Capsaicin has been used as a topical analgesic to treat diverse pain conditions. We investigated the molecular mechanisms that mediate the inhibition of high-voltage-activated calcium channel currents (ICa) using trigeminal ganglion neurons and a heterologous expression system. Capsaicin inhibited ICa in capsaicin-sensitive trigeminal ganglion neurons, but not in capsaicin-insensitive neurons. Single-cell reverse-transcription polymerase chain reaction revealed the expression of TRPV1 only in capsaicin-sensitive neurons. Capsaicin inhibited ICa in transient receptor potential vanilloid-1-expressing C2D7 cells stably expressing human N-type calcium channels, whereas capsaicin failed to inhibit ICa in naïve C2D7 cells with no endogenous transient receptor potential vanilloid-1 expression. Calcium influx via transient receptor potential vanilloid-1 is not likely to play a critical role in capsaicin-induced ICa inhibition in trigeminal ganglion neurons. ICa inhibition might be one of the mechanisms for the analgesic effect of capsaicin.
We tested whether it is possible to selectively block pain signals in the orofacial area by delivering the permanently charged lidocaine derivative QX-314 into nociceptors via TPRV1 channels. We examined the effects of co-applied QX-314 and capsaicin on nociceptive, proprioceptive, and motor function in the rat trigeminal system. QX-314 alone failed to block voltage-gated sodium channel currents (I(Na)) and action potentials (APs) in trigeminal ganglion (TG) neurons. However, co-application of QX-314 and capsaicin blocked I(Na) and APs in TRPV1-positive TG and dental nociceptive neurons, but not in TRPV1-negative TG neurons or in small neurons from TRPV1 knock-out mice. Immunohistochemistry revealed that TRPV1 is not expressed by trigeminal motor and trigeminal mesencephalic neurons. Capsaicin had no effect on rat trigeminal motor and proprioceptive mesencephalic neurons and therefore should not allow QX-314 to enter these cells. Co-application of QX-314 and capsaicin inhibited the jaw-opening reflex evoked by noxious electrical stimulation of the tooth pulp when applied to a sensory but not a motor nerve, and produced long-lasting analgesia in the orofacial area. These data show that selective block of pain signals can be achieved by co-application of QX-314 with TRPV1 agonists. This approach has potential utility in the trigeminal system for treating dental and facial pain.
Temperature signaling can be initiated by members of transient receptor potential family (thermo-TRP) channels. Hot and cold substances applied to teeth usually elicit pain sensation. This study investigated the expression of thermo-TRP channels in dental primary afferent neurons of the rat identified by retrograde labeling with a fluorescent dye in maxillary molars. Single cell reverse transcription-PCR and immunohistochemistry revealed expression of TRPV1, TRPM8, and TRPA1 in subsets of such neurons. Capsaicin (a TRPV1 agonist), menthol (a TRPM8 agonist), and icilin (a TRPM8 and TRPA1 agonist) increased intracellular calcium and evoked cationic currents in subsets of neurons, as did the appropriate temperature changes (>43 °, <25 °, and <17 °C, respectively). Some neurons expressed more than one TRP channel and responded to two or three corresponding stimuli (ligands or thermal stimuli). Immunohistochemistry and single cell reverse transcription-PCR following whole cell recordings provided direct evidence for the association between the responsiveness to thermo-TRP ligands and expression of thermo-TRP channels. The results suggest that activation of thermo-TRP channels expressed by dental afferent neurons contributes to tooth pain evoked by temperature stimuli. Accordingly, blockade of thermo-TRP channels will provide a novel therapeutic intervention for the treatment of tooth pain. Temperature signaling can be initiated by members of transient receptor potential family (thermo-TRP) channels. Hot and cold substances applied to teeth usually elicit pain sensation. This study investigated the expression of thermo-TRP channels in dental primary afferent neurons of the rat identified by retrograde labeling with a fluorescent dye in maxillary molars. Single cell reverse transcription-PCR and immunohistochemistry revealed expression of TRPV1, TRPM8, and TRPA1 in subsets of such neurons. Capsaicin (a TRPV1 agonist), menthol (a TRPM8 agonist), and icilin (a TRPM8 and TRPA1 agonist) increased intracellular calcium and evoked cationic currents in subsets of neurons, as did the appropriate temperature changes (>43 °, <25 °, and <17 °C, respectively). Some neurons expressed more than one TRP channel and responded to two or three corresponding stimuli (ligands or thermal stimuli). Immunohistochemistry and single cell reverse transcription-PCR following whole cell recordings provided direct evidence for the association between the responsiveness to thermo-TRP ligands and expression of thermo-TRP channels. The results suggest that activation of thermo-TRP channels expressed by dental afferent neurons contributes to tooth pain evoked by temperature stimuli. Accordingly, blockade of thermo-TRP channels will provide a novel therapeutic intervention for the treatment of tooth pain. Recent studies have demonstrated that subfamilies of TRP 2The abbreviations used are: TRP, transient receptor potential; thermo-TRPs, temperature-activated transient receptor potential channels; IB4, isolectin B4; RT, reverse transcription; TG, trigeminal ganglion; DiI, 1,1′-dioctadecyl-3,3,3′,3′-tetramethylindocarbocyanine perchlorate. channels play critical roles in the transduction of temperature and pain sensation (1Patapoutian A. Peier A.M. Story G.M. Viswanath V. Nat. Rev. Neurosci. 2003; 4: 529-539Crossref PubMed Scopus (639) Google Scholar). The temperature-activated TRP channels (thermo-TRP channels) include TRPV1, TRPM8, and TRPA1; they are activated by >43 °, <25 °, and <17 °C, respectively (1Patapoutian A. Peier A.M. Story G.M. Viswanath V. Nat. Rev. Neurosci. 