First report of Neofusicoccum parvum causing canker on Castanea sativa in Spain.

In April 2021, depressed bark with dark reddish coloration was observed on the stem of a five-year-old chestnut (Castanea sativa Mill.) plant, acquired from a commercial Galician nursery. One tissue sample was collected from the injury of this plant, surface-sterilized with 96% ethanol for 30 s and dried on sterilized tissue paper, plated on potato dextrose agar (PDA) and incubated at 25oC. Fungal colonies were consistently isolated and after 5 days developed abundant greyish-white aerial mycelium. Two weeks later pycnidia with fusiform conidia were observed. For molecular identification, internal transcribed spacer (ITS1: TCCGTAGGTGAACCTGCGG, ITS4: TCCTCCGCTTAT TGATATGC, White et al. 1990), beta-tubulin (BT2a: GGTAACCAAATCGGT GCTGCTTTC, BT2b: ACCCTCAGTGTAGTGACCCTTGGC, Glass & Donaldson 1995) and elongation factor (EF1-728F: CATCGA GAAGTTCGAGAAGG, EF1-1199R: GGGAAGTACCMGTGATCATGT, Walker et al. 2010) were amplified. BLAST analysis showed that ITS sequence of isolate LPPAF-971 (accession no. MZ314849) showed 99.63% identity with Neofusicoccum parvum isolates ACBA15 (accession no. KX244803) and mywxxq (accession no. MW767713), and 99.4% identity with isolate CMW9081T (accession no. AY230943). Beta-tubulin sequence (accession no. MZ561053) showed 100% identity with isolate GDTCMF1 (accession no. MN022786), and elongation factor sequence (accession no. MZ561054) showed 98.70% identity with isolate F7 (accession no. MN461166), all corresponding with N. parvum. Pathogenicity tests were carried out on ten five-year-old chestnut plants on which a 5mm PDA plug from the edge of an actively growing colony of the fungus was inoculated by a cut in the bark of one to three branches per plant up to a total of 16 inoculated branches and then wrapped with Parafilm©. Five plants inoculated with one plug of PDA without the fungus were used as controls. Plants were placed in a plastic tunnel with a lateral insect net, provided with drip irrigation and grown under natural conditions. Bark cankers symptoms similar to the one observed in the original sample were visible on all inoculated chestnut plants ten days after inoculation. No symptoms were observed on the controls. The assay was conducted twice. Fungal colonies morphologically identified as N. parvum were reisolated from bark cankers on inoculated chestnut plants, fulfilling Koch's postulates. C. sativa is a widely distributed multipurpose tree, with important economic, environmental, cultural, and heritage functions (Bounous & Beccaro 2019), which underlines the importance of this finding with a view on its sanitary control. In addition, N. parvum, teleomorph Botryosphaeria parva (Pennycook & Samuels) Crous, Slippers & Phillips (Crous et al. 2006), is the causal agent of cankers and dieback in many crops and trees (Phillips et al. 2013) worldwide, but until now it had not been detected in C. sativa. To the best of our knowledge, this is the first report worldwide of N. parvum causing disease on chestnut in Spain. References: Bounous G & Beccaro G. 2019. Pp. 1. In: The Chestnut Handbook-Crop & Forest Management. Eds. Beccaro et al. CRC Press, Taylor & Francis Group. Crous PW et al. 2006. Stud. Mycol. 55: 235. doi.org/10.3114/sim.55.1.235 Glass NL & Donaldson GC. 1995. Appl Environ Microbiol 61: 1323. doi: 10.1128/aem.61.4.1323-1330 Phillips AJL et al. 2013. Stud. Mycol. 76: 51. doi:10.3114/sim0021 Walker DM et al. 2010. Mycologia 102: 1479. doi: 10.3852/10-002 White TJ et al. 1990. Pp. 315 In: PCR Protocols: a guide to methods and applications. Academic Press, San Diego, CA.