Using MicroRNA-199B-5P in the medical field and diagnostic

Oligonucleotide having a sequence comprising or consisting of the following sequence: ** ** Formula or comprising or consisting of the corresponding ribonucleotide sequence: ** ** Formula or comprising or consisting of a part of SEQ ID no: 10: CCCAGUGUUUAGACUAUCUGUUC (SEQ ID nO: 11) for use in the treatment and / or prevention of tumors characterized by expression of CD133 gene, chosen in the group consisting medulloblastoma, lymphoma, glioblastoma, colon carcinoma and carcinoma mammary.