P121 CCR5 Delta 32 polymorphism is not associated with non-HLA antibody mediated rejection in heart transplant

Aim C–C chemokine receptor type 5 (CCR5) is predominantly expressed on T cells, macrophages, and dendritic cells. In addition to the wild type allele, a null allele (CCR5 Delta 32) has a 32-base pair (bp) deletion (CCR5Delta32) in the coding region. Antibody mediated rejection (AMR) can be caused by non-HLA antibodies. In this study, we determined if the recipient diagnosed as non-HLA antibody mediated rejection is the CCR5 Delta 32 allele homozygous, hence could develop antibody against CCR5 which the donor carries. Methods 11 heart transplant patients were diagnosed with AMR based on biopsy, but no donor specific HLA antibodies were detected. We performed CCR5 genotyping on these recipients and their donors by polymerase chain reaction (PCR). PCR primers (Forward (5’- AGGTACCTGGGCTGTC GTCCCCCA; Reverse 5’CTCACAGCCCTGTGCCTCTTC) were used to amplify the wild type alleles (329 bp) and the null allele CCR5Delta 32(297 bp). Results Out of 11 patients, one patient was heterozygous at the CCR5 locus, carrying the wildtype allele and null allele CCR5Delta32. Out of 10 donors, 3 donors were heterozygous. PCR reaction failed for one donor sample due to the insufficient DNA. Neither the patients or donors were homozygous for a null allele CCR5Delta32. The frequency of the CCR5Delta 32 allele between the patient and donor were not significantly different. Download high-res image (38KB) Download full-size image Conclusions The frequencyof CCR5Delta32 in this cohort is about 20%, which is similar to the previous finding. No patients in this cohort are homozygous for the null allele CCR5Delta 2, suggesting the patient cannot develop antibody against CCR5, and AMR in these patients are not caused by CCR5 antibody.