Methylation of the hTERT promoter is frequent in choroid plexus tumors but not of independent prognostic value

2014 
Choroid plexus tumors are rare intraventricular neoplasms occurring predominantly in children. The group of choroid plexus tumors is made up of choroid plexus papillomas (WHO grade I), atypical choroid plexus papillomas (WHO grade II) and choroid plexus carcinomas (WHO grade III). While choroid plexus papillomas usually have an excellent clinical prognosis, children with choroid plexus carcinomas face five year survival rates between 27 and 46 % [1]. Chromosomal aberrations in choroid plexus carcinomas are complex [2], but little is known about epigenetic alterations and their potential prognostic value. Methylation upstream of the transcription start site (UTSS) of the human telomerase reverse transcriptase (hTERT) promoter is a frequent event in pediatric brain tumors [3]. However, in choroid plexus tumors only limited data regarding the methylation status of the hTERT promoter is available, and its prognostic role has not yet been evaluated. We therefore aimed to examine the frequency and prognostic impact of hTERT promoter methylation status in a large series of choroid plexus tumors. Formalin-fixed paraffin-embedded tissue samples of 99 choroid plexus tumors (36 choroid plexus papillomas, 26 atypical choroid plexus papillomas and 37 choroid plexus carcinomas) were collected from the archives of the Institute of Neuropathology Munster and from institutions that had previously submitted cases for reference in context of the CPT-SIOP studies. All samples were reviewed neuropathologically according to current WHO criteria. Followup data was collected from the CPT-SIOP database (available for 20 choroid plexus papillomas, 17 atypical choroid plexus papillomas and 33 choroid plexus carcinomas). Permission for collection and scientific use of all tumor samples was obtained from the local ethical committee (Munster 2007-420-f-S). After isolation of genomic DNA using the Maxwell LEV FFPE Tissue DNA Purification Kit (Promega, Mannheim, Germany), bisulfite conversion was performed (EZ DNA Methylation-Gold-Kit, Zymo Research, Orange, CA). DNA was then subjected to methylation specific PCR, using specifically designed primers interrogating four UTSS CpG sites of the hTERT promoter described to be clinically relevant in other pediatric brain tumors [3] (FWD-primer for both methylated and unmethylated: 50-GGGAAGTGTTGTAGGGAGGTATTT; REV-primer for methylated: 50-CGTACGACGACCCTTTAACCG; REV-primer for unmethylated: 50CATACAACAACCCTTTAACCA). This approach allows for distinction of tumors with no methylation of the four interrogated CpG sites versus those tumors with methylation of all of these CpG sites. PCR-products were visualized using the Agilent 2200 TapeStation (Agilent Technologies, Santa Clara, CA, USA). Methylation of the hTERT promoter was found in 47/99 choroid plexus tumors (47 %, see Online Resource 1). As Electronic supplementary material The online version of this article (doi:10.1007/s11060-014-1473-7) contains supplementary material, which is available to authorized users.
    • Correction
    • Source
    • Cite
    • Save
    • Machine Reading By IdeaReader
    3
    References
    8
    Citations
    NaN
    KQI
    []