Molecular analysis of the dystrophin gene in 407 Chinese patients with Duchenne/Becker muscular dystrophy by the combination of multiplex ligation-dependent probe amplification and Sanger sequencing☆☆☆
2013
Abstract Background Progressive muscular dystrophy is a leading neuromuscular disorder without any effective treatments and a common genetic cause of mortality among teenagers. A challenge exists in the screening of subtle mutations in 79 exons and little is known about the genotype-phenotype correlation. Methods Here we adopted multiplex ligation-dependent probe amplification and Sanger sequencing to detect the dystrophin gene in 407 patients and 76 mothers. Results Sixty-three percent (257/407) of the patients harbored a deletion or duplication mutation, with a de novo mutation frequency of 39.5% in 76 affected patients, and approximately 43.7% of the deletions occurred from exon 45 to 52. To those patients suspected with single exon deletion, combined with Sanger sequencing, five subtle mutations were identified: c.8608C > T, c.2302C > T, c.7148dupT, c.10855C > T and c.2071-2093del AGGGAACAGATCCTGGTAAAGCA; the last three mutations were novel. Furthermore, after genotype–phenotype analysis, the severity of DMD/BMD was associated with the frame shift mutation but not with the deletion, the duplication or the number of deleted exons. Conclusion The majority of patients have a deletion/duplication mutation in the dystrophin gene, with a hot deletion mutation region from exon 45 to 52. Combined with Sanger sequencing, multiplex ligation-dependent probe amplification is capable of detecting part of subtle mutations.
Keywords:
- Correction
- Source
- Cite
- Save
- Machine Reading By IdeaReader
20
References
17
Citations
NaN
KQI