2003; 4: 529-539Crossref PubMed Scopus (639) Google Scholar). They can also be activated by the exogenous ligands, capsaicin (TRPV1), menthol (TRPM8), and icilin (TRPM8 and TRPA1) (2Caterina M.J. Schumacher M.A. Tominaga M. Rosen T.A. Levine J.D. Julius D. Nature. 1997; 389: 816-824Crossref PubMed Scopus (7144) Google Scholar, 3Peier A.M. Moqrich A. Hergarden A.C. Reeve A.J. Andersson D.A. Story G.M. Earley T.J. Dragoni I. McIntyre P. Bevan S. Patapoutian A. Cell. 2002; 108: 705-715Abstract Full Text Full Text PDF PubMed Scopus (1759) Google Scholar, 4Story G.M. Peier A.M. Reeve A.J. Eid S.R. Mosbacher J. Hricik T.R. Earley T.J. Hergarden A.C. Andersson D.A. Hwang S.W. McIntyre P. Jegla T. Bevan S. Patapoutian A. Cell. 2003; 112: 819-829Abstract Full Text Full Text PDF PubMed Scopus (1970) Google Scholar, 5McKemy D.D. Neuhausser W.M. Julius D. Nature. 2002; 416: 52-58Crossref PubMed Scopus (2011) Google Scholar). Given that the thermo-TRPs are involved in converting thermal information into electrical signals within the sensory nervous system (1Patapoutian A. Peier A.M. Story G.M. Viswanath V. Nat. Rev. Neurosci. 2003; 4: 529-539Crossref PubMed Scopus (639) Google Scholar), it is possible that thermo-TRPs expressed by dental primary afferents play a crucial role for transduction process of tooth pain, especially caused by noxious thermal stimulation. The different forms of pain are produced by distinctive molecular and cellular mechanisms. It is now thought that elucidation of the main mechanism involved in a certain form of pain is key to the development of pain treatments, which specifically target underlying the cause rather than just symptoms (6Scholz J. Woolf C.J. Nat. Neurosci. 2002; 5: 1062-1067Crossref PubMed Scopus (690) Google Scholar). Tooth pain is commonly induced by the presence of hot or cold foods in the oral cavity (7Pashley D.H. Crit. Rev. Oral Biol. Med. 1996; 7: 104-133Crossref PubMed Scopus (296) Google Scholar, 8Nair P.N. Oral Surg. Oral Med. Oral Pathol. Oral Radiol. Endod. 1995; 80: 710-719Abstract Full Text PDF PubMed Scopus (35) Google Scholar, 9Mengel M.K. Stiefenhofer A.E. Jyvasjarvi E. Kniffki K.D. Pain. 1993; 55: 159-169Abstract Full Text PDF PubMed Scopus (25) Google Scholar). Tooth pain results from the exposure of dentin, which is caused by dissolution of the protective enamel covering the tooth crown by dental caries or gingival recession (7Pashley D.H. Crit. Rev. Oral Biol. Med. 1996; 7: 104-133Crossref PubMed Scopus (296) Google Scholar, 8Nair P.N. Oral Surg. Oral Med. Oral Pathol. Oral Radiol. Endod. 1995; 80: 710-719Abstract Full Text PDF PubMed Scopus (35) Google Scholar). Since the proposition of Brännström, arguing that the fluid movement in dentinal tubules induced by diverse stimuli, including thermal stimuli, elicits tooth nerve firing to produce tooth pain (referred to as the hydrodynamic hypothesis) (10Brannstrom M. Linden L.A. Astrom A. Caries Res. 1967; 1: 310-317Crossref PubMed Scopus (242) Google Scholar, 11Brannstrom M. Astrom A. Int. Dent. J. 1972; 22: 219-227PubMed Google Scholar), much evidence has been reported to support the hypothesis (12Andrew D. Matthews B. J. Physiol. 2000; 529: 791-802Crossref PubMed Scopus (64) Google Scholar). However, it is not fully understood yet how such temperature changes are perceived as painful by the teeth, given that tooth afferents are generally considered to be purely nociceptive. We hypothesized that this is mediated by thermo-TRP channels (1Patapoutian A. Peier A.M. Story G.M. Viswanath V. Nat. Rev. Neurosci. 2003; 4: 529-539Crossref PubMed Scopus (639) Google Scholar, 13Clapham D.E. Nature. 2003; 426: 517-524Crossref PubMed Scopus (2164) Google Scholar, 14Moran M.M. Xu H. Clapham D.E. Curr. Opin. Neurobiol. 2004; 14: 362-369Crossref PubMed Scopus (260) Google Scholar). In the present experiments we identified dental afferent neurons dissociated from the trigeminal ganglion of rats, by previously applying a fluorescent dye to the exposed dentin of molar teeth. The neurons were classified by size and expression of NaV1.8- and the isolectin B4 (IB4)-binding protein. We found evidence for expression of TRPV1, TRPM8, and TRPA1 in these neurons by measuring mRNA level through single cell reverse transcription (RT)-PCR, by immunohistochemistry, and by measuring inward currents or changes in intracellular calcium in response to the appropriate ligands or temperature changes. The results indicate that TRP channels could be responsible for the transduction of heat and cold stimuli into the sensation of pain. All surgical and experimental procedures were reviewed and approved by the Institutional Animal Care and Use Committee in College of Dentistry, Seoul National University. Sprague-Dawley rats (Harlan, Indianapolis, IN), weighing ∼160-180 g at the time of surgery, were housed at a temperature of 23 ± 2 °C with a 12-h light-dark cycle and fed food and water ad libitum. The animals were allowed to habituate to the housing facilities for 1 week before the experiments. Verification and Classification of Dental Primary Afferent Neurons— Dental primary afferent neurons were identified by retrograde labeling with a fluorescent dye (DiI, D-282, Molecular Probes, Eugene, OR) (15Taddese A. Nah S.Y. McCleskey E.W. Science. 1995; 270: 1366-1369Crossref PubMed Scopus (133) Google Scholar, 16Cook S.P. Vulchanova L. Hargreaves K.M. Elde R. McCleskey E.W. Nature. 1997; 387: 505-508Crossref PubMed Scopus (396) Google Scholar, 17Eckert S.P. Taddese A. McCleskey E.W. J. Neurosci. Methods. 1997; 77: 183-190Crossref PubMed Scopus (50) Google Scholar). Three weeks after the dye was placed in maxillary molars, trigeminal ganglion neurons were prepared (18Yang B.H. Piao Z.G. Kim Y.B. Lee C.H. Lee J.K. Park K. Kim J.S. Oh S.B. J. Dent. Res. 2003; 82: 781-785Crossref PubMed Scopus (159) Google Scholar) and maintained in a humidified atmosphere of 95% O2/5% CO2 at 37 °C; they were used for calcium imaging and whole cell recording within 6 and 8 h. DiI-labeled neurons were identified by fluorescence and were further classified by treatment immediately after the experiment with IB4 conjugated to fluorescein isothiocyanate (10 μg/ml IB4-fluorescein isothiocyanate, Sigma) (19Stucky C.L. Lewin G.R. J. Neurosci. 