At the FASEB summer research conference on “Arf Family GTPases”, held in Il Ciocco, Italy in June, 2007, it became evident to researchers that our understanding of the family of Arf GTPase activating proteins (ArfGAPs) has grown exponentially in recent years. A common nomenclature for these genes and proteins will facilitate discovery of biological functions and possible connections to pathogenesis. Nearly 100 researchers were contacted to generate a consensus nomenclature for human ArfGAPs. This article describes the resulting consensus nomenclature and provides a brief description of each of the 10 subfamilies of 31 human genes encoding proteins containing the ArfGAP domain.
G protein-coupled receptor kinases (GRK) regulate diverse cellular functions ranging from metabolism to growth and locomotion. Here, we report an important contributory role for GRK5 in human prostate cancer. Inhibition of GRK5 kinase activity attenuated the migration and invasion of prostate cancer cells and, concordantly, increased cell attachment and focal adhesion formation. Mass spectrometric analysis of the phosphoproteome revealed the cytoskeletal-membrane attachment protein moesin as a putative GRK5 substrate. GRK5 regulated the subcellular distribution of moesin and colocalized with moesin at the cell periphery. We identified amino acid T66 of moesin as a principal GRK5 phosphorylation site and showed that enforcing the expression of a T66-mutated moesin reduced cell spreading. In a xenograft model of human prostate cancer, GRK5 silencing reduced tumor growth, invasion, and metastasis. Taken together, our results established GRK5 as a key contributor to the growth and metastasis of prostate cancer.
The selective transfer of material between membrane-delimited organelles is mediated by protein-coated vesicles. In many instances, formation of membrane trafficking intermediates is regulated by the GTP-binding protein Arf. Binding and hydrolysis of GTP by Arf was originally linked to the assembly and disassembly of vesicle coats. Arf GTPase-activating proteins (GAPs), a family of proteins that induce hydrolysis of GTP bound to Arf, were therefore proposed to regulate the disassembly and dissociation of vesicle coats. Following the molecular identification of Arf GAPs, the roles for GAPs and GTP hydrolysis have been directly examined. GAPs have been found to bind cargo and known coat proteins as well as directly contribute to vesicle formation, which is consistent with the idea that GAPs function as subunits of coat proteins rather than simply Arf inactivators. In addition, GTP hydrolysis induced by GAPs occurs largely before vesicle formation and is required for sorting. These results are the primary basis for modifications to the classical model for the function of Arf in transport vesicle formation, including a recent proposal that Arf has a proofreading, rather than a structural, role.
ASAP3, an Arf GTPase-activating protein previously called DDEFL1 and ACAP4, has been implicated in the pathogenesis of hepatocellular carcinoma. We have examined in vitro and in vivo functions of ASAP3 and compared it to the related Arf GAP ASAP1 that has also been implicated in oncogenesis. ASAP3 was biochemically similar to ASAP1: the pleckstrin homology domain affected function of the catalytic domain by more than 100-fold; catalysis was stimulated by phosphatidylinositol 4,5-bisphosphate; and Arf1, Arf5, and Arf6 were used as substrates in vitro. Like ASAP1, ASAP3 associated with focal adhesions and circular dorsal ruffles. Different than ASAP1, ASAP3 did not localize to invadopodia or podosomes. Cells, derived from a mammary carcinoma and from a glioblastoma, with reduced ASAP3 expression had fewer actin stress fiber, reduced levels of phosphomyosin, and migrated more slowly than control cells. Reducing ASAP3 expression also slowed invasion of mammary carcinoma cells. In contrast, reduction of ASAP1 expression had no effect on migration or invasion. We propose that ASAP3 functions nonredundantly with ASAP1 to control cell movement and may have a role in cancer cell invasion. In comparing ASAP1 and ASAP3, we also found that invadopodia are dispensable for the invasive behavior of cells derived from a mammary carcinoma. ASAP3, an Arf GTPase-activating protein previously called DDEFL1 and ACAP4, has been implicated in the pathogenesis of hepatocellular carcinoma. We have examined in vitro and in vivo functions of ASAP3 and compared it to the related Arf GAP ASAP1 that has