Background Children and adolescents, who represent a biologically vulnerable population, are major victims of environmental exposure and often prioritized in environmental health policy. Objectives Korea Environmental Health Survey in Children (KorEHS-C) (III) purposed to collect a representative data of children and adolescents for monitoring environmental exposure and related health status on a national level. Materials and Methods The sampling plan was established by stratifying school-age children and adolescents by school year and region. A study for 1817 children and adolescents aged 6 to 18 years in elementary, middle and high schools were recruited from the all regions. Selected exposure biomarkers, i.e., lead(µg/?), mercury(µg/l) in blood and cadmium (µg/g creatinine) in urine were analyzed. Statistical analyses were weighted using the KorEHS-C survey weights generated by Statistics Korea. Results The geometric means (upper 95%) of the blood lead, mercury and urinary cadmium levels were 1.15 (2.11) µg/?, 1.92 (3.77) µg/l and 0.26 (0.55) µg/g creatinine, respectively. Within samples we found that levels of lead in Korean children and adolescents were significantly higher than subjects from Canada and the US. However, in German studies levels were shown to be lower in comparison (table 1). The levels of mercury and cadmium were significantly higher than subjects from Canada, Germany and the US (table 1). Conclusion Our study suggests that developing policies to reduce exposure to hazardous materials for the protection of the health of Korean children and adolescents are needed.
Background: A variety of imaging modalities are currently used for the preoperative evaluation of cartilage tumors. Although the anatomic details of the lesions are demonstrated well on computerized tomography and magnetic resonance images, those studies yield little information about the biologic activity of the tumors. In this study, we investigated the glucose metabolism of cartilage tumors measured by positron emission tomography and its correlation with histopathologic grades. Methods: Thirty-five biopsy-proven cartilaginous tumors in twenty-seven patients were studied with plain radiographs, bone-scanning, magnetic resonance imaging, and positron emission tomography. The glucose metabolism in these cartilaginous tumors was measured quantitatively by calculating the maximal standardized uptake value of the region of interest. This value was then correlated with histopathologic grade, tumor size, recurrence, and metastasis. Results: There were thirteen benign bone tumors, twelve grade-I chondrosarcomas, and ten high-grade (grade-II or III) chondrosarcomas. The mean maximal standard uptake values were 1.147 ± 0.751 in the benign tumors, 0.898 ± 0.908 in the grade-I chondrosarcomas, and 6.903 ± 5.581 in the high-grade chondrosarcomas. There was no significant difference in these values between the benign cartilage tumors and the grade-I chondrosarcomas (p > 0.05). However, there was a significant difference between the low-grade (benign and grade-I) and high-grade chondrosarcomas (p = 0.009). Metastasis, but not tumor size or recurrence, was associated with a higher standard uptake value (p = 0.031). Two large pelvic grade-I chondrosarcomas demonstrated no radioisotope uptake on bone-scanning or on positron emission tomography. Positron emission tomography demonstrated grade-II and III metastatic lesions in the lung and other anatomic locations. When the cutoff for the standardized uptake value was set at 2.3 for grade-II or III chondrosarcomas, the positive predictive value was 0.82 (95% confidence interval, 0.48 to 0.97) and the negative predictive value was 0.96 (95% confidence interval, 0.77 to 1.00). Conclusions: Grade-II and III chondrosarcomas have a higher glucose metabolism than do low-grade cartilage tumors. However, the measurement of glucose metabolism by positron emission tomography alone cannot distinguish between benign and grade-I malignant cartilaginous tumors. It is important to understand the advantages and disadvantages of imaging modalities for accurate interpretation of results. Although positron emission tomography has limitations, it may be useful for predicting high-grade chondrosarcomas. Level of Evidence: Diagnostic study, Level II-1 (development of diagnostic criteria on basis of consecutive patients [with universally applied reference "gold" standard]). See Instructions to Authors for a complete description of levels of evidence.