1999; 19: 6497-6505Crossref PubMed Google Scholar). IB4-positive neurons had an intense bright ring around the soma membrane (see Fig. 1A, panel f). Intracellular Calcium Imaging—Neurons were loaded with fura-2 AM (acetoxymethyl, 2 μm; Molecular Probes) for 40 min at 37 °C in a balanced salt solution (in mm: 145 NaCl, 5 KCl, 2 CaCl2,1MgCl2, 10 HEPES, and 10 glucose), followed by rinsing and incubation for 30 min to de-esterify the dye. The cells plated onto poly-l-ornithine-coated coverslips were mounted onto the chamber, which then was placed onto the inverted microscope (Olympus IX70, Japan) and perfused continuously by balanced salt solution at 2 ml/min. All measurements were made at 36 °C (temperature controller PTC-20, ALA Scientific Instrument Inc., Westbury, NY). Cells were illuminated with a 175-watt xenon arc lamp, and excitation wavelengths (340/380 nm) were selected by a Lambda DG-4 monochromator wavelength changer (Shutter Instrument, Novato, CA). Intracellular free calcium concentration ([Ca2+]i) was measured by digital video microfluorometry with an intensified charge-coupled device camera (CasCade, Roper Scientific, Trenton, NJ) coupled to a microscope and software (Metafluor, Universal Imaging Corp., Downington, PA) on a computer with a Pentium 4 microprocessor chip. Electrophysiology—Whole cell patch clamp recordings were performed to measure currents with Axopatch-1C amplifier (Axon Instruments, Union City, CA). The patch pipettes were pulled from borosilicate capillaries (Chase Scientific Glass Inc., Rockwood, TN). The resistance of pipette was 2-5 megohms, and series resistance was compensated (>80%). Data were low pass-filtered at 2 kHz and sampled at 10 kHz. The pClamp8 (Axon Instruments) software was used during experiments and analysis. Pipette solution was (in mm): 135 CsCl, 5 MgCl2, 10 HEPES, 5 Mg-ATP, 5 EGTA, 10 glucose, adjusted pH to 7.4 with CsOH, and 301 mosm. The bath was continuously perfused with extracellular solution containing (in mm): 140 NaCl, 5 KCl, 2 CaCl2, 1 MgCl2, 10 HEPES, 10 glucose, adjusted to pH 7.4 with NaOH, and 305 mosm. Experiments were performed at a holding potential of -60 mV at 28 °C. Immunohistochemistry—Cells were identified after electrophysiological recording by marking the bottom of the cover glass surrounding the cells. To maintain the mark during staining, cover glasses were kept on parafilm during the immunohistochemical procedure (20Petruska J.C. Napaporn J. Johnson R.D. Gu J.G. Cooper B.Y. J. Neurophysiol. 2000; 84: 2365-2379Crossref PubMed Scopus (214) Google Scholar, 21Galoyan S.M. Petruska J.C. Mendell L.M. Eur. J. Neurosci. 2003; 18: 535-541Crossref PubMed Scopus (56) Google Scholar). Primary antibodies were rat anti-TRPM8 (1:500, a gift from Dr. Makoto Tominaga) and guinea pig anti-TRPV1 (1:500, Chemicon), incubated at 4 °C overnight. The cells were washed three times with phosphate-buffered saline and then incubated with Cy5-conjugated donkey anti-rat, fluorescein isothiocyanate-conjugated donkey anti-guinea pig (Jackson ImmunoResearch, West Grove, PA) at 1:200, respectively, for 1 h at room temperature. After washing with phosphate-buffered saline, the samples were covered with Vectashield mounting media (Vector Laboratories, Inc., Burlingame, CA) and visualized using a confocal microscope with the appropriate filter sets (LSM 5 PASCAL, Carl Zeiss, Germany). The primary antibodies were omitted as negative control (data not shown). Single Cell RT-PCR—We adopted methods described by Silbert et al. (22Silbert S.C. Beacham D.W. McCleskey E.W. J. Neurosci. 2003; 23: 34-42Crossref PubMed Google Scholar). Briefly, following whole cell patch clamp recordings, we changed patch pipettes with a tip diameter of about 30 μm for cell collection. The intracellular content of a single cell was aspirated into a patch pipette under visual control and was gently put into a reaction tube containing reverse transcription agents. Optionally, to avoid genomic DNA contaminations, a DNase I (for 40 min at 37 °C) digest was performed before reverse transcription. After heat inactivation, RT was carried out for 50 min at 50 °C (superscript III, Invitrogen). Subsequently, the cDNA was divided into four or five 2-μl aliquots that were used in separate PCRs. All PCR amplifications were performed with nested primers (Table 1). The first round of PCR was preformed in 50 μl of PCR buffer containing 0.2 mm dNTPs, 0.2 μm "outer" primers, 5 μl of RT product, and 0.2 μlof platinum TaqDNA polymerase (Invitrogen). The protocol included 5 min of initial denaturation at 95 °C, followed by 35 cycles of 40 s of denaturation at 95 °C, 40 s of annealing at 55 °C, and then 40 s of elongation at 72 °C, and was completed with 7 min of final elongation. For the second round of amplification, the reaction buffer (20 μl) contained 0.2 mm dNTPs, 0.2 μm "inner" primers, 5 μl of the products from the first round, and 0.1 μl of platinum TaqDNA polymerase. The reaction was the same as the first round. The PCR products were then displayed on the ethidium bromide-stained 2% agarose gel. Gels were photographed using a digital camera.TABLE 1DNA primers used for single cell RT-PCRTarget gene (product length)Outer primersNested primersGenbank no.TRPV1 (426 bp, 245 bp)ATGCCAGCTACACAGACAGCTATGACCCTCTTGGTGGAGAATAF029310CCTTCCTGTTGGTGATCTCTTCTGTGTTATCTGCCACCTCCATRPM8 (369 bp, 244 bp)GAAGAGGAGATTGAGAGCTGGATCACGGTCATCAAGATGGAGAY072788GAGGACTTCATTGGTGAGGAACTTGGGCCTGTCCTTTATGAGTRPA1 (306 bp, 189 bp)ATCATGACCTGGCAGACTACCTAGCAACTGCTTCTGCATCCTAY496961GCCTACAAGCATAATGGAGAGGTTGTCCTCATCCATCACCAGNav1.8 (356 bp, 215 bp)AGATCCACTGTCTGGACATCCTCCAATCTCTCCAAAGCATCCU53833GAAAGACGTAGCAGAGGCAGTTGAGTCCACTGTTTGCCATGA Open table in a new tab Thermal Stimulation and Drug Application—For calcium imaging experiment, temperature was controlled by PTC-20, a Peltier