also been implicated in oncogenesis. ASAP3 was biochemically similar to ASAP1: the pleckstrin homology domain affected function of the catalytic domain by more than 100-fold; catalysis was stimulated by phosphatidylinositol 4,5-bisphosphate; and Arf1, Arf5, and Arf6 were used as substrates in vitro. Like ASAP1, ASAP3 associated with focal adhesions and circular dorsal ruffles. Different than ASAP1, ASAP3 did not localize to invadopodia or podosomes. Cells, derived from a mammary carcinoma and from a glioblastoma, with reduced ASAP3 expression had fewer actin stress fiber, reduced levels of phosphomyosin, and migrated more slowly than control cells. Reducing ASAP3 expression also slowed invasion of mammary carcinoma cells. In contrast, reduction of ASAP1 expression had no effect on migration or invasion. We propose that ASAP3 functions nonredundantly with ASAP1 to control cell movement and may have a role in cancer cell invasion. In comparing ASAP1 and ASAP3, we also found that invadopodia are dispensable for the invasive behavior of cells derived from a mammary carcinoma. Cell migration is important to physiological processes such as development and inflammation and disease processes such as the invasion of normal tissue by cancer cells. Migration requires several temporally and spatially coordinated changes in the cellular membranes and cytoskeleton. Dynamic structures critical to cell movement include actin stress fibers, focal adhesions (FA), 3The abbreviations used are: FA, focal adhesions; LUV, large unilamellar vesicles; DDEFL1, development and differentiation enhancing factor like-1; GST, glutathione S-transferase; CDR, circular dorsal ruffles; GAP, GTPase-activating protein; UPLC1, up-regulated in liver cancer 1; PH, pleckstrin homology; MLC, myosin light chain; siRNA, small interfering RNA; PBS, phosphate-buffered saline; MTT, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide; PI, phosphatidylinositol; PI(4)P, phosphatidylinositol 4-phosphate; PI(4,5)P2, phosphatidylinositol 4,5-bisphosphate; PI(3,4,5)P3, phosphatidylinositol 3,4,5-trisphosphate. circular dorsal ruffles (CDRs), and invadopodia (for reviews, see Refs. 1Brunton V.G. MacPherson I.R.J. Frame M.C. Biochim. Biophys. Acta. 2004; 1692: 121-144Crossref PubMed Scopus (150) Google Scholar, 2Ayala I. Baldassarre M. Caldieri G. Buccione R. Eur. J. Cell Biol. 2006; 85: 159-164Crossref PubMed Scopus (72) Google Scholar, 3Buccione R. Orth J.D. McNiven M.A. Nat. Rev. Mol. Cell Biol. 2004; 5: 647-657Crossref PubMed Scopus (487) Google Scholar, 4Pelligrin S. Mellor H. J. Cell Sci. 2007; 120: 3491-3499Crossref PubMed Scopus (548) Google Scholar, 5Carragher N.O. Frame M.C. Trends Cell Biol. 2004; 14: 241-249Abstract Full Text Full Text PDF PubMed Scopus (300) Google Scholar, 6Webb D.J. Parsons J.T. Horwitz A.F. Nat. Cell Biol. 2002; 4: E97-E100Crossref PubMed Scopus (604) Google Scholar, 7Wehrle-Haller B. Imhof B.A. Trends Cell Biol. 2002; 12: 382-389Abstract Full Text Full Text PDF PubMed Scopus (167) Google Scholar). Arf family GTP-binding proteins and Arf GTPase-activating proteins (GAPs) control these cytoskeletal structures (8Randazzo P.A. Hirsch D.S. Cell. Signal. 2004; 16: 401-413Crossref PubMed Scopus (161) Google Scholar, 9Sabe H. Onodera Y. Mazaki Y. Hashimoto S. Curr. Opin. Cell Biol. 2006; 18: 558-564Crossref PubMed Scopus (54) Google Scholar, 10Randazzo P.A. Inoue H. Bharti S. Biol. Cell. 2007; 99: 583-600Crossref PubMed Scopus (79) Google Scholar). The molecular mechanisms by which Arf and Arf GAP proteins are spatially and temporally controlled and by which they interact with other regulatory elements are being discovered. The Arfs are GTP-binding proteins (11Donaldson J.G. J. Biol. Chem. 2003; 278: 41573-41576Abstract Full Text Full Text PDF PubMed Scopus (378) Google Scholar, 12Donaldson J.G. Honda A. Weigert R. Biochim. Biophys. Acta. 2005; 1744: 364-373Crossref PubMed Scopus (97) Google Scholar, 13Randazzo P.A. Nie Z. Miura K. Hsu V. Sci STKE. 2000; 59: RE1Google Scholar, 14Moss J. Vaughan M. J. Biol. Chem. 1998; 273: 21431-21434Abstract Full Text Full Text PDF PubMed Scopus (299) Google Scholar, 15Logsdon J.M. Kahn R.A. Kahn R.A. Arf family GTPases. Kluwer Academic Publishers, Dordrecht2003: 1-21Google Scholar). Six mammalian Arf proteins have been identified, five in the human genome. These are divided into 3 classes: class 1 includes Arfs 1–3; class 2 includes Arfs 4 and 5; class 3 includes Arf6. Class 1 and 3 Arf proteins have been examined more extensively