Using the "tagged" rRNA gene system, which allows in vivo mutational analysis of Saccharomyces cerevisiae rRNA, we studied the role of two distinct structural elements of 26S rRNA in ribosome biogenesis and function--namely, the evolutionarily highly conserved "GTPase center" located in domain II and the eukaroyote-specific variable region V9 in domain III. Replacement of the S. cerevisiae GTPase center with its counterpart from Escherichia coli did not affect the assembly of the mutant 26S rRNA into functional (as judged by their polysomal distribution) 60S subunits, indicating that the E. coli GTPase center functions efficiently in the context of the heterologous rRNA. Removal of most of the S. cerevisiae V9 region or replacement of this segment by the equivalent segment from mouse 28S rRNA also did not affect the formation of functional 60S subunits carrying the mutant 26S rRNA. Therefore, the V9 region does not seem to play a role in the biological functioning of the yeast 60S subunits, and these subunits appear to be able to accommodate V9 regions of various size and secondary structure without apparent loss of function.
Treatment of yeast 60S ribosomal subunits with 0.5 M LiCl was found to remove all but six of the ribosomal proteins. The proteins remaining associated with the (26S + 5.8S) rRNA complex were identified as L4, L8, L10, L12, L16 and L25. These core proteins were split off sequentially in the order (L16 + L12), L10, (L4 + L8), L25 by further increasing the LiCl concentration. At 1.0 M LiCl only ribosomal protein L25 remains bound to the rRNA. Upon lowering the LiCl concentration the core proteins reassociate with the rRNA in the reverse order of their removal. The susceptibility of the ribosomal proteins to removal by LiCl corresponds quite well with their order of assembly into the 60S subunit in vivo as determined earlier [Kruiswijk et al. (1978) Biochim. Biophys. Acta 517 , 378–389]. Binding studies in vitro using partially purified L25 showed that this protein binds specifically to 26S rRNA. Therefore our experiments for the first time directly identify a eukaryotic ribosomal protein capable of binding to high‐molecular‐mass rRNA. Binding studies in vitro using a blot technique demonstrated that core proteins L8 and LI6 as well as protein L21, though not present in any of the core particles, are also capable of binding to 26S rRNA to approximately the same extent as L25. About nine additional 60S proteins appeared to interact with the 26S rRNA, though to a lesser extent.
Saccharomyces cerevisiae Rio2p (encoded by open reading frame Ynl207w) is an essential protein of unknown function that displays significant sequence similarity to Rio1p/Rrp10p. The latter was recently shown to be an evolutionarily conserved, predominantly cytoplasmic serine/threonine kinase whose presence is required for the final cleavage at site D that converts 20 S pre-rRNA into mature 18 S rRNA. A data base search identified homologs of Rio2p in a wide variety of eukaryotes and Archaea. Detailed sequence comparison and in vitro kinase assays using recombinant protein demonstrated that Rio2p defines a subfamily of protein kinases related to, but both structurally and functionally distinct from, the one defined by Rio1p. Failure to deplete Rio2p in cells containing a GAL-rio2 gene and direct analysis of Rio2p levels by Western blotting indicated the protein to be low abundant. Using a GAL-rio2 gene carrying a point mutation that reduces the kinase activity, we found that depletion of this mutant protein blocked production of 18 S rRNA due to inhibition of the cleavage of cytoplasmic 20 S pre-rRNA at site D. Production of the large subunit rRNAs was not affected. Thus, Rio2p is the second protein kinase that is essential for cleavage at site D and the first in which the processing defect can be linked to its enzymatic activity. Contrary to Rio1p/Rrp10p, however, Rio2p appears to be localized predominantly in the nucleus. Saccharomyces cerevisiae Rio2p (encoded by open reading frame Ynl207w) is an essential protein of unknown function that displays significant sequence similarity to Rio1p/Rrp10p. The latter was recently shown to be an evolutionarily conserved, predominantly cytoplasmic serine/threonine kinase whose presence is required for the final cleavage at site D that converts 20 S pre-rRNA into mature 18 S rRNA. A data base search identified homologs