temperature control system (ALA Scientific Instrument Inc.), in which coverslips were cooled down at a rate of 0.13 °C/s from 36 °C to 10 °C and heated at a rate of 0.1 °C/s from 36 °C to 46 °C. For thermal stimulation for whole cell patch clamp recordings, we applied cold (4 °C) or heated (70 °C) extracellular solution for 1 min. Final temperatures of thermal stimuli, cold and hot, measured by a thermistor placed in the recording chamber, were 12 °C and 45 °C, respectively. Capsaicin, capsazepine, and menthol stock solutions were made in ethanol and stored at -20 °C. Icilin was dissolved in dimethyl sulfoxide (Me2SO) to make stock solution and kept at -20 °C. All drugs were purchased from Sigma. We confirmed that 0.01% Me2SO or ethanol did not affect [Ca2+]i and currents measured in the present study. Drugs were diluted to their final concentration using the extracellular solution and then applied by gravity through a bath perfusion system with a flow rate of 2 ml/min. Distribution of Dental Primary Afferent Neurons—We considered fluorescent DiI-labeled neurons present in the dissociations of TG to be dental primary afferents (17Eckert S.P. Taddese A. McCleskey E.W. J. Neurosci. Methods. 1997; 77: 183-190Crossref PubMed Scopus (50) Google Scholar, 23Chaudhary P. Martenson M.E. Baumann T.K. J. Dent. Res. 2001; 80: 1518-1523Crossref PubMed Scopus (56) Google Scholar). DiI-labeled neurons were ∼40 to 60 TG neurons per animal (n = 60), and they constituted ∼13% of total neurons (Fig. 1A, panels a and b). In differential interference contrast and fluorescent images of the same field (Fig. 1A, panels c and d, respectively), we found DiI-labeled TG neurons with IB4-positive (Fig. 1A, panels e and f). IB4-positive neurons were 57% (229/403) of dental primary afferent neurons and almost exclusively below 40-μm diameter (Fig. 1B), consistent with previous reports (16Cook S.P. Vulchanova L. Hargreaves K.M. Elde R. McCleskey E.W. Nature. 1997; 387: 505-508Crossref PubMed Scopus (396) Google Scholar, 19Stucky C.L. Lewin G.R. J. Neurosci. 1999; 19: 6497-6505Crossref PubMed Google Scholar, 24Dirajlal S. Pauers L.E. Stucky C.L. J. Neurophysiol. 2003; 89: 513-524Crossref PubMed Scopus (127) Google Scholar). In the next experiments, we used IB4-positive dental primary afferent neurons (Fig. 1A, panel f). Interestingly, the proportion of IB4-positive neurons was relatively higher in dental primary afferents, compared with total TG neurons (Table 2).TABLE 2Numbers of trigeminal ganglion neurons and identified dental primary afferent neurons (Dil-labeled) responding to thermo-TRP ligands determined in single cell calcium imaging experiments The values are the percentages of cells in which calcium transients were observed; numbers in parentheses are numbers of cells tested.Small (<24 μm)Medium (24–38 μm)Large (38–60 μm)All neuronsDiI-labeledAll neuronsDiI-labeledAll neuronsDiI-labeledIB4-positive61% (280)85% (85)50% (280)58% (266)9% (280)4% (52)Capsaicin (C)57% (30)75% (20)47% (30)60% (20)30% (30)30% (10)Menthol (M)20% (50)30% (20)12% (50)20% (20)4% (50)10% (10)Icilin (I)14% (50)20% (20)8% (50)20% (20)0% (50)0% (10)C + M10% (50)15% (20)8% (50)15% (20)4% (50)10% (10)M + I6% (50)15% (20)6% (50)10% (20)0% (50)0% (10)C + I12% (50)20% (20)10% (50)15% (20)0% (50)0% (10)C + M + I8% (50)15% (20)6% (50)10% (20)0% (50)0% (10) Open table in a new tab Single Cell RT-PCR Analysis of Thermo-TRP Channel Expression by Dental Primary Afferent Neurons—We investigated using single cell RT-PCR whether dental primary afferent neurons would express TRPV1, TRPM8, and TRPA1, transmitting heat, cool, and cold sensation in sensory neurons (1Patapoutian A. Peier A.M. Story G.M. Viswanath V. Nat. Rev. Neurosci. 2003; 4: 529-539Crossref PubMed Scopus (639) Google Scholar, 13Clapham D.E. Nature. 2003; 426: 517-524Crossref PubMed Scopus (2164) Google Scholar). Among the dental primary afferent neurons (n = 55) randomly collected irrespective of soma size, it was found that 45% of identified dental primary afferent neurons expressed TRPV1, 13% expressed TRPM8, and 11% expressed TRPA1 (Fig. 1C). Some neurons expressed more than one TRP channel subunit (Fig. 1C). When we examined the expression of TTX-resistant sodium channel, NaV1.8, which is known to be restricted to nociceptors (25Lai J. Porreca F. Hunter J.C. Gold M.S. Annu. Rev. Pharmacol. Toxicol. 2004; 44: 371-397Crossref PubMed Scopus (285) Google Scholar), together with thermo-TRP channels, we found mRNA expression of NaV1.8 in 85% of these neurons, which were of small and medium sizes (Fig. 1C, panel b). These results suggested that dental primary afferent neurons with thermo-TRP channels might be associated with tooth pain. Ligands for Thermo-TRP Channels and Thermal Stimuli Increase Intracellular Calcium in Dental Primary Afferent Neurons—We examined the effects of capsaicin (a TRPV1 agonist), menthol (a TRPM8 agonist), or icilin (a TRPM8 and TRPA1 agonist) on [Ca2+]i as a screen for the presence of functional thermo-TRP channels in tooth pulp afferents, using ratiometric calcium imaging. The application of vehicle at the beginning of the experiment (i.e. 0.01% ethanol or Me2SOin 1 ml of balanced salt solution) did not alter [Ca2+]i (data not shown). However, as shown in Fig. 2 and Table 2, the subsequent application of thermo-TRP ligands clearly increased [Ca2+]i in subpopulations of neurons. To obtain the concentrations used in experiments, we confirmed the dose-response data (EC50, menthol, 85 ± 10.4 μm; icilin, 0.96 ± 0.2 μm, Fig. 2, A and B), which was similar to other previous reports (2Caterina M.J. Schumacher M.A. Tominaga M. Rosen T.A. Levine J.D. Julius D. Nature. 1997; 389: 816-824Crossref PubMed Scopus (7144) Google Scholar, 5McKemy D.D. Neuhausser W.M. Julius D. Nature. 2002; 416: 52-58Crossref PubMed Scopus (2011) Google Scholar, 26Chuang H.H. Neuhausser W.M. Julius D. Neuron. 