than class 2 Arfs. Arf1 has been found to affect membrane traffic at the Golgi apparatus and in the endocytic compartment and to recruit paxillin to focal adhesions (12Donaldson J.G. Honda A. Weigert R. Biochim. Biophys. Acta. 2005; 1744: 364-373Crossref PubMed Scopus (97) Google Scholar, 13Randazzo P.A. Nie Z. Miura K. Hsu V. Sci STKE. 2000; 59: RE1Google Scholar). Arf6 has also been found to affect membrane traffic and the actin cytoskeleton including FAs and invadopodia (11Donaldson J.G. J. Biol. Chem. 2003; 278: 41573-41576Abstract Full Text Full Text PDF PubMed Scopus (378) Google Scholar, 16Hashimoto S. Onodera Y. Hashimoto A. Tanaka M. Hamaguchi M. Yamada A. Sabe H. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 6647-6652Crossref PubMed Scopus (216) Google Scholar, 17Sabe H. J. Biochem. (Tokyo). 2003; 134: 485-489Crossref PubMed Scopus (93) Google Scholar, 18Palacios F. Souza-Schorey C. J. Biol. Chem. 2003; 278: 17395-17400Abstract Full Text Full Text PDF PubMed Scopus (83) Google Scholar, 19Yoon H.-Y. Miura K. Cuthbert E.J. Davis K.K. Ahvazi B. Casanova J.E. Randazzo P.A. J. Cell Sci. 2006; 119: 4650-4666Crossref PubMed Scopus (55) Google Scholar). The function of both Arf1 and Arf6 is dependent on the binding and hydrolysis of GTP, which is catalyzed by guanine nucleotide exchange factors and GAPs (8Randazzo P.A. Hirsch D.S. Cell. Signal. 2004; 16: 401-413Crossref PubMed Scopus (161) Google Scholar, 10Randazzo P.A. Inoue H. Bharti S. Biol. Cell. 2007; 99: 583-600Crossref PubMed Scopus (79) Google Scholar, 13Randazzo P.A. Nie Z. Miura K. Hsu V. Sci STKE. 2000; 59: RE1Google Scholar, 20Donaldson J.G. Jackson C.L. Curr. Opin. Cell Biol. 2000; 12: 475-482Crossref PubMed Scopus (319) Google Scholar). The Arf GAPs are a family of multidomain proteins with the common catalytic function of accelerating the hydrolysis of GTP bound to Arf (8Randazzo P.A. Hirsch D.S. Cell. Signal. 2004; 16: 401-413Crossref PubMed Scopus (161) Google Scholar, 10Randazzo P.A. Inoue H. Bharti S. Biol. Cell. 2007; 99: 583-600Crossref PubMed Scopus (79) Google Scholar, 20Donaldson J.G. Jackson C.L. Curr. Opin. Cell Biol. 2000; 12: 475-482Crossref PubMed Scopus (319) Google Scholar, 21Inoue H. Randazzo P.A. Traffic. 2007; 8: 1465-1475Crossref PubMed Scopus (127) Google Scholar, 22Turner C.E. West K.A. Brown M.C. Curr. Opin. Cell Biol. 2001; 13: 593-599Crossref PubMed Scopus (113) Google Scholar), thereby inactivating Arf proteins. The family can be subdivided based on domain structure. The AZAP group has a catalytic core of pleckstrin homology (PH), Arf GAP, and ankyrin repeat domains. Within this group, the ASAPs, ACAPs, AGAPs, and ARAPs have additional domains defining the subtypes. In addition to the PH, Arf GAP, and ankyrin repeat domains, ASAPs contain BAR, proline-rich, and SH3 domains; ACAPs have a BAR domain; AGAPs have a GTP-binding protein-like domain; the ARAPs have sterileα motif, 5 PH, Rho GAP, and Ras-association domains. Most Arf GAPs have been found to regulate cytoskeletal structures including FAs, CDRs, and invadopodia (for reviews see Refs. 8Randazzo P.A. Hirsch D.S. Cell. Signal. 2004; 16: 401-413Crossref PubMed Scopus (161) Google Scholar, 9Sabe H. Onodera Y. Mazaki Y. Hashimoto S. Curr. Opin. Cell Biol. 2006; 18: 558-564Crossref PubMed Scopus (54) Google Scholar, 10Randazzo P.A. Inoue H. Bharti S. Biol. Cell. 2007; 99: 583-600Crossref PubMed Scopus (79) Google Scholar, 19Yoon H.-Y. Miura K. Cuthbert E.J. Davis K.K. Ahvazi B. Casanova J.E. Randazzo P.A. J. Cell Sci. 2006; 119: 4650-4666Crossref PubMed Scopus (55) Google Scholar, and 21Inoue H. Randazzo P.A. Traffic. 2007; 8: 1465-1475Crossref PubMed Scopus (127) Google Scholar, 22Turner C.E. West K.A. Brown M.C. Curr. Opin. Cell Biol. 2001; 13: 593-599Crossref PubMed Scopus (113) Google Scholar, 23de Curtis I. EMBO Rep. 2001; 2: 277-281Crossref PubMed Scopus (75) Google Scholar, 24Turner C.E. Brown M.C. Perrotta J.A. Riedy M.C. Nikolopoulos S.N. McDonald A.R. Bagrodia S. Thomas S. Leventhal P.S. J. Cell Biol. 1999; 145: 851-863Crossref PubMed Scopus (401) Google Scholar, 25Furman C. Short S.M. Subramanian R.R. Zetter B.R. Roberts T.M. J. Biol. Chem. 2002; 277: 7962-7969Abstract Full Text Full Text PDF PubMed Scopus (72) Google Scholar, 26Liu Y.H. Loijens J.C. Martin K.H. Karginov A.V. Parsons J.T. Mol. Biol. Cell. 2002; 13: 2147-2156Crossref PubMed Scopus (128) Google Scholar, 27Oda A. Wada I. Miura K. Okawa K. Kadoya T. Kato T. Nishihara H. Maeda M. Tanaka S. Nagashima K. Nishitani C. Matsuno K. Ishino M. Machesky L.M. Fujita H. Randazzo P. J. Biol. Chem. 2003; 278: 6456-6460Abstract Full Text Full Text PDF PubMed Scopus (39) Google Scholar, 28Randazzo P.A. Andrade J. Miura K. Brown M.T. Long Y.Q. Stauffer S. Roller P. Cooper J.A. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 4011-4016Crossref PubMed Scopus (162) Google Scholar, 29Amerongen G.P.V. Natarajan K. Yin G.Y. Hoefen R.J. Osawa M. Haendeler J. Ridley A.J. Fujiwara K. van Hinsbergh V.W.M. Berk B.C. Circ. Res. 2004; 94: 1041-1049Crossref PubMed Scopus (59) Google Scholar, 30Frank S.R. Adelstein M.R. Hansen S.H. EMBO J. 2006; 25: 1848-1859Crossref PubMed Scopus (56) Google Scholar, 31Manabe R. Kovalenko M. Webb D.J. Horwitz A.R. J. Cell Sci. 2002; 115: 1497-1510Crossref PubMed Google Scholar, 32Zhao Z.S. Manser E. Loo T.H. Lim L. Mol. Cell. Biol. 2000; 20: 6354-6363Crossref PubMed Scopus (315) Google Scholar). At least part of the molecular mechanism by which the different Arf GAPs affect actin involves the catalytic GTPase-activating protein activity. For instance, the Arf6-GAP activity of ARAP2 is required for formation of FAs (19Yoon H.-Y. Miura K. Cuthbert E.J. Davis K.K. Ahvazi B. Casanova J.E. Randazzo P.A. J. Cell Sci. 2006; 119: 4650-4666Crossref PubMed Scopus (55) Google Scholar). However, the multidomain Arf GAPs have additional functions. ASAP1 is an example of an Arf GAP that functions as a GTPase-activating protein and as a scaffold to regulate FAs and invadopodia (9Sabe H. Onodera Y. Mazaki Y. Hashimoto S. Curr. Opin. Cell Biol. 2006; 18: 558-564Crossref PubMed Scopus (54) Google Scholar, 26Liu Y.H. Loijens J.C. Martin K.H. Karginov A.V. Parsons J.T. Mol. Biol. Cell. 2002; 13: 2147-2156Crossref PubMed Scopus (128) Google Scholar, 27Oda A. Wada I. Miura K. Okawa K. Kadoya T. Kato T. Nishihara H. Maeda M. Tanaka S. Nagashima K. Nishitani C. Matsuno K. Ishino M. Machesky L.M. Fujita H. Randazzo P. J. Biol. Chem. 2003; 278: 6456-6460Abstract Full Text Full Text PDF PubMed Scopus (39) Google Scholar, 33Liu Y. Yerushalmi G.M. Grigera P.R. Parsons J.T. J. Biol. Chem. 2005; 280: 8884-8892Abstract Full Text Full Text PDF PubMed Scopus (56) Google Scholar, 34Onodera Y. Hashimoto S. Hashimoto A. Morishige M. Yamada A. Ogawa E. Adachi M. Sakurai T. Manabe T. Wada H. Matsuura N. Sabe H. EMBO J. 2005; 24: 963-973Crossref PubMed Scopus (134) Google Scholar). ASAP proteins are a subtype of Arf GAPs that have been implicated in oncogenesis. Three ASAP-type proteins have been identified so far. ASAP1 and ASAP2, but not ASAP3, contain an SH3 domain at the extreme C terminus (35Brown M.T. Andrade J. Radhakrishna H. Donaldson J.G. Cooper J.A. Randazzo P.A. Mol. Cell. Biol. 1998; 18: 7038-7051Crossref PubMed Scopus (193) Google Scholar, 36Andreev J. Simon J.P. Sabatini D.D. Kam J. Plowman G. Randazzo P.A. Schlessinger J. Mol. Cell. Biol. 1999; 19: 2338-2350Crossref PubMed Scopus (146) Google Scholar). The gene for ASAP1 is amplified in uveal melanoma and expression levels of ASAP1 have been found to correlate with invasive potential in uveal melanoma and mammary carcinoma (34Onodera Y. Hashimoto S. Hashimoto A. Morishige M. Yamada A. Ogawa E. Adachi M. Sakurai T. Manabe T. Wada H. Matsuura N. Sabe H. EMBO J. 2005; 24: 963-973Crossref PubMed Scopus (134) Google Scholar, 37Ehlers J.P. Worley L. Onken M.D. Harbour J.W. Clin. Cancer Res. 2005; 11: 3609-3613Crossref PubMed Scopus (110) Google Scholar). In addition, ASAP1 associates with and regulates FAs, CDRs, and invadopodia/podosomes (26Liu Y.H. Loijens J.C. Martin K.H. Karginov A.V. Parsons J.T. Mol. Biol. Cell. 2002; 13: 2147-2156Crossref PubMed Scopus (128) Google Scholar, 27Oda A. Wada I. Miura K. Okawa K. Kadoya T. Kato T. Nishihara H. Maeda M. Tanaka S. Nagashima K. Nishitani C. Matsuno K. Ishino M. Machesky L.M. Fujita H. Randazzo P. J. Biol. Chem. 2003; 278: 6456-6460Abstract Full Text Full Text PDF PubMed Scopus (39) Google Scholar, 28Randazzo P.A. Andrade J. Miura K. Brown M.T. Long Y.Q. Stauffer S. Roller P. Cooper J.A. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 4011-4016Crossref PubMed Scopus (162) Google Scholar, 34Onodera Y. Hashimoto S. Hashimoto A. Morishige M. Yamada A. Ogawa E. Adachi M. Sakurai T. Manabe T. Wada H. Matsuura N. Sabe H. EMBO J. 2005; 24: 963-973Crossref PubMed Scopus (134) Google Scholar, 38Bharti S. Inoue H. Bharti K. Hirsch D.S. Nie Z. Yoon H.Y. Artym V. Yamada K.M. Mueller S.C. Barr V.A. Randazzo P.A. Mol. Cell. Biol. 2007; 27: 8271-8283Crossref PubMed Scopus (79) Google Scholar), structures involved in cell migration and invasion (2Ayala I. Baldassarre M. Caldieri G. Buccione R. Eur. J. Cell Biol. 2006; 85: 159-164Crossref PubMed Scopus (72) Google Scholar, 3Buccione R. Orth J.D. McNiven M.A. Nat. Rev. Mol. Cell Biol. 2004; 5: 647-657Crossref PubMed Scopus (487) Google Scholar, 39Linder S. Aepfelbacher M. Trends Cell Biol. 2003; 13: 376-385Abstract Full Text Full Text PDF PubMed Scopus (512) Google Scholar, 40Spinardi L. Marchisio P.C. Eur. J. Cell Biol. 2006; 85: 191-194Crossref PubMed Scopus (62) Google Scholar, 41Yamaguchi H. Pixley F. Condeelis J. Eur. J. Cell Biol. 2006; 85: 213-218Crossref PubMed Scopus (129) Google Scholar). Reducing ASAP1 expression has been reported to slow cell migration in some studies (25Furman C. Short S.M. Subramanian R.R. Zetter B.R. Roberts T.M. J. Biol. Chem. 2002; 277: 7962-7969Abstract Full Text Full Text PDF PubMed Scopus (72) Google Scholar, 34Onodera Y. Hashimoto S. Hashimoto A. Morishige M. Yamada A. Ogawa E. Adachi M. Sakurai T. Manabe T. Wada H. Matsuura N. Sabe H. EMBO J. 2005; 24: 963-973Crossref PubMed Scopus (134) Google Scholar), accelerate cell migration in others (26Liu Y.H. Loijens J.C. Martin K.H. Karginov A.V. Parsons J.T. Mol. Biol. Cell. 2002; 13: 2147-2156Crossref PubMed Scopus (128) Google Scholar, 33Liu Y. Yerushalmi G.M. Grigera P.R. Parsons J.T. J. Biol. Chem. 2005; 280: 8884-8892Abstract Full Text Full Text PDF PubMed Scopus (56) Google Scholar), and decrease cell invasion (34Onodera Y. Hashimoto S. Hashimoto A. Morishige M. Yamada A. Ogawa E. Adachi M. Sakurai T. Manabe T. Wada H. Matsuura N. Sabe H. EMBO J. 2005; 24: 963-973Crossref PubMed Scopus (134) Google Scholar). ASAP3, previously called up-regulated in liver cancer 1 (UPLC1), DDEFL1 and ACAP4 (42Fang Z.Y. Miao Y. Ding X. Deng H. Liu S.Q. Wang F.S. Zhou R.H. Watson C. Fu C.H. Hu Q.C. Lillard J.W. Powell M. Chen Y. Forte J.G. Yao X.B. Mol. Cell. Proteomics. 2006; 5: 1437-1449Abstract Full Text Full Text PDF PubMed Scopus (39) Google Scholar, 43Okabe H. Furukawa Y. Kato T. Hasegawa S. Yamaoka Y. Nakamura Y. Int. J. Oncol. 2004; 24: 43-48PubMed Google Scholar), was identified in analyses of expression profiles of clinical hepatocellular carcinomas using cDNA microarray. The relative expression of ASAP3 was high in hepatocellular carcinoma (43Okabe H. Furukawa Y. Kato T. Hasegawa S. Yamaoka Y. Nakamura Y. Int. J. Oncol. 2004; 24: 43-48PubMed Google Scholar). The expression level of ASAP3 correlated with cell proliferation and migration (42Fang Z.Y. Miao Y. Ding X. Deng H. Liu S.Q. Wang F.S. Zhou R.H. Watson C. Fu C.H. Hu Q.C. Lillard J.W. Powell M. Chen Y. Forte J.G. Yao X.B. Mol. Cell. Proteomics. 2006; 5: 1437-1449Abstract Full Text Full Text PDF PubMed Scopus (39) Google Scholar). However, the localization of endogenous protein and the precise site of action have not been examined. Here we characterize ASAP3 and test the hypothesis that ASAP3 and ASAP1, with highly similar structures, have redundant cellular functions in controlling cell migration and invasion. Biochemically, ASAP3 is similar to ASAP1; however, examination of the cellular function of ASAP3 revealed differences from ASAP1. First, ASAP3 localized in FAs and CDRs but, different from ASAP1, ASAP3 was not found in invadopodia or podosomes, structures reported to mediate invasion of cancer cells. Second, reduction of ASAP3 expression did not prevent the formation of invadopodia or podosomes; in contrast, reduction of ASAP1 blocked the formation of invadopodia and podosomes (34Onodera Y. Hashimoto S. Hashimoto A. Morishige M. Yamada A. Ogawa E. Adachi M. Sakurai T. Manabe T. Wada H. Matsuura N. Sabe H. EMBO J. 2005; 24: 963-973Crossref PubMed Scopus (134) Google Scholar, 38Bharti S. Inoue H. Bharti K. Hirsch D.S. Nie Z. Yoon H.Y. Artym V. Yamada K.M. Mueller S.C. Barr V.A. Randazzo P.A. Mol. Cell. Biol. 2007; 27: 8271-8283Crossref PubMed Scopus (79) Google Scholar). Decreasing the expression level of ASAP3 reduced actin stress fibers. Third, reduction of ASAP3 expression levels slowed cell migration and invasion, whereas reduction of ASAP1 expression did not affect these activities. Based on our results, we conclude that ASAP3 and ASAP1 do not function redundantly but have distinct functions. At least for the mammary carcinoma cell line we examined, ASAP3 contributes to invasion but ASAP1 does not. Given the critical role of ASAP1 for invadopodia formation (38Bharti S. Inoue H. Bharti K. Hirsch D.S. Nie Z. Yoon