of Rio2p in a wide variety of eukaryotes and Archaea. Detailed sequence comparison and in vitro kinase assays using recombinant protein demonstrated that Rio2p defines a subfamily of protein kinases related to, but both structurally and functionally distinct from, the one defined by Rio1p. Failure to deplete Rio2p in cells containing a GAL-rio2 gene and direct analysis of Rio2p levels by Western blotting indicated the protein to be low abundant. Using a GAL-rio2 gene carrying a point mutation that reduces the kinase activity, we found that depletion of this mutant protein blocked production of 18 S rRNA due to inhibition of the cleavage of cytoplasmic 20 S pre-rRNA at site D. Production of the large subunit rRNAs was not affected. Thus, Rio2p is the second protein kinase that is essential for cleavage at site D and the first in which the processing defect can be linked to its enzymatic activity. Contrary to Rio1p/Rrp10p, however, Rio2p appears to be localized predominantly in the nucleus. Like their counterparts in other eukaryotes, Saccharomyces cerevisiae ribosomes contain four species of rRNA: 5 S, 5.8 S, 18 S, and 25 S rRNAs. The genes encoding these rRNAs are organized on the yeast genome in 150–200 tandem repeats, each of which comprises two transcriptional units separated by non-transcribed spacers. One of these units consists of a 5 S rRNA gene, transcribed by RNA polymerase III. The other unit contains single genes for each of the mature 18 S, 5.8 S, and 25 S rRNAs that are separated by internal transcribed spacers 1 and 2, whereas external transcribed spacer regions are present at either end of the unit (see Fig. 1A). After transcription of this polycistronic unit by RNA polymerase I, the spacers are removed from the primary transcript via an ordered series of endo- and exonucleolytic cleavages (see Fig. 1B) (reviewed in Refs. 1Raué H.A. Olson M. The Nucleolus. Landes Bioscience, Georgetown, Washington, D. C.2003Google Scholar and 2Venema J. Tollervey D. Annu Rev. Genet. 1999; 33: 216-311Crossref Scopus (655) Google Scholar). The first detectable precursor species is 35 S pre-rRNA, which results from a cleavage at site B0 in the 3′-external transcribed spacer by the yeast RNase III homolog Rnt1p (3Abou-Elela S. Igel H. Ares Jr., M. Cell. 1996; 85: 115-124Abstract Full Text Full Text PDF PubMed Scopus (192) Google Scholar, 4Kufel J. Dichtl B. Tollervey D. RNA (N. Y.). 1999; 5: 909-917Crossref PubMed Scopus (125) Google Scholar). Subsequent cleavage at sites A0 and A1 in the 5′-external transcribed spacer first gives rise to 33 S and then 32 S pre-rRNA. The latter is cleaved at site A2 to produce separate 20 S and 27 S A2 precursors for the small and large ribosomal subunit, respectively. The majority (90%) of the 27 S A2 precursor molecules are cleaved endonucleolytically at site A3, followed by exonucleolytic trimming to B1S. The remainder are processed endonucleolytically 1A. W. Faber, J. C. Vos, and H. A. Raué, unpublished data. at site B1L. The resulting 27 S BS and 27 S BL precursors, whose 5′-ends are located 6 nucleotides apart, are then converted into 25 S rRNA and the "short" and "long" forms of 5.8 S rRNA, respectively, in the same manner (5Allmang C. Kufel J. Chanfreau G. Mitchell P. Petfalski E. Tollervey D. EMBO J. 1999; 18: 5399-5410Crossref PubMed Scopus (492) Google Scholar, 6Faber A.W. van Dijk M. Raué H.A. Vos J.C. RNA (N. Y.). 2002; 8: 1095-1101Crossref PubMed Scopus (44) Google Scholar, 7Mitchell P. Petfalski E. Tollervey D. Genes Dev. 1996; 10: 502-513Crossref PubMed Scopus (166) Google Scholar, 8Geerlings T. Vos J.C. Raué H.A. RNA (N. Y.). 2000; 6: 1698-1703Crossref PubMed Scopus (99) Google Scholar, 9Van Hoof A. Lennertz P. Parker R. EMBO J. 2000; 19: 1357-1365Crossref PubMed Scopus (146) Google Scholar). All of the above processing steps, as well as the concomitant assembly of most of the ribosomal proteins, take place in the nucleolus/nucleoplasm. However, the final step in 40 S subunit biogenesis in yeast occurs after export of the pre-40 S ribosomal subunit to the cytoplasm, where its 20 S pre-rRNA is processed at site D to produce the mature 18 S rRNA (10Moy T.I. Silver P.A. Genes Dev. 1999; 13: 2118-2133Crossref PubMed Scopus (147) Google Scholar, 11Vanrobays E. Gleizes P.-E. Bousquet-Antonelli C. Noaillac-Depeyre J. Caizergues-Ferrer M. Gélugne J.