Thirty Novel Genetic Variations in the SLC29A1 Gene Encoding Human Equilibrative Nucleoside Transporter 1 (hENT1)
2006
Summary: Thirtynine genetic variations, including thirty novel ones, were found in the human SLC29A1 gene, which encodes equilibrative nucleoside transporter 1, from 256 Japanese cancer patients administered gemcitabine. The found novel variations included –8166G > A, –8110A > G, –7947G > A, –7789 T > C, –5595G > A, –3803–3783delTCGGGGAGGTGGCAGTGGGCG, –3548G > C, –3414G > A, –1355 T > C, –34C > G, IVS1 + 141G > A, IVS1 + 260C > T, IVS1– 82C > T, 177C > G, IVS3–6C > T, 564C > T, IVS8 + 44 T > C, IVS8 + 90 T > C, IVS8 + 97 T > C, IVS8 + 131C > T, IVS8 + 169G > A, 933 T > C, 954C > T, IVS11–52G > C, IVS11–46G > A, 1288G > A, 1641C > G, 1703_1704delGT, 1812C > T, and 1861C > T. The frequencies were 0.051 for IVS8 + 169G > A, 0.012 for –7947G > A, 0.006 for IVS1 + 141G > A and 1703_1704delGT, 0.004 for –8166G > A, –8110A > G, –3548G > C, –1355 T > C, –34C > G, IVS8 + 44 T > C, and 1812C > T, and 0.002 for the other 19 variations. Among them, 177C > G and 1288G > A resulted in amino acid substitutions Asp59Glu and Ala430Thr, respectively. Using the detected polymorphisms, linkage disequilibrium analysis was performed, and 28 haplotypes were identified or inferred. Our findings would provide fundamental and useful information for genotyping SLC29A1 in the Japanese and probably other Asian populations.
Keywords:
- Correction
- Source
- Cite
- Save
- Machine Reading By IdeaReader
17
References
32
Citations
NaN
KQI