H.Y. Artym V. Yamada K.M. Mueller S.C. Barr V.A. Randazzo P.A. Mol. Cell. Biol. 2007; 27: 8271-8283Crossref PubMed Scopus (79) Google Scholar), these results also support the conclusion that invadopodia are dispensable for invasion. Plasmids—Epitope-tagged (FLAG tag, hemagglutinin tag) of full-length ASAP3 (accession number NM_017707) and the GAP-deficient mutant ([R469K]ASAP3 and [R469A]ASAP3) were constructed in the mammalian expression vector pCI (Promega) with standard molecular biology procedures. Antibodies—Rabbit antiserum against human ASAP3 was raised using a synthetic peptide WVISTEPGSDSEEDEEEKRC, residues 692–711 of ASAP3, conjugated to maleimide-activated keyhole limpet hemocyanin (Pierce) as an immunogen. Immunization was performed at BioWorld (Dublin, OH). The antiserum (Bio228) was affinity purified using an EZ-link kit from Pierce and used for this article (see supplemental materials and Fig. S1 for characterization). The other antibodies used in this study were as follows: mouse monoclonal anti-FLAG antibody M5 (Sigma; 1:1,000), rabbit anti-phosphomyosin light chain 2 (Ser19), phospho-MLC2, (Cell Signaling, 1:1000), rabbit anti-myosin light chain 2 (MLC2) (Cell Signaling, 1:1000), rabbit polyclonal anti-hemagglutinin (Covance, 1:1,000), goat anti-rabbit IgG antibody conjugated with horseradish peroxidase (Bio-Rad, 1:3,000), goat anti-mouse IgG antibody conjugated with horseradish peroxidase (Bio-Rad, 1:3,000), Texas Red-conjugated goat anti-mouse IgG (Jackson ImmunoResearch, 1:200), fluorescein isothiocyanate-conjugated goat anti-rabbit IgG (Jackson ImmunoResearch, 1:200). siRNA Preparation and Transfection—For RNA interference assays, 19-nucleotide small interfering RNA duplexes (siRNAs) with 3′-UU overhangs specific for the 3′-untranslated region (5′-3′) and the open reading frame ("Smart pool," combination of 4 siRNA duplexes) for human ASAP3/DDEFL1 (GenBank™ accession number NM_017707) were synthesized by Dharmacon (Chicago, IL). The sequences were as follows: siRNA-1 sense, UCAGAUACCACACGAGUAAUU; siRNA-1 anti, UUACUCGUGUGGUAUCUGAUU; siRNA-2 sense, UAUAUGACCAUUACAGUUGUU; siRNA-2 anti, CAACUGUAAUGGUCAUAUAUU; siRNA-3 sense, GAAAGAAGGGAGAGUAAUAUU; siRNA-3 anti, UAUUACUCUCCCUUCUUUCUU; siRNA-4 sense, UCACUAAAUUCCAACUCUAUU; and siRNA-4 anti, UAGAGUUGGAAUUUAGUGAUU. The siRNA duplexes used to target human ASAP1 (GenBank accession number NM_081482) specific for the open reading frame were synthesized by Invitrogen. The sequences were as follows: HSS147202, 5′-CCCAAAUUGGAGAUUUGCCGCCUAA-3′; HSS147203, 5′-GACCAGAUCUCUGUCUCGGAGUUCA-3′; and HSS147204, 5′-GGGCAAUAAGGAAUAUGGCAGUGAA-3′. The pool and individual siRNAs suppressed the expression of endogenous ASAP1 or ASAP3 efficiently (<80% knockdown assessed by Western blot analysis). Silencer negative control number 2 siRNA (catalog D-001810-02-20) was purchased from Dharmacon. Cells were transfected with 100 nm siRNA using Lipofectamine 2000 (Invitrogen) transfection reagent according to the manufacturer'ns recommendations. The cells were harvested 48–96 h later and analyzed by Western blots and immunofluorescence. Cell Culture and Cell Transfection—Human cell lines HepG2, U118, and MDA-MB-231 and mouse NIH 3T3 fibroblasts were maintained in Dulbecco'ns modified Eagle'ns medium supplemented with 10% heat-inactivated fetal bovine serum at 37 °C in a 5% CO2 atmosphere at constant humidity. Protein Expression and Purification from Bacteria—To express different constructs of ASAP3, reading frames for proteins of residues 287–693 (PZA), 1–693 (BAR-PZA), 417–903 (ZA-proline rich), 293–903 (ΔBAR ASAP3), and 1–903 (full-length ASAP3) of ASAP3 were ligated into the NdeI/XhoI sites of pET19b (Novagen), which contains a His10 fusion at the N terminus to express histidine-tagged proteins. Recombinant proteins were expressed in and purified from Escherichia coli over a HiTrap Q anion-exchange column (GE Healthcare) followed by a nickel affinity column (GE Healthcare) using gradients of NaCl and imidazole. Experiments were performed with the histidine-tagged proteins. Non-myristoylated Arfs were prepared as described (44Randazzo P.A. Weiss O. Kahn R.A. Methods Enzymol. 