-P. EMBO J. 2001; 20: 4204-4213Crossref PubMed Scopus (100) Google Scholar). Pre-rRNA processing in other eukaryotic cells follows a similar pathway, except that maturation of 18 S rRNA is completed in the nucleus rather than the cytoplasm. Although the pre-rRNA processing pathway itself is now well understood, many questions pertaining to its control and its integration with the assembly of the ribosomal proteins remain to be answered. Presently, >100 non-ribosomal proteins or trans-acting factors have been identified that are essential for ribosome biogenesis in S. cerevisiae (1Raué H.A. Olson M. The Nucleolus. Landes Bioscience, Georgetown, Washington, D. C.2003Google Scholar, 12Fatica A. Tollervey D. Curr. Opin. Cell Biol. 2002; 14: 313-318Crossref PubMed Scopus (428) Google Scholar, 13Kressler D. Linder P. De La Cruz J. Mol. Cell. Biol. 1999; 19: 7897-7912Crossref PubMed Scopus (309) Google Scholar). Recent advances in the purification and characterization of large (ribonucleo)-protein complexes have pushed the number of potential trans-acting factors even higher. Moreover, it has become clear that these factors form two largely independent, dynamic processing/assembly machineries for the small and large subunits, respectively (12Fatica A. Tollervey D. Curr. Opin. Cell Biol. 2002; 14: 313-318Crossref PubMed Scopus (428) Google Scholar, 14Dragon F. Gallagher J.E.G. Compagnone-Post P.A. Mitchell B.A. Porwancher K.A. Wehner K.A. Wormsley S. Settlage R.E. Shabanowitz J. Osheim Y. Beyer A.L. Hunt D.F. Baserga S.J. Nature. 2002; 417: 967-970Crossref PubMed Scopus (562) Google Scholar, 15Grandi P. Rybin V. Baβler J. Petfalski E. Strauss D. Marzioch M. Schäfer T. Kuster B. Tschochner H. Tollervey D. Gavin A.-C. Hurt E. Mol. Cell. 2002; 10: 105-115Abstract Full Text Full Text PDF PubMed Scopus (389) Google Scholar, 16Harnpicharnchai P. Jakovljevic J. Horsey E. Miles T. Roman J. Rout M. Meagher D. Imai B. Guo Y. Brame C.J. Shabanowitz J. Hunt D.F. Woolford Jr., J.L. Mol. Cell. 2001; 8: 505-515Abstract Full Text Full Text PDF PubMed Scopus (256) Google Scholar, 17Nissan T.A. Baβler J. Petfalski E. Tollervey D. Hurt E. EMBO J. 2002; 21: 5539-5547Crossref PubMed Scopus (292) Google Scholar). Very little is known as yet about the exact function of any of the parts of these machineries or the manner in which they cooperate. Virtually all of the trans-acting factors presently known to be involved in biogenesis of the yeast 40 S subunit are required for the formation of 20 S pre-rRNA by the early processing cleavages at sites A0, A1, and A2. These factors assemble cotranscriptionally on the pre-rRNA in the nucleolus, together with some of the ribosomal proteins, to form the 80–90 S small subunit pre-ribosome and, at least for the most part, appear to dissociate prior to export of the pre-40 S particle to the cytoplasm (1Raué H.A. Olson M. The Nucleolus. Landes Bioscience, Georgetown, Washington, D. C.2003Google Scholar, 12Fatica A. Tollervey D. Curr. Opin. Cell Biol. 2002; 14: 313-318Crossref PubMed Scopus (428) Google Scholar, 14Dragon F. Gallagher J.E.G. Compagnone-Post P.A. Mitchell B.A. Porwancher K.A. Wehner K.A. Wormsley S. Settlage R.E. Shabanowitz J. Osheim Y. Beyer A.L. Hunt D.F. Baserga S.J. Nature. 2002; 417: 967-970Crossref PubMed Scopus (562) Google Scholar, 15Grandi P. Rybin V. Baβler J. Petfalski E. Strauss D. Marzioch M. Schäfer T. Kuster B. Tschochner H. Tollervey D. Gavin A.-C. Hurt E. Mol. Cell. 2002; 10: 105-115Abstract Full Text Full Text PDF PubMed Scopus (389) Google Scholar). However, a number of trans-acting factors remain associated or join the pre-40 S particle in the nucleoplasm and accompany it upon export to the cytoplasm (18Schäfer T. Strauss D. Petfalski E. Tollervey D. Hurt E. EMBO J. 2003; 22: 1370-1380Crossref PubMed Scopus (250) Google Scholar). One of these factors is Rrp10p, which is essential for the conversion of 20 S pre-rRNA into mature 18 S rRNA and was identified in a synthetic lethality screen with a mutant of Gar1p (11Vanrobays E. Gleizes P.-E. Bousquet-Antonelli C. Noaillac-Depeyre J. Caizergues-Ferrer M. Gélugne J.