To clarify the role of calpain in the receptor activator of NF-κB ligand (RANKL)-supported osteoclastogenesis, RANKL-induced calpain activation was examined by using murine RAW 264.7 cells and bone marrow-derived monocyte/macrophage progenitors. We found that calpain activity increased in response to RANKL in both cell types based on α-spectrinolysis and that μ-calpain, rather than m-calpain, was activated during RANKL-supported osteoclastogenesis in RAW 264.7 cells. Overexpression of μ-calpain clearly augmented RANKL-supported osteoclastogenesis in RAW 264.7 cells, thereby implicating its pivotal role in this process. Cell-permeable calpain inhibitors, including calpastatin and calpeptin, were sufficient to suppress RANKL-supported osteoclastogenesis based on decreased expression of the osteoclastogenic marker, matrix metalloproteinase 9, and the generation of tartrate-resistant acid phosphatase-positive multinucleated cells in both cell types. Calpain inhibitors suppressed NF-κB activation via inhibition of the cleavage of inhibitor of NF-κB(IκBα)in RAW 264.7 cells. Taken together, our findings suggest that μ-calpain is essential to the regulation of RANKL-supported osteoclastogenesis via NF-κB activation. To clarify the role of calpain in the receptor activator of NF-κB ligand (RANKL)-supported osteoclastogenesis, RANKL-induced calpain activation was examined by using murine RAW 264.7 cells and bone marrow-derived monocyte/macrophage progenitors. We found that calpain activity increased in response to RANKL in both cell types based on α-spectrinolysis and that μ-calpain, rather than m-calpain, was activated during RANKL-supported osteoclastogenesis in RAW 264.7 cells. Overexpression of μ-calpain clearly augmented RANKL-supported osteoclastogenesis in RAW 264.7 cells, thereby implicating its pivotal role in this process. Cell-permeable calpain inhibitors, including calpastatin and calpeptin, were sufficient to suppress RANKL-supported osteoclastogenesis based on decreased expression of the osteoclastogenic marker, matrix metalloproteinase 9, and the generation of tartrate-resistant acid phosphatase-positive multinucleated cells in both cell types. Calpain inhibitors suppressed NF-κB activation via inhibition of the cleavage of inhibitor of NF-κB(IκBα)in RAW 264.7 cells. Taken together, our findings suggest that μ-calpain is essential to the regulation of RANKL-supported osteoclastogenesis via NF-κB activation. Bone is a specialized organ that provides invaluable benefits such as support, locomotion, bone marrow, electrolytes, and protection of internal organs. Bone remodels in a constant manner throughout the life span, and its homeostasis is delicately maintained via bone resorption by osteoclasts and bone formation by osteoblasts (1Teitelbaum S.L. Ross F.P. Nat. Rev. Genet. 2003; 4: 638-649Crossref PubMed Scopus (1289) Google Scholar, 2Teitelbaum S.L. Ross F.P. Science. 2000; 289: 1504-1508Crossref PubMed Scopus (3007) Google Scholar). Hence, the balancing of these two processes is a necessary prerequisite to the maintenance of normal bone condition. On the other hand, unbalanced bone homeostasis may lead to severe bone defects, such as osteoporosis or osteopetrosis.Osteoclasts are multinucleated cells, derived from hematopoietic myeloid precursors of monocyte/macrophage lineage, which express the receptor activator of NF-κB (RANK). 