1992; 219: 362-369Crossref PubMed Scopus (52) Google Scholar). Immunofluorescence—Cultured cells were seeded on fibronectin-coated coverslips for at least 4 h and fixed in 2% formaldehyde in phosphate-buffered saline (PBS) for 10 min at room temperature, washed three times with phosphate-buffered saline (PBS), and once in 10% fetal bovine serum and 0.04% sodium azide in PBS. Cells were then permeabilized in buffer A (10% fetal bovine serum, 0.04% sodium azide, and 0.2% saponin in PBS) for 10 min at room temperature. Cells were incubated with primary antibodies at 1:100 dilution in buffer A for 1 h at room temperature followed by incubation with appropriate secondary antibodies conjugated with fluorescein isothiocyanate (Jackson ImmunoResearch) for 1 h at room temperature. For visualization of actin filaments, rhodamine-conjugated phalloidin (Molecular Probes) was added during the incubation with secondary antibodies. Coverslips were then washed and mounted on glass slides with Gel Mount (Biomeda). Cells were visualized and images captured by confocal microscopy using a Zeiss LSM 510 attached to a Zeiss Axiovert 100M with a 63 × 1.4 NA plan Neofluar oil immersion lens. Adobe Illustrator was used to prepare the images for publication. Western Blot Analysis—Cell lysates containing equivalents of total protein were resolved on a 10% SDS-polyacrylamide gel, followed by transfer to nitrocellulose membranes (Bio-Rad). Membranes were incubated in 4% nonfat dry milk for 1 h at room temperature, washed with PBS containing 0.1% Tween 20, followed by incubation with the primary antibody (as specified) for 1 h at room temperature or overnight at 4 °C. Membranes were then washed and incubated in the appropriate secondary antibody for 1 h at room temperature, and the immunocomplexes were visualized using ECL Plus Western blotting Detection System (Amersham Biosciences). Cell Proliferation Assay—Cells treated with siRNA targeting ASAP3 or cells stably expressing ASAP3 or [R469K]ASAP3 were plated at a density of 20,000 cells per well in 12-well plates in 1 ml of culture medium containing 10% fetal bovine serum. Proliferation was monitored by counting cells each day using a hemocytometer. The experiments were repeated twice in triplicates each. MTT Assay—Cells previously treated with the indicated siRNA were plated at a density of 3,000 cells per well in 96-well plates (200 μl/well) and incubated at 37 °C. MTT assay was performed every 24 h by adding 20 μl of MTT (5 mg/ml) 4 h before cell harvesting. The resulting MTT purple formazan crystals in each well were solubilized by addition of 100 μl of DMSO and absorbance was measured spectrophotometrically at a wavelength of 650 nm. Wound Healing Assay—Monolayers of confluent cells were scratched with a sterile pipette tip and phase-contrast images of cells were taken either immediately after wounding or after 24 or 48 h. Repair of the artificial "wound" (% healing) was quantified as follows: healing (%) = ((1 – (width of wound at 0 h/width of wound at 24 or 48 h)) × 100. Transwell Migration and Invasion Assay—Migration and invasion assays were carried out with cell culture inserts (8-μm pore size; BD Biosciences). For invasion assays, cell culture inserts were coated with 10 μg of Matrigel (BD Biosciences). The Matrigel was diluted in cold serum-free medium and added to the chambers and dried in a sterile hood for 4–5 h. The Matrigel was then reconstituted with serum-free medium for 1 h at 37°C before the addition of cells. Cells were harvested by trypsinization, resuspended in Opti-MEM and 1 × 104 cells were added to the upper chambers, and the chambers were placed in 24-well dishes. The lower compartment of the wells were filled with Dulbecco'ns modified Eagle'ns medium containing 10% fetal bovine serum used as chemoattractant. Migration assays were carried out for 12 h and invasion assays for 24 h. Cells were scraped off the top side of the polyethylene membrane with a cotton swab. Cells that invaded into the Matrigel and migrated out onto the lower surface of the membrane were stained in 0.2% crystal violet. Images of the cells that invaded the lower surface of the filter were taken with the ×2.5 objective of an inverted microscope (Nikon Eclipse E800) coupled to a digital camera (Hamamatsu C4742-95). Data were collected from at least three independent experiments each carried out in triplicate. Data are presented as percentages calculated by normalizing the values obtained for the cells treated with a negative control siRNA as 100%. Site-directed Mutagenesis—Mutations were performed using the QuikChange kit (Stratagene) following the manufacturer'ns instructions and confirmed by DNA sequencing. Mutant proteins were purified as described above. Arf GAP Assay—Arf GAP activity was determined using an in vitro assay that measures a single