-P. EMBO J. 2001; 20: 4204-4213Crossref PubMed Scopus (100) Google Scholar), one of the core proteins of box H/ACA small nucleolar ribonucleoproteins. Interestingly, Rrp10p, also known as Rio1p (19Angermayr M. Bandlow W. J. Biol. Chem. 1997; 272: 31630-31635Abstract Full Text Full Text PDF PubMed Scopus (24) Google Scholar), was subsequently shown to be a member of a novel subfamily of serine/threonine protein kinases with family members in eukaryotes, Archaea, and prokaryotes (20Krupa A. Srinivasan N. Protein Sci. 2002; 11: 1580-1584Crossref PubMed Scopus (21) Google Scholar, 21Angermayr M. Bandlow W. FEBS Lett. 2002; 524: 31-36Crossref PubMed Scopus (40) Google Scholar, 22Angermayr M. Roidl A. Bandlow W. Mol. Microbiol. 2002; 44: 309-324Crossref PubMed Scopus (75) Google Scholar). Homologs of Rio1p in other organisms have been implicated in cell cycle progression, and it has been reported that depletion of Rio1p in yeast causes arrest in the G1 phase of the cell cycle (21Angermayr M. Bandlow W. FEBS Lett. 2002; 524: 31-36Crossref PubMed Scopus (40) Google Scholar, 22Angermayr M. Roidl A. Bandlow W. Mol. Microbiol. 2002; 44: 309-324Crossref PubMed Scopus (75) Google Scholar). The connection between these two functions of Rio1p/Rrp10p and its enzymatic activity remains unclear. In yeast, the open reading frame Ynl207w encodes a protein called Rio2p that has 19% identity and 49% similarity to Rio1p/Rrp10p. The function of Rio2p in yeast cells is unknown, but obviously differs from that of Rio1p/Rrp10p as both proteins are essential. A systematic analysis of several hundreds of yeast protein complexes isolated by tandem-affinity purification (23Rigaut G. Shevchenko A. Rutz B. Wilm M. Mann M. Séraphin B. Nat. Biotechnol. 1999; 17: 1030-1032Crossref PubMed Scopus (2287) Google Scholar) demonstrated the association of Rio2p on the one hand with a number of proteins required late in 40 S subunits biogenesis such as Trs1p, Rrp12p, and Dim1p and on the other hand with several proteins implicated in cell growth and maintenance (24Gavin A.-C. Bösche M. Krause R. Grandi P. Marzioch M. Bauer A. Schultz J. Rick J.M. Michon A.-M. Cruciat C.-M. Remor M. Höfert C. Schelder M. Brajenovic M. Ruffner H. Merino A. Klein K. Hudak M. Dickson D. Rudi T. Gnau V. Bauch A. Bastuck S. Huhse B. Leutwein C. Heurtier M.-A. Copley R.R. Edelmann A. Querfurth E. Rybin V. Drewes G. Raida M. Bouwmeester T. Bork P. Seraphin B. Kuster B. Neubauer G. Superti-Furga G. Nature. 2002; 414: 141-147Crossref Scopus (4010) Google Scholar, 25Ho Y. Gruhler A. Heilbut A. Bader G.D. Moore L. Adams S.-L. Millar A. Taylor P. Bennett K. Boutilier K. Yang L. Wolting C. Donaldson I. Schandorff S. Shewnarane J. Vo M. Taggart J. Goudreault M. Muskat B. Alfarano C. Dewar D. Lin Z. Michalickova K. Willems A.R. Sassi H. Nielsen P.A. Rasmussen K.J. Andersen J.R. Johansen L.E. Hansen L.H. Jespersen H. Podtelejnikov A. Nielsen E. Crawford J. Poulsen V. Sørensen B.D. Matthiesen J. Hendrickson R.C. Gleeson F. Pawson T. Moran M.F. Durocher D. Mann M. Hogue C.W.V. Figeys D. Tyers M. Nature. 2002; 415: 180-183Crossref PubMed Scopus (3086) Google Scholar). In this study, we present evidence that Rio2p is a member of a second subfamily of protein kinases and, like Rio1p, is essential for cleavage at site D, the final processing step in the formation of mature 18 S rRNA. Strains and Plasmids—The yeast strains and plasmids used in this study are listed in Tables I and II. All strains were grown on yeast nitrogen base medium (Difco) containing the relevant amino acids and either 2% (w/v) glucose or galactose. Plates also contained 2% agar (Bacto-agar, Difco). During determination of growth rates, cells were kept in logarithmic growth by regular dilution with prewarmed medium. All optical density measurements were performed at 660 nm on a Novaspec 550 spectrophotometer (Amersham Biosciences).Table IS. cerevisiae strains used in this studyStrainGenotypeRef.Y22005Mata/α, his3Δ1/his3Δ1, leu2Δ0/leu2Δ0, lys2Δ0/LYS2, MET15/met15Δ0, ura3Δ0/ura3Δ0, ynl207w::kanMX4/YNL207wEUROSCARFSC1413Mata, ade2, arg4, leu2-3, 112, trp1-289, ura3-52, YNL207w::TAP-K.I.URA3EUROSCARFSC1110Mata, ade2, arg4, leu2-3, 112, trp1-289, ura3-52, YHR089c::TAP-K.I.URA3EUROSCARFYTV101Mata, his3Δ1, leu2Δ0, ura3Δ0, yn1207w::kanMX4 (pWTR2)This work Open table in a new tab Table IIPlasmids used in this studyPlasmidRef.pTL26HIS3, CEN/ARS, Amp, GAlI-1027Lafontaine D. Tollervey D. Nucleic Acids Res. 1996; 24: 3469-3472Crossref PubMed Scopus (89) Google ScholarpRS316URA3, CEN/ARS, Amp26Sikorski R.S. Hieter P. Genetics. 