1The abbreviations used are: RANK, receptor activator of NF-κB; RANKL, receptor activator of NF-κB ligand; BMMs, bone marrow-derived monocyte/macrophages; TRAP, tartrate-resistant acid phosphatase; TNF, tumor necrosis factor; IL, interleukin; FBS, fetal bovine serum; BisTris, 2-[bis(2-hydroxyethyl)amino]-2-(hydroxymethyl)propane-1,3-diol; SEAP, secreted alkaline phosphatase; MMP, matrix metalloproteinase; M-CSF, macrophage colony-stimulating factor; RT, reverse transcription; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.1The abbreviations used are: RANK, receptor activator of NF-κB; RANKL, receptor activator of NF-κB ligand; BMMs, bone marrow-derived monocyte/macrophages; TRAP, tartrate-resistant acid phosphatase; TNF, tumor necrosis factor; IL, interleukin; FBS, fetal bovine serum; BisTris, 2-[bis(2-hydroxyethyl)amino]-2-(hydroxymethyl)propane-1,3-diol; SEAP, secreted alkaline phosphatase; MMP, matrix metalloproteinase; M-CSF, macrophage colony-stimulating factor; RT, reverse transcription; GAPDH, glyceraldehyde-3-phosphate dehydrogenase. These cells are tightly regulated by systemic or local factors, such as RANKL, which is generated by osteoblasts and bone marrow stromal cells in response to various stimuli, including vitamin D3, parathyroid hormone, TNF-α, thyroid hormone, lipopolysaccaride, IL-1, IL-11, histamine, fibroblast growth factor-2, insulin-like growth factor-1, and CpGpDNA (3Lee S.K. Lorenzo J.A. Endocrinology. 1999; 140: 3552-3561Crossref PubMed Google Scholar, 4Hofbauer L.C. Lacey D.L. Dunstan C.R. Spelsberg T.C. Riggs B.L. Khosla S. Bone. 1999; 25: 255-259Crossref PubMed Scopus (541) Google Scholar, 5Li X. Pilbeam C.C. Pan L. Breyer R.M. Raisz L.G. Bone. 2002; 30: 567-573Crossref PubMed Scopus (84) Google Scholar, 6Chung H. Kang Y.S. Hwang C.S. Moon I.K. Yim C.H. Choi K.H. Han K.O. Jang H.C. Yoon H.K. Han I.K. J. Korean Med. Sci. 2001; 16: 769-773Crossref PubMed Scopus (10) Google Scholar, 7Deyama Y. Kikuiri T. Ohnishi G. Feng Y. Takeyama S. Hatta M. Yoshimura Y. Suzuki K. Biochem. Biophys. Res. Commun. 2002; 298: 240-246Crossref PubMed Scopus (33) Google Scholar, 8Chikazu D. Katagiri M. Ogasawara T. Ogata N. Shimoaka T. Takato T. Nakamura K. Kawaguchi H. J. Bone Miner. Res. 2001; 16: 2074-2081Crossref PubMed Scopus (66) Google Scholar, 9Rubin J. Ackert-Bicknell C.L. Zhu L. Fan X. Murphy T.C. Nanes M.S. Marcus R. Holloway L. Beamer W.G. Rosen C.J. J. Clin. Endocrinol. Metab. 2002; 87: 4273-4279Crossref PubMed Scopus (143) Google Scholar).Interaction between RANKL and RANK initiates various signaling pathways by recruiting TNF receptor-associated factors 1-3, 5, and 6. TNF receptor-associated factor plays a key role in mediating various extracellular signals that lead to osteoclastogenesis and eventually bone resorption (10Wong B.R. Josien R. Lee S.Y. Vologodskaia M. Steinman R.M. Choi Y. J. Biol. Chem. 1998; 273: 28355-28359Abstract Full Text Full Text PDF PubMed Scopus (405) Google Scholar, 11Armstrong A.P. Tometsko M.E. Glaccum M. Sutherland C.L. Cosman D. Dougall W.C. J. Biol. Chem. 2002; 277: 44347-44356Abstract Full Text Full Text PDF PubMed Scopus (192) Google Scholar). Previous studies have shown that knock-out mice devoid of either the RANKL gene or its receptor RANK gene show severe osteopetrosis, thereby highlighting their importance in osteoclastogenesis (12Kong Y.Y. Yoshida H. Sarosi I. Tan H.L. Timms E. Capparelli C. Morony S. Oliveira-dos-Santos A.J. Van G. Itie A. Khoo W. Wake-ham A. Dunstan C.R. Lacey D.L. Mak T.W. Boyle W.J. Penninger J.M. Nature. 1999; 397: 315-323Crossref PubMed Scopus (2834) Google Scholar, 13Li J. Sarosi I. Yan X.Q. Morony S. Capparelli C. Tan H.L. McCabe S. Elliott R. Scully S. Van G. Kaufman S. Juan S.C. Sun Y. Tarpley J. Martin L. Christensen K. McCabe J. Kostenuik P. Hsu H. Fletcher F. Dunstan C.R. Lacey D.L. Boyle W.J. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 1566-1571Crossref PubMed Scopus (936) Google Scholar).It has been suggested that calpain, a calcium-dependent intracellular cysteine protease, plays a major role in various cellular processes in mammals, such as signal transduction, cell growth, differentiation and fusion, apoptosis, necrosis, etc. (14Goll D.E. Thompson V.F. Li H. Wei W. Cong J. Physiol. Rev. 2003; 83: 731-801Crossref PubMed Scopus (2329) Google Scholar). Calpain is composed of a superfamily with 14 known members and can be divided into ubiquitous and tissue-specific isozymes in mammals (15Huang Y. Wang K.K. Trends Mol. Med. 2001; 78: 355-362Abstract Full Text Full Text PDF Scopus (404) Google Scholar). Structurally, ubiquitous μ- and m-calpains are heterodimers with an identical small subunit (30K) and different large subunits (80K) sharing 55-65% similarity (16Sorimachi H. Suzuki K. J. Biochem. (Tokyo). 