round of GTP hydrolysis on recombinant Arf (45Randazzo P.A. Kahn R.A. J. Biol. Chem. 1994; 269: 10758-10763Abstract Full Text PDF PubMed Google Scholar, 46Luo R. Ahvazi B. Amariei D. Shroder D. Burrola B. Losert W. Randazzo P.A. Biochem. J. 2007; 402: 439-447Crossref PubMed Scopus (31) Google Scholar). Briefly, recombinant Arf proteins were preloaded with [α-32P]GTP for 30 min at 37 °C. Purified ASAP3 proteins were added to GTP-loaded Arfs in the presence of large unilamellar vesicles (LUVs). Reactions were terminated after 3 min by adding ice-cold buffer. Protein-bound nucleotide was trapped on nitrocellulose filters, released into formic acid, fractionated by chromatography on polyethyleneimide cellulose plates, and quantified using a Phosphor-Imager (GE Healthcare). All experiments were performed at least three times with similar results. Preparation of Large Unilamellar Vesicles—Synthetic LUVs consisting of 40% phosphatidylcholine, 25% phosphatidylethanolamine, 15% phosphatidylserine, 9.5% phosphatidylinositol (PI), 0.5% phosphatidylinositol 4,5-bisphosphate (PI(4,5)P2), and 10% cholesterol from liver or brain total lipid extracts (Avanti Polar Lipids) were obtained as follows. Lipids were dried under N2 for >1 h and resuspended in phosphate-buffered saline for Arf GA
We have shown previously that nerve growth factor (NGF) down-regulates adenosine A2A receptor (A2AAR) mRNA in PC12 cells. To define cellular mechanisms that modulate A2AAR expression, A2AAR mRNA and protein levels were examined in three PC12 sublines: i) PC12nnr5 cells, which lack the high affinity NGF receptor TrkA, ii) srcDN2 cells, which overexpress kinase-defective Src, and iii) 17.26 cells, which overexpress a dominant-inhibitory Ras. In the absence of functional TrkA, Src, or Ras, NGF-induced down-regulation of A2AAR mRNA and protein was significantly impaired. However, regulation of A2AAR expression was reconstituted in PC12nnr5 cells stably transfected with TrkA. Whereas NGF stimulated the mitogen-activated protein kinases p38, extracellular regulated kinase 1 and 2 (ERK1/ERK2), and stress-activated protein kinase/c-Jun NH2-terminal kinase (SAPK/JNK) in PC12 cells, these kinases were activated only partially or not at all in srcDN2 and 17.26 cells. Inhibiting ERK1/ERK2 with PD98059 or inhibiting SAPK/JNK by transfecting cells with a dominant-negative SAPKβ/JNK3 mutant partially blocked NGF-induced down-regulation of A2AAR expression in PC12 cells. In contrast, inhibiting p38 with SB203580 had no effect on the regulation of A2AAR mRNA and protein levels. Treating SAPKβ/JNK3 mutant-transfected PC12 cells with PD98059 completely abolished the NGF-induced decrease in A2AAR mRNA and protein levels. These results reveal a role for ERK1/ERK2 and SAPK/JNK in regulating A2AAR expression.
ADVERTISEMENT RETURN TO ISSUEPREVArticleNEXTPurification and characterization of a .gamma.-like DNA polymerase from Chlamydomonas reinhardtiiZ. F. Wang, Junming Yang, Z. Q. Nie, and Madeline WuCite this: Biochemistry 1991, 30, 4, 1127–1131Publication Date (Print):January 1, 1991Publication History Published online1 May 2002Published inissue 1 January 1991https://pubs.acs.org/doi/10.1021/bi00218a034https://doi.org/10.1021/bi00218a034research-articleACS PublicationsRequest reuse permissionsArticle Views47Altmetric-Citations17LEARN ABOUT THESE METRICSArticle Views are the COUNTER-compliant sum of full text article downloads since November 2008 (both PDF and HTML) across all institutions and individuals. These metrics are regularly updated to reflect usage leading up to the last few days.Citations are the number of other articles citing this article, calculated by Crossref and updated daily. Find more information about Crossref citation counts.The Altmetric Attention Score is a quantitative measure of the attention that a research article has received online. Clicking on the donut icon will load a page at altmetric.com with additional details about the score and the social media presence for the given article. Find more information on the Altmetric Attention Score and how the score is calculated. Share Add toView InAdd Full Text with ReferenceAdd Description ExportRISCitationCitation and abstractCitation and referencesMore Options Share onFacebookTwitterWechatLinked InRedditEmail Other access optionsGet e-Alertsclose Get e-Alerts
A summary is not available for this content so a preview has been provided. Please use the Get access link above for information on how to access this content.