1989; 122: 19-27Crossref PubMed Google ScholarpWTR2Derived from pRS316 by insertion of RIO2 under its own promoter between BamHI and EcoRI sitesThis workpGalR2Derived from pTL26 by insertion of the GAL-rio2 gene between EcoRI and XhoI sitesThis workpGalR2(D229A)Identical to pGalR2, but containing D229A mutation in RIO2 coding regionThis workpGSTR2Derivative of pGEX1 containing GST-RIO2 fusion geneThis workpGSTR2(D229A)Identical to pGSTR2, but containing D229A mutation in RIO2 coding regionThis work Open table in a new tab The basal strain for our analysis was constructed by first transforming the diploid Y22005 strain carrying a rio2 gene inactivated by insertion of the kanamycin marker on one of its chromosomes (obtained from EUROSCARF) with the centromeric pWTR2(URA3) plasmid carrying a wild-type copy of the RIO2 gene. The resulting transformants were sporulated using the method described on the EUROSCARF site, 2Available at www.uni-frankfurt.de/fb15/mikro/euroscarf/index/html. except that our pre-sporulation plates contained 2× yeast nitrogen base medium and 5% (w/v) glucose and lacked uracil to select for the presence of the plasmid. After growing the dissected spores on YPD (1% yeast extract, 2% peptone, and 2% dextrose) plates, haploid transformants containing the inactivated rio2 gene were identified by PCR. The selected haploid strain containing the rio2::kan gene was called YTV101. The pWTR2 plasmid present in the cells was replaced by the pGalR2(HIS3) plasmid or its mutant counterparts by plasmid shuffling. Construction of Plasmid-encoded Wild-type and Mutant RIO2 Genes and RIO2 Fusion Genes—A plasmid-encoded copy of the RIO2 gene under the control of its own promoter was constructed by amplifying the gene including 300 bp of its upstream sequence with the R2B1fw and R2E1rv primers (Table III). The resulting product was inserted between the BamHI and EcoRI sites of pRS316(URA3) (26Sikorski R.S. Hieter P. Genetics. 1989; 122: 19-27Crossref PubMed Google Scholar), resulting in plasmid pWTR2. The RIO2 gene was fused to the GAL1-10 promoter by first amplifying it using the R2E1fw and R2S1rv primers (Table III). The resulting product was inserted into pTL26(HIS3) (27Lafontaine D. Tollervey D. Nucleic Acids Res. 1996; 24: 3469-3472Crossref PubMed Scopus (89) Google Scholar) between the EcoRI and XhoI sites to give the pGalR2 plasmid.Table IIISequences of oligonucleotides used in this work either as probes in Northern hybridization or as primers during construction of the various RIO2 genesProbesSequence1GAAATCTCTCACCGTTTGGAATACG2TGTTACCTCTGGGCCC3GGCCAGCAATTTCAAGTTAAPrimersR2E1fwAAAAAGAATTCTCAGACTAGAATGAAATTGGATACR2E1rvAAAAAGAATTCGAACAACTTGATTATTTGCGGCR2B1fwAAAAAGGATCCGGCTCACGTTGGTGAATGGCTR2S1rvAAAAAGTCGACAACAACTTGATTATTTGCGGCAva1fwCGAAGTCGTTCCAACTCCCTTGBstefwGGAGCTTATCGAGGGTTACCCBstervCTCCTCATTGGGTAACCCHincrvTCAGTTTCTTTTTGAAGAAACGACGVVICGCGTCATATAGTCGTTAAGGAGCTTATCGAGGGTTACCC (M189K)VVKCGCGTCATATAGTCGTTATTGAGCTTATCGAGGGTTACCC (M189I)GRESCGGTAACACTATTGGTGTTGGTATTGAATCTGACATCTATAAAGTAAG (K105R)GIESCGGTAACACTATTGGTGTTGGTAGGGAATCTGACATCTATAAAGTAAG (K105I)GLIFCDGCAAATAGCGGACTTATCTTTTGTGATTTTAATGAGTTTAATATT (H227F)GLIYCDGCAAATAGCGGACTTATCTATTGTGATTTTAATGAGTTTAATATT (H227Y)GLIHCAGCAAATAGCGGACTTATCCATTGTGCTTTTAATGAGTTTAATATT (D229A) Open table in a new tab Point mutations (see Fig. 2) were introduced into the RIO2 coding region by site-directed mutagenesis via the megabase primer method (28Sambrook J. MacCallum P. Russell R.B. Molecular Cloning: A Laboratory Manual. 4th Ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY2001Google Scholar) using the unique AvaI, BstEII, and HincII sites in the RIO2 gene carried on the pGalR2 plasmid. The oligonucleotides used for mutagenesis are listed in Table III. A GST 3The abbreviations used are: GST, glutathione S-transferase; DTT, dithiothreitol; MBP, myelin basic protein; PAA, polyacrylamide; TAP, tandem affinity purification. -RIO2 fusion was constructed by amplification of the RIO2 gene using the R2N1fw and R2E1rv primers (Table III). The former primer introduces an NcoI site at the ATG start codon of the RIO2 coding region. The PCR product was inserted between the NcoI and EcoRI sites of plasmid pRP261, a derivative of pGEX1 (29Smith D.B. Johnson K.S. Gene (Amst. 1988; 67: 31-40Crossref PubMed Scopus (5047) Google Scholar) that fuses the RIO2 and GST coding regions in-frame. This plasmid was transformed into the Escherichia coli Sure strain (Stratagene), and expression of the fusion protein was induced by the addition of 1 mm isopropyl-β-d-thiogalactopyranoside to an exponentially growing