A, 1158C>T, 1272T>C, and 976T>G) cassettes by two-step mutagenesis as described (7). Second site mutagenesis was ruled out by DNA sequencing of both strands. wt and mutated cDNAs were subcloned into pCIneo (Promega) with XhoI-NotI restriction sites. Cultivation of tsA-201 cells and calcium phosphate transfection (6 /g of specific vector DNA; 9 p.g of pUC18 carrier DNA/100-mm dish) were performed as described (8, 9). The amount of specific vector DNA used for transfection was saturating, and no decrease in wt cDNA expression was observed when 10-fold lower DNA concentrations were used. For cotransfection, 3 p.g of each DHCR7 construct (wt and mutants), 3 p.g of human emopamil-binding protein/sterol A8-A7 isomerase (10) in pCIneo, and 9 p.g of pUC18 carrier DNA/100-mm dish were used. Protein concentrations were determined as described (4) with BSA as a standard.