2004; 43: 859-869Abstract Full Text Full Text PDF PubMed Scopus (273) Google Scholar). Measurement of [Ca2+]i in tooth pulp afferents showed increases evoked by capsaicin (1 μm: 60% of neurons, ratio changes 1.0 ± 0.2), menthol (1 mm: 20%, ratio changes 1.0 ± 0.2), and icilin (10 μm: 16%, ratio changes 0.9 ± 0.2) (Fig. 2, C-E, and Table 2). Several neurons responded to more than one ligand (capsaicin and menthol, 14% of neurons; menthol and icilin, 10%; capsaicin and icilin, 14%; capsaicin, menthol and icilin, 8%) (Fig. 2F and Table 2), indicating considerable co-localization of thermo-TRP channels in subpopulations of dental primary afferent neurons. To confirm that neurons expressing thermo-TRP channel are responsive to natural thermal stimulation that might cause pain in teeth, we then examined the effects of heat or cold stimulation on [Ca2+]i. When heated above 42 ± 0.7 °C, capsaicin-sensitive neurons clearly showed increase of [Ca2+]i (0.3 ± 0.1, n = 10) (Fig. 3, A and D). Likewise, menthol- and icilin-sensitive neurons showed increase of [Ca2+]i (0.3 ± 0.1, n = 8, Fig. 3, B and D) below 25 ± 1.7 °C, and icilin-sensitive neurons responded below 17 ± 0.5 °C (0.2 ± 0.1, n = 7, Fig. 3, C and D). However, neurons that failed to respond to menthol and icilin also have no cold responses (n = 5). These results strongly suggest that thermo-TRP channels expressed by dental primary afferent neurons might act as specific detectors, which are activated at specific temperature point, for natural nociceptive thermal stimulation applied to teeth. Ligands for Thermo-TRP Channels and Thermal Stimuli Activate Inward Currents in Dental Primary Afferent Neurons—To further support our hypothesis, we next examined whether the activation of thermo-TRP channels would produce inward currents at the holding potential of -60 mV. Capsaicin, menthol, and icilin induced inward currents of 4.5 ± 1.8 nA (n = 30), 0.45 ± 0.15 nA (n = 12), and 0.32 ± 0.15 nA (n = 7), respectively (Fig. 4, A-C). The currents produced by these agonists reversed polarity at ∼0 mV and showed outward rectification, indicating that these currents were produced by the opening of TRP-channels. This result agreed with other previous reports (2Caterina M.J. Schumacher M.A. Tominaga M. Rosen T.A. Levine J.D. Julius D. Nature. 1997; 389: 816-824Crossref PubMed Scopus (7144) Google Scholar, 5McKemy D.D. Neuhausser W.M. Julius D. Nature. 2002; 416: 52-58Crossref PubMed Scopus (2011) Google Scholar, 26Chuang H.H. Neuhausser W.M. Julius D. Neuron. 2004; 43: 859-869Abstract Full Text Full Text PDF PubMed Scopus (273) Google Scholar). Consistent with the results of calcium imaging, capsaicin-sensitive neurons also responded to heat (n = 9) and menthol-sensitive neurons were responsive to cold (n = 5, Fig. 4, D and E). To directly determine whether the responsiveness of dental primary afferent neurons to thermo-TRP ligands is associated with the expression of thermo-TRP channels, at the end of some electrophysiological recordings, the expression of TRP channels was determined by immunohistochemistry or single cell RT-PCR. In Fig. 5A, capsaicin- and menthol-sensitive dental primary afferent neuron (red) showed immunoreactivity of TRPV1 (green) and TRPM8 (blue). At single cell RT-PCR study, we confirmed the correlation between mRNA of each TRP channel and ligand-induced current. In Fig. 5B, capsaicin (panel a)-sensitive dental primary afferent expressed only TRPV1 mRNA, whereas icilin/capsaicin (panel b)- and menthol/capsaicin (panel c)-sensitive neurons expressed TRPA1/TRPV1 and TRPM8/TRPV1 mRNA, respectively. Taken together, this suggests that dental primary afferent neurons have TRP-channels as specific thermal detectors, which play an important role in the sensation of thermal stimuli.FIGURE 5Confocal laser microscopy and single cell RT-PCR of thermo-TRPs following whole cell recordings. A, capsaicin (1 μm) and menthol (1 mm) evoked currents at -60 mV. Immunohisto-chemistry of the cell recorded A shows the presence of DiI-labeled (a, red), TRPV1 (b, green), TRPM8 (c, blue); d is the merged image. B, single cell RT-PCR analysis following whole cell recording in three different neurons. Lanes a-c show single cell RT-PCR products obtained from intracellular contents of the cells shown in panels a-c, respectively. Note the precise correspondence between mRNA expressed and responsiveness to ligands. The control is obtained from pipettes that did not harvest cell contents but were submerged in bath solution.View Large Image Figure ViewerDownload Hi-res image Download (PPT) In the present study, we demonstrate that subfamilies of thermo-TRP channels such as TRPV1, TRPM8, and TRPA1 are expressed by dental primary afferent neurons and that responsiveness of individual tooth afferents to thermo-TRP ligands and temperature change is correlated with expression of thermo-TRP channels. Thus, we suggest that activation of thermo-TRP channels expressed by these neurons may initiate sensory signals that contribute to tooth pain by temperature stimuli. It has been hypothesized that stimulation of tooth pulp by any type of stimulus results only in a painful sensation (15Taddese A. Nah S.Y. McCleskey E.W. Science. 1995; 270: 1366-1369Crossref PubMed Scopus (133) Google Scholar, 16Cook S.P. Vulchanova L. Hargreaves K.M. Elde R. McCleskey E.W. Nature. 1997; 387: 505-508Crossref PubMed Scopus (396) Google Scholar, 27Fors U. Ahlquist M.L. Skagerwall R. Edwall L.G. Haegerstam G.A. Pain. 1984; 18: 397-408Abstract Full Text PDF PubMed Scopus (31) Google Scholar). This assumption leads many investigators to use dissociated trigeminal neurons, identified by retrograde labeling with DiI, as an in vitro model for the study of pain-sensing neurons (15Taddese A. Nah S.Y. McCleskey E.W. Science. 1995; 270: 1366-1369Crossref PubMed Scopus (133) Google Scholar, 16Cook S.P. Vulchanova L. Hargreaves K.M. Elde R. McCleskey E.W. Nature. 