2001; 129: 653-664Crossref PubMed Scopus (246) Google Scholar).Calpain executes limited proteolysis of its own substrates and is considered a modulator of various intracellular signaling pathways (14Goll D.E. Thompson V.F. Li H. Wei W. Cong J. Physiol. Rev. 2003; 83: 731-801Crossref PubMed Scopus (2329) Google Scholar, 15Huang Y. Wang K.K. Trends Mol. Med. 2001; 78: 355-362Abstract Full Text Full Text PDF Scopus (404) Google Scholar). For instance, calpain is known to degrade IκBα, c-Jun, and c-Fos in vitro, all of which are essential molecular players in osteoclastogenesis (17Milligan S.A. Owens M.W. Grisham M.B. Arch. Biochem. Biophys. 1996; 335: 388-395Crossref PubMed Scopus (55) Google Scholar, 18Pariat M. Salvat C. Bebien M. Brockly F. Altieri E. Carillo S. Jariel-Encontre I. Piechaczyk M. Biochem. J. 2000; 345: 129-138Crossref PubMed Google Scholar, 19Jariel-Encontre I. Salvat C. Steff A.M. Pariat M. Acquaviva C. Furstoss O. Piechaczyk M. Mol. Biol. Rep. 1997; 24: 51-56Crossref PubMed Google Scholar). Therefore, calpain may play a master role in the regulation of osteoclastogenesis through limited proteolysis of these molecules.Uncontrolled calpain activity resulting from altered calcium homeostasis often leads to irreversible damage to cells, as exemplified in myocardial infarction, stroke, and brain ischemia (20Wang K.K. Trends Neurosci. 2000; 23: 20-26Abstract Full Text Full Text PDF PubMed Scopus (805) Google Scholar, 21Kunimatsu M. Tada T. Narita Y. Ozaki Y. Liu Z.Q. Shearer T.R. Sasaki M. Cardiovasc. Pathol. 1999; 8: 7-15Crossref PubMed Scopus (17) Google Scholar, 22Vanderklish P.W. Bahr B.A. Int. J. Exp. Pathol. 2000; 81: 323-339Crossref PubMed Scopus (174) Google Scholar, 23Rami A. Neurobiol. Dis. 2003; 13: 75-88Crossref PubMed Scopus (148) Google Scholar). Therefore, it is tightly regulated by an endogenous inhibitor, calpastatin (24Wendt A. Thompson V.F. Goll D.E. Biol. Chem. 2004; 385: 465-472Crossref PubMed Scopus (175) Google Scholar). Although it has been suggested that the calpain-calpastatin system is involved in pre-osteoblastic proliferation and differentiation (25Murray S.S. Grisanti M.S. Bentley G.V. Kahn A.J. Urist M.R. Murray E.J. Exp. Cell Res. 1997; 233: 297-309Crossref PubMed Scopus (44) Google Scholar), its function in the regulation of RANKL-supported osteoclastogenesis remains unclear. To date, it has been only weakly suggested to play a part in implant particle-induced osteoclastogenesis (26Clohisy J.C. Hirayama T. Frazier E. Han S.K. Abu-Amer Y. J. Orthop. Res. 2004; 22: 13-20Crossref PubMed Scopus (96) Google Scholar).Clarifying the role of calpain in RANKL-supported osteoclastogenesis may shed light on the development of a novel therapeutic intervention(s) that can arrest bone resorption. In the present study, the role of calpain in the regulation of RANKL-supported osteoclastogenesis was therefore examined by using a murine RAW 264.7 cellular system and/or bone marrow-derived macrophage/monocyte progenitors capable of differentiating into multinucleated osteoclasts in the presence of RANKL and/or M-CSF. Here we report that μ-calpain regulates RANKL-supported osteoclastogenesis. It should be noted that this is the first report to demonstrate the role of calpain in the regulation of RANKL/RANK signaling.MATERIALS AND METHODSCell Culture—Murine macrophage-like RAW 264.7 cells were purchased from the American Type Culture Collection (ATCC) (Manassas, VA). RAW 264.7 cells were maintained in Dulbecco's modified Eagle's medium, also purchased from the ATCC, containing sodium bicarbonate (1.5 g/liter), l-glutamine (4 mm), glucose (4.5 g/liter), penicillin (100 units/ml), streptomycin (0.1 mg/ml), and 10% fetal bovine serum (FBS) (Invitrogen). Bone marrow monocyte/macrophage (BMMs) lineage progenitors were collected from the femur and tibia of 4-5-week-old C57BL/6J mice and cultured in α-minimum Eagle's medium supplemented with l-glutamine (4 mm), penicillin (100 units/ml), streptomycin (0.1 mg/ml), murine M