culture. After an additional 2 h at 30 °C, cells were collected and broken by sonication in lysis buffer containing 20% (v/v) glycerol, 50 mm Tris-HCl (pH 8.0), 125 mm NaCl, 2.5 mm MgCl2, 1 mm DTT, 0.1 mm EDTA, and 0.1% Nonidet P-40. The extract was centrifuged for 15 min at 14,000 rpm in an Eppendorf centrifuge to remove the cell debris. Glutathione-Sepharose beads (400 μl; Amersham Biosciences) were added to the resulting supernatant. After incubation for 30 min at 4 °C, the beads were washed three times with lysis buffer. GST-Rio2p(D229A) was purified in the same manner from cells expressing a derivative plasmid in which the wild-type RIO2 coding region had been replaced by the mutant version. Biochemical Fractionation—20 OD660 units of yeast cells harvested during mid-logarithmic growth were resuspended in buffer A (1 m sorbitol, 50 mm Tris-HCl (pH 8.0), and 10 mm MgCl2) containing 30 mm DTT and incubated at room temperature for 15 min. The cells where then pelleted by centrifugation in an Eppendorf centrifuge for 1 min at 3000 rpm, resuspended in buffer A containing 3 mm DTT and 0.45 mg/ml zymolyase (Seikagaku), and incubated at 30 °C for 60 min. The cells were pelleted, washed with ice-cold buffer A, and resuspended in buffer B (15 mm KCl, 10 mm Tris-HCl (pH 8.0), 5 mm MgCl2, 0.1 mm EDTA, and 3 mm DTT) using a homogenizer with a loose-fitting pestle. The cell suspension was incubated at 4 °C for 20 min and then broken with five strokes of a tight-fitting pestle. The resulting homogenate was separated into a cytoplasmic and a nuclear fraction by centrifugation for 20 min at 13,000 rpm in an Eppendorf centrifuge at 4 °C. RNA and Protein Analysis—Total RNA was isolated by resuspending 20 OD660 units of cells in 600 μl of buffer (10 mm Tris-HCl (pH 7.5), 10 mm EDTA, and 0.5% (w/v) SDS) and 600 μl of water-saturated phenol. After adding 100 μl of glass beads (diameter, 0.5–0.8 mm), the samples were heated at 65 °C for 1 h under continuous stirring. The aqueous phase was re-extracted with phenol and again with 600 μl of chloroform/isoamyl alcohol (24:1, v/v). RNA was precipitated by adding 40 μl of 3 m NaAc (pH 5.2) and 800 μl of EtOH and redissolved in RNase-free distilled water to a concentration of 0.4 A260/μl. Northern analysis was performed as described previously using the various probes indicated in Fig. 1A (30Venema J. Vos H. Faber A.W. van Venrooij W.J. Raué H.A. RNA (N. Y.). 2000; 6: 1660-1671Crossref PubMed Scopus (56) Google Scholar). Protein extracts for Western blotting were prepared by lysing the cells in 10 mm Tris-HCl (pH 8.0), 1 mm EDTA, 0.1 m NaCl, and 1 mm DTT with glass beads (diameter, 0.5–0.8 mm) by vortexing for 5 min. The extracts were subjected to SDS-PAGE on 12% minigels (Bio-Rad). After blotting onto nylon membrane (Protran, Schleicher & Schüll) and incubation with horse radish peroxidase-labeled antibodies against the protein A epitope, bound antibody was visualized using nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate coloring reaction. In Vitro Kinase Assays—The auto- and heterophosphorylating activities of recombinant GST-Rio2p were determined by incubating 5 μl of Sepharose-glutathione-bound GST-Rio2p beads in 20 μl of buffer containing 50 mm Tris-HCl (pH 7.2), 5 mm MgCl2, and 1 μCi of [γ-32P]ATP (10 mCi/ml; Amersham Biosciences) either with or without 5 mm MnCl2. To determine the ability of Rio2p to heterophosphorylate a substrate, 4 μg of myelin basic protein (MBP; Sigma) was added to the reaction mixture. The samples were analyzed by electrophoresis on a 12% SDS-PAA gel, followed by autoradiography. The amount of GST-Rio2p present in the reaction mixture was assayed by staining with Coomassie Brilliant Blue Rio2p Is a Member of a Distinct Subfamily of Putative Protein Kinases—The S. cerevisiae open reading frame Ynl207w encodes a protein, designated Rio2p (19Angermayr M. Bandlow W. J. Biol. Chem. 1997; 272: 31630-31635Abstract Full Text Full Text PDF PubMed Scopus (24) Google Scholar), that shows significant structural similarity to Rio1p/Rrp10p. The latter was found to be essential for endonucleolytic cleavage at site D, the final step in the formation of mature 18 S rRNA (11Vanrobays E. Gleizes P.-E. Bousquet-Antonelli C. Noaillac-Depeyre J. Caizergues-Ferrer M. Gélugne J.