1997; 387: 505-508Crossref PubMed Scopus (396) Google Scholar). However, evidence of non-nociceptive neuron in tooth pulp has challenged this assumption so that the "pure pain" sensation of teeth became controversial (28Dong W.K. Chudler E.H. Martin R.F. Brain Res. 1985; 334: 389-395Crossref PubMed Scopus (98) Google Scholar). Thus, we first determined the proportion of "nociceptive" neurons among dental primary afferents. On the basis of neurochemical properties primary afferent neurons fall into two main classes. The first binds IB4 and expresses P2X3, c-RET, and NaV1.8 sodium channels. The second group is IB4-negative, contains calcitonin gene-related peptide and/or substance P, and expresses TrkA (29Hunt S.P. Mantyh P.W. Nat. Rev. Neurosci. 2001; 2: 83-91Crossref PubMed Scopus (470) Google Scholar). Our data obtained from IB4 staining revealed that a significant proportion of small primary afferent neurons were IB4-positive, whereas the large neurons were not (Fig. 1B). Single cell RT-PCR showed that most dental primary afferent neurons express NaV1.8 mRNA. These data strongly support the notion that the majority, but not all, of dental primary afferent neurons may be considered to be nociceptors. Stimuli that produce tooth pain include mechanical (toothbrush contact, instrument touch, and desiccation with air), chemical (citrus, sour, or sweet foods and beverages and acidic bacterial plaque by-products), and thermal (extremes of hot or cold food, liquids, or inhaled air). Thermal stimulation is often described as the most severe, and is widely used in dental clinic to test the vitality of the tooth pulp. Therefore, we focused in the present study on the molecular mechanisms that might underlie tooth pain caused by thermal stimulation. TRPV1 is a Ca2+-permeable channel activated by capsaicin and temperatures higher than 42 °C, and it is highly expressed in a subset of peptidergic and IB4-binding nociceptive neurons (1Patapoutian A. Peier A.M. Story G.M. Viswanath V. Nat. Rev. Neurosci. 2003; 4: 529-539Crossref PubMed Scopus (639) Google Scholar, 2Caterina M.J. Schumacher M.A. Tominaga M. Rosen T.A. Levine J.D. Julius D. Nature. 1997; 389: 816-824Crossref PubMed Scopus (7144) Google Scholar). By single cell RT-PCR analysis, we found that TRPV1 is highly expressed in dental primary afferent neurons (Fig. 1C), consistent with a previous report (23Chaudhary P. Martenson M.E. Baumann T.K. J. Dent. Res. 2001; 80: 1518-1523Crossref PubMed Scopus (56) Google Scholar, 30Morgan C.R. Rodd H.D. Clayton N. Davis J.B. Boissonade F.M. J. Orofac. Pain. 2005; 19: 248-260PubMed Google Scholar). Ratiometric calcium imaging showed that [Ca2+]i was increased by capsaicin as well as by heat stimulation (Figs. 2C and 3A), indicating clear functional responses attributable to TRPV1. Consistent with these data, heat-evoked currents were found in capsaicin-sensitive neurons (Fig. 4, A and D), which were similar to the responses evoked by heterologous expression of TRPV1 (18Yang B.H. Piao Z.G. Kim Y.B. Lee C.H. Lee J.K. Park K. Kim J.S. Oh S.B. J. Dent. Res. 2003; 82: 781-785Crossref PubMed Scopus (159) Google Scholar). Furthermore, we observed expression of TRPV1 in the same neurons that gave capsaicin-evoked currents (Fig. 5). Thus, we propose that TRPV1 might be involved in nociceptive heat sensation in dental primary afferents. TRPM8 was originally identified as a cold and menthol receptor (CMR1) (3Peier A.M. Moqrich A. Hergarden A.C. Reeve A.J. Andersson D.A. Story G.M. Earley T.J. Dragoni I. McIntyre P. Bevan S. Patapoutian A. Cell. 2002; 108: 705-715Abstract Full Text Full Text PDF PubMed Scopus (1759) Google Scholar, 5McKemy D.D. Neuhausser W.M. Julius D. Nature. 2002; 416: 52-58Crossref PubMed Scopus (2011) Google Scholar); it is activated by menthol and cooling (8-25 °C). Because the temperature ranges that activate TRPM8 are similar to those that activate native innocuous cold-sensitive fibers, and because pain markers such as calcitonin gene-related peptide, substance P, TRPV1, or IB4 do not co-localize with TRPM8, it has been suggested that TRPM8 has physiological function for innocuous thermosensation (5McKemy D.D. Neuhausser W.M. Julius D. Nature. 2002; 416: 52-58Crossref PubMed Scopus (2011) Google Scholar). However, our findings, that TRPM8 is expressed by a subset of pain and temperature-sensing neurons such as TrkA-positive small diameter neurons and activated by the noxious cold range of temperatures (3Peier A.M. Moqrich A. Hergarden A.C. Reeve A.J. Andersson D.A. Story G.M. Earley T.J. Dragoni I. McIntyre P. Bevan S. Patapoutian A. Cell. 2002; 108: 705-715Abstract Full Text Full Text PDF PubMed Scopus (1759) Google Scholar, 31Tominaga M. Caterina M.J. J. Neurobiol. 2004; 61: 3-12Crossref PubMed Scopus (393) Google Scholar, 32McKemy D.D. Mol. Pain. 2005; 1: 16Crossref PubMed Scopus (215) Google Scholar), led us to re-examine the possibility of involvement of TRPM8 in cold sensation. A subset of neurons that expressed TRPM8 were found (Fig. 1C), and menthol and cold stimulation not only increased [Ca2+]i (Figs. 2D and 3B) but also evoked inward currents (Fig. 4B). The percentage of menthol-sensitive neurons in the trigeminal ganglion was similar to that previously reported (5McKemy D.D. Neuhausser W.M. Julius D. Nature. 2002; 416: 52-58Crossref PubMed Scopus (2011) Google Scholar, 33Abe J. Hosokawa H. Okazawa M. Kandachi M. Sawada Y. Yamanaka K. Matsumura K. Kobayashi S. Brain Res. Mol. Brain Res. 2005; 136: 91-98Crossref PubMed Scopus (126) Google Scholar, 34Nealen M.L. Gold M.S. Thut P.D. Caterina M.J. J. Neurophysiol. 2003; 90: 515-520Crossref PubMed Scopus (143) Google Scholar). Although it was originally suggested that TRPM8 does not co-exist with TRPV1 (3Peier A.M. Moqrich A. Hergarden A.C. Reeve A.J. Andersson D.A. Story G.M. Earley T.J. Dragoni I. McIntyre P. Bevan S. Patapoutian A. Cell. 2002; 108: 705-715Abstract Full Text Full Text PDF PubMed Scopus (1759) Google Scholar), other reports indicated colocalization of TRPM8 and TRPV1 (33Abe J. Hosokawa H. Okazawa M. Kandachi M. Sawada Y. Yamanaka K. Matsumura K. Kobayashi S. Brain Res. Mol. Brain Res. 2005; 136: 91-98Crossref PubMed Scopus (126) Google Scholar, 35Babes A. Zorzon D. Reid G. Eur. J. Neurosci. 