-P. EMBO J. 2001; 20: 4204-4213Crossref PubMed Scopus (100) Google Scholar). Subsequently, it was characterized as a predominantly cytoplasmic serine/threonine protein kinase conserved from bacteria to man with a role in cell cycle progression (20Krupa A. Srinivasan N. Protein Sci. 2002; 11: 1580-1584Crossref PubMed Scopus (21) Google Scholar, 21Angermayr M. Bandlow W. FEBS Lett. 2002; 524: 31-36Crossref PubMed Scopus (40) Google Scholar, 22Angermayr M. Roidl A. Bandlow W. Mol. Microbiol. 2002; 44: 309-324Crossref PubMed Scopus (75) Google Scholar). Fig. 2 shows the results of an alignment of Rio1p/Rrp10p and Rio2p, demonstrating that the sequence similarities between the two proteins are predominantly confined to three regions indicated as I, II, and III. 4A detailed alignment is available upon request. Regions I and III contain the putative ATP-binding and kinase domains, respectively (22Angermayr M. Roidl A. Bandlow W. Mol. Microbiol. 2002; 44: 309-324Crossref PubMed Scopus (75) Google Scholar). This result suggests that Rio2p also is a protein kinase, but may belong to a subfamily distinct from the one defined by Rio1p/Rrp10p. Using the Rio2p sequence as our starting point, we searched the NCBI Protein Database for homologs of Rio2p in other organisms and identified a number of such homologs in both eukaryotes and Archaea. Alignment of these homologs revealed a pattern of sequence conservation that is distinct from the one between Rio2p and Rio1p (Fig. 2). First, the N-terminal regions of the various Rio2 proteins show marked similarity, but differ considerably from the corresponding region in Rio1p, which is not significantly conserved in the latter subfamily (20Krupa A. Srinivasan N. Protein Sci. 2002; 11: 1580-1584Crossref PubMed Scopus (21) Google Scholar, 22Angermayr M. Roidl A. Bandlow W. Mol. Microbiol. 2002; 44: 309-324Crossref PubMed Scopus (75) Google Scholar). Second, within the regions that are conserved between Rio1p and Rio2p, conservation within each of the two subfamilies is higher than between the two subfamilies (Fig. 2). From these data, we conclude that Rio2p defines a putative protein kinase subfamily that is related to, but distinct from, the one founded by Rio1p/Rrp10p. Phylogenetic analysis (Fig. 3) adds further support to this conclusion. This analysis clearly shows an early division between Rio1p- and Rio2p-like proteins. Furthermore, a small number of (archae)bacterial Rio-like proteins seem to from a third subfamily. Interestingly, our data base search did not identify any eubacterial members of the Rio2p subfamily. Thus, whereas eukaryotes and Archaea have at least one gene member in both the RIO1 and RIO2 subfamily, the latter seems to be absent from the eubacterial kingdom. This suggests that the two types of subfamily originated from duplication of an ancestral gene that occurred before the split between Archaea and eukaryotes. Because Rio1p and Rio2p are both essential in yeast, the two genes gained different functions. Low Level Expression of Rio2p Is Sufficient to Support Normal Growth—To study the role of Rio2p in yeast in more detail, we constructed a mutant strain that conditionally expresses the protein. As the starting point, we used the diploid strain Y22005 obtained from EUROSCARF. This strain contains a rio2 gene that has been disrupted by insertion of the kanamycin gene on one of its chromosomes. Diploid Y22005 cells were transformed with the centromeric pWTR2(URA3) plasmid carrying a wild-type RIO2 gene under the control of its authentic promoter. Transformants were selected on plates lacking uracil; and after sporulation, tetrads were dissected and spotted on YPD plates. Transformation of Y22005 with an empty vector showed the expected 2:2 segregation of viable and nonviable spores. PCR analysis demonstrated that none of the viable spores contained the disrupted rio2 gene, confirming that RIO2 is an essential gene as previously reported (31Winzeler E.A. Shoemaker D.D. Astromoff A. Liang H. Anderson K. Andre B. Bangham R. Benito R. Boeke J.D. Bussey H. Chu A.M. Connelly C. Davis K. Dietrich F. Dow S.W. El Bakkoury M. Foury F. Friend S.H. Gentalen E. Giaever G. Hegemann J.H. Jones T. Laub M. Liao H. Liebundguth N. Lockhart D.J. Lucau-Danila A. Lussier M. M'Rabet N. Menard P. Mittmann M. Pai C. Rebischung C. Revuelta J.L. Riles L. Roberts C.J. Ross-MacDonald P. Scherens B. Snyder M. Sookhai-Mahadeo S. Storms R.K. Véronneau S. Voet M. Volckaert G. Ward T.R. Wysocki R. Yen G.S. Yu K. Zimmermann K. Philippsen P. Johnston M. Davis R.W. Science. 1999; 285: 901-906Crossref PubMed Scopus (3212) Google Scholar). In contrast, sporulation of Y22005 cells carrying the pWTR2 plasmid in most cases resulted in four viable spores. The resulting haploid transformants were tested for G414 resistance to ascertain the presence of the disrupted chromosomal rio2 gene as well as for their ability to grow on plates lacking uracil to ensure retention of the plasmid. As a final check, selected cells were analyzed by PCR to ascertain that no recombination had taken place between the plasmid and the genome. This resulted in strain YTV101(pWTR2) (rio2-null), which was found to grow normally. To determine the effect of depletion of Rio2p, we replaced the pWTR2 plasmid with plasmid pGalR2(HIS3), which contains the wild-type RIO2 gene under the control of the repressible GAL1-10 promoter, by plasmid shuffling and determined the effect of a shift from galactose to glucose on growth of the YTV101(pGalR2) transformants. To our surprise, we found no significant change in growth rate after the shift compared with the wild-type control, for which we took cells grown from viable haploid spores of the Y22005 strain that had been transformed with an empty vector. Even after culturing the pGalR2-transformed YTV101 cells for several days on glucose-based medium, normal
In recent years considerable insight has been gained into the mechanisms of nucleocytoplasmic transport. Interestingly, a number of strong indications were found that nuclear import of r-proteins uses a specialized import pathway different from that used by the majority of karyophilic proteins. This suggests that the nuclear localization signals or sequences (NLSs) of r-proteins may be structurally distinct from the classical NLSs present in the latter class of proteins. This chapter reviews present knowledge of the mechanism and signals responsible for the nuclear import of proteins, in particular, r-proteins. A similar situation exists in mammalian cells, where the nuclear import of rat r-proteins S7, L5, and L23a could be achieved by four different vertebrate importins, namely, transportin; RanBP5, the homologue of yeast Pse1p; and Ran BP7; as well as importin β itself, but without the aid of importin α. Mammalian r-proteins also use a specialized nuclear import pathway not involving importin α.The situation is even more complex than in yeast, however, since four different receptors have been identified, all belonging to the importin β family: transportin, which is also involved in nuclear import of hnRNP proteins; importin β itself; RanBP5, the homologue of the yeast r-protein importin Pse1p; and RanBP7. Each of these receptors was shown to be able to promote nuclear import of at least three different r-proteins (S7, L5, and L23a) directly, without the help of importin α.
Abstract We have developed a system for mutational analysis of Saccharomyces cerevisiae ribosomal RNA in vivo in which yeast cells can be made completely dependent on mutant rRNA and ribosomes by a simple switch in carbon source. The system is based on a yeast strain defective in RNA polymerase I (Pol I) transcription [Nogi et al. (1991). Proc. Natl. Acad. Sci. USA 88 , 3962–3966]. This normally inviable strain was rescued by integration of multiple copies of the complete 37S pre‐rRNA operon under control of the inducible, Pol II‐transcribed GAL7 promoter into the rDNA repeat on chromosome XII. The resulting YJV100 strain can only grow on medium containing galactose as the carbon source. A second, episomal vector was constructed in which the rDNA unit was placed under control of the constitutive PGK1 promoter. YJV100 cells transformed with this vector are now also able to grow on glucose‐based medium making the cells completely dependent on plasmid‐encoded rRNA. We show that the Pol II‐transcribed pre‐rRNA is processed and assembled similarly to authentic Pol I‐synthesised pre‐rRNA, making this ‘ in vivo Pol II system’ suitable for the detailed analysis of rRNA mutations, even highly deleterious ones, affecting ribosome biogenesis or function. A clear demonstration of this is our finding that an insertion into variable region V8 in 17S rRNA, previously judged to be neutral with respect to processing of 17S rRNA, its assembly into 40S subunits and the polysomal distribution of these subunits [Musters et al. (1989), Mol. Cell. Biol. 9 , 551–559], is in fact a lethal mutation.