2004; 20: 2276-2282Crossref PubMed Scopus (143) Google Scholar, 36Okazawa M. Inoue W. Hori A. Hosokawa H. Matsumura K. Kobayashi S. Neurosci. Lett. 2004; 359: 33-36Crossref PubMed Scopus (81) Google Scholar). In agreement with these latter reports, we also found TRPM8 to be co-localized with TRPV1 in some primary afferent neurons (Figs. 1C and 5B). Moreover, some neurons were responsive to both menthol and capsaicin (Fig. 5, A and C), and sometimes to icilin as well (Fig. 2F). Taken together, our data suggested the potential role of TRPM8 channels in thermosensation of dental afferents. TRPA1 is a more distantly related TRP channel, homologous to Drosophila Painless (37Goodman M.B. Trends Neurosci. 2003; 26: 643-645Abstract Full Text Full Text PDF PubMed Scopus (13) Google Scholar, 38Tracey Jr., W.D. Wilson R.I. Laurent G. Benzer S. Cell. 2003; 113: 261-273Abstract Full Text Full Text PDF PubMed Scopus (540) Google Scholar) and activated by noxious cold temperature (<∼17 °C): this temperature is reported as being painfully cold by humans. TRPA1 is also activated by icilin, but not by menthol. Unlike TRPM8, TRPA1 is expressed in a subset of sensory neurons that express the nociceptive markers such as calcitonin gene-related peptide and substance P (4Story G.M. Peier A.M. Reeve A.J. Eid S.R. Mosbacher J. Hricik T.R. Earley T.J. Hergarden A.C. Andersson D.A. Hwang S.W. McIntyre P. Jegla T. Bevan S. Patapoutian A. Cell. 2003; 112: 819-829Abstract Full Text Full Text PDF PubMed Scopus (1970) Google Scholar). We also found the expression of TRPA1 in a subset of dental primary afferents (Fig. 1C), suggesting a potential action as a transducer of cold sensation in teeth. The percentage of TRPA1-expressing cells was similar to that of total trigeminal ganglion previously reported (4Story G.M. Peier A.M. Reeve A.J. Eid S.R. Mosbacher J. Hricik T.R. Earley T.J. Hergarden A.C. Andersson D.A. Hwang S.W. McIntyre P. Jegla T. Bevan S. Patapoutian A. Cell. 2003; 112: 819-829Abstract Full Text Full Text PDF PubMed Scopus (1970) Google Scholar). It is interesting to find that some neurons responded to icilin alone (Figs. 2E and 3C), whereas other neurons responded to both icilin and menthol (Figs. 2D, 2F, and 3B). Based on the specificity of the ligands, it is likely that individual neurons can express either TRPA1 or TRPM8, respectively. TRPA1 is also known to be expressed in a subset of sensory neurons that express the noxious-heat receptor, TRPV1 (4Story G.M. Peier A.M. Reeve A.J. Eid S.R. Mosbacher J. Hricik T.R. Earley T.J. Hergarden A.C. Andersson D.A. Hwang S.W. McIntyre P. Jegla T. Bevan S. Patapoutian A. Cell. 2003; 112: 819-829Abstract Full Text Full Text PDF PubMed Scopus (1970) Google Scholar). We also found that TRPA1 and TRPV1 were expressed together in a subset of dental primary afferent neurons (Figs. 1C and 5C); these might act as polymodal nociceptive neurons that respond to both noxious heat and cold. The co-expression of subtypes of thermo-TRP channels in dental primary afferent neurons provide a likely explanation why pain is the sensation mostly perceived in teeth, irrespective of the sub-modality of thermal stimuli. Given that the sensation perceived from teeth by cold and hot stimuli is not always identical, the cellular and molecular mechanisms underlying thermal and pain sensations of teeth is likely to be more complex, rather than simply induced by the activation of molecules such as thermo-TRPs in dental primary afferents, which are highly specialized to detect specific ranges of temperature (1Patapoutian A. Peier A.M. Story G.M. Viswanath V. Nat. Rev. Neurosci. 2003; 4: 529-539Crossref PubMed Scopus (639) Google Scholar). Odontoblasts, which have a process extending into the dentin, can also contribute to nociceptive and non-nociceptive sensory processing in teeth (39Magloire H. Lesage F. Couble M.L. Lazdunski M. Bleicher F. J. Dent. Res. 2003; 82: 542-545Crossref PubMed Scopus (59) Google Scholar). Non-TRP channels such as TREK-1 (a member of a family of mammalian two-pore domain K+channel) might also be involved in thermosensation (1Patapoutian A. Peier A.M. Story G.M. Viswanath V. Nat. Rev. Neurosci. 2003; 4: 529-539Crossref PubMed Scopus (639) Google Scholar) and have been demonstrated to be expressed by odontoblasts (39Magloire H. Lesage F. Couble M.L. Lazdunski M. Bleicher F. J. Dent. Res. 2003; 82: 542-545Crossref PubMed Scopus (59) Google Scholar). Odontoblasts also express subfamilies of thermo-TRP channels. 3C.-K. Park, M. S. Kim, Z. Fang, H. Y. Li, S. J. Jung, S.-Y. Choi, S. J. Lee, K. Park, J. S. Kim, and S. B. Oh, unpublished data. From the observation that various stimuli, including cold, heat, acids, pressure, chemicals, and high osmotic solutions, create the movement of fluid within the dentin tubules, Brännström proposed that any kinds of stimulus that cause the fluid within the tubules to flow inward or outward create a mechanical disturbance or cellular perturbation, thereby exciting the nerves in the tooth (10Brannstrom M. Linden L.A. Astrom A. Caries Res. 1967; 1: 310-317Crossref PubMed Scopus (242) Google Scholar, 11Brannstrom M. Astrom A. Int. Dent. J. 1972; 22: 219-227PubMed Google Scholar). If this is the case, dental primary afferents are also likely to express low threshold mechanoreceptors with high sensitivity. Our ongoing work on these two possibilities will also help us further understand the detailed cellular and molecular mechanisms underlying tooth pain. In conclusion, our results support a potential role of thermo-TRP channels in the transduction of tooth pain. Thermo-TRP channels are expressed by dental primary afferent neurons, and the neurons are activated by the appropriate thermal stimuli. Given that rational treatment of pain requires identification of pain mechanisms as a target of drug therapy, thermo-TRP channels might constitute a new distinctive target for the development of therapeutic intervention for tooth pain. We thank Dr. Makoto Tominaga of the National Institutes of Natural Sciences, Japan, for his kind gift of TRPM8 antibody.
Secretion of proinflammatory cytokines by lipopolysaccharide (LPS) activated vascular endothelial cells (VECs) contributes substantially to the pathogenesis of several inflammatory diseases such as atherosclerosis and septic shock. However, the mechanisms involved in this process are not well understood. Here, we investigated the role of phosphatidylcholine-specific phospholipase C (PC-PLC) in LPS-induced IL-8 and MCP-1 production in VECs. The results showed that LPS elevated the level of PC-PLC and the production of IL-8 and MCP-1 in Human umbilical vein vascular endothelial cells (HUVECs). Blocking the function of PC-PLC by exploiting the neutralization antibody of PC-PLC or tricyclodecan-9-yl-xanthogenate (D609), an inhibitor of PC-PLC, significantly inhibited LPS-induced production of IL-8 and MCP-1 in HUVECs. Furthermore, the in vivo experimental results showed that the levels of PC-PLC, IL-8, and MCP-1 in the aortic endothelium and serum were increased in mice injected with LPS. The increased levels of these molecules were also inhibited by the treatment with D609. The data suggested that blocking PC-PLC function significantly inhibited LPS-induced IL-8 and MCP-1 production in cultured HUVECs and in vivo. PC-PLC might be a potential target for therapy in inflammation associated-diseases such as atherosclerosis.
Eugenol is widely used in dentistry to relieve pain. We have recently demonstrated voltage-gated Na+ and Ca2+ channels as molecular targets for its analgesic effects, and hypothesized that eugenol acts on P2X3, another pain receptor expressed in trigeminal ganglion (TG), and tested the effects of eugenol by whole-cell patch clamp and Ca2+ imaging techniques. In the present study, we investigated whether eugenol would modulate 5'-triphosphate (ATP)-induced currents in rat TG neurons and P2×3-expressing human embryonic kidney (HEK) 293 cells. ATP-induced currents in TG neurons exhibited electrophysiological properties similar to those in HEK293 cells, and both ATP- and α, β-meATP-induced currents in TG neurons were effectively blocked by TNP-ATP, suggesting that P2×3 mediates the majority of ATP-induced currents in TG neurons. Eugenol inhibited ATP-induced currents in both capsaicin-sensitive and capsaicin-insensitive TG neurons with similar extent, and most ATP-responsive neurons were IB4-positive. Eugenol inhibited not only Ca2+ transients evoked by α, β-meATP, the selective P2×3 agonist, in capsaicin-insensitive TG neurons, but also ATP-induced currents in P2×3-expressing HEK293 cells without co-expression of transient receptor potential vanilloid 1 (TRPV1). We suggest, therefore, that eugenol inhibits P2×3 currents in a TRPV1-independent manner, which contributes to its analgesic effect.
Ca(v)2.3 calcium channels play an important role in pain transmission in peripheral sensory neurons. Six Ca(v)2.3 isoforms resulting from different combinations of three inserts (inserts I and II in the II-III loop and insert III in the carboxyl-terminal region) have been identified in different mammalian tissues. To date, however, Ca(v)2.3 isoforms unique to primary sensory neurons have not been identified. In this study, we determined Ca(v)2.3 isoforms expressed in the rat trigeminal ganglion neurons. Whole tissue reverse transcription (RT)-PCR analyses revealed that only two isoforms, Ca(v)2.3a and Ca(v)2.3e, are present in TG neurons. Using single cell RT-PCR, we found that Ca(v)2.3e is the major isoform, whereas Ca(v)2.3e expression is highly restricted to small (<16 mum) isolectin B4-negative and tyrosine kinase A-positive neurons. Ca(v)2.3e was also preferentially detected in neurons expressing the nociceptive marker, transient receptor potential vanilloid 1. Single cell RT-PCR following calcium imaging and whole-cell patch clamp recordings provided evidence of an association between an R-type calcium channel component and Ca(v)2.3e expression. Our results suggest that Ca(v)2.3e in sensory neurons may be a potential target for the treatment of pain.
'%3e%3cg id='b'%3e%3cpath id='a' stroke='%23000' stroke-width='2' d='M-6-25H6m-12 3H6m-12 3H6'/%3e%3cuse xlink:href='%23a' y='44'/%3e%3c/g%3e%3cpath stroke='%23fff' d='M0 17v10'/%3e%3ccircle r='12' fill='%23cd2e3a'/%3e%3cpath fill='%230047a0' d='M0-12A6 6 0 0 0 0 0a6 6 0 0 1 0 12 12 12 0 0 1 0-24z'/%3e%3c/g%3e%3cg transform='rotate(-123.69)'%3e%3cuse xlink:href='%23b'/%3e%3cpath stroke='%23fff' d='M0-23.5v3M0 17v3.5m0 3v3'/%3e%3c/g%3e%3c/svg%3e)
'/%3e%3cuse xlink:href='%23a' transform='rotate(23.036 .093 25.536)'/%3e%3cuse xlink:href='%23a' transform='rotate(45.87 1.273 16.18)'/%3e%3cuse xlink:href='%23a' transform='rotate(69.945 .996 12.078)'/%3e%3cuse xlink:href='%23a' transform='rotate(20.66 -19.689 31.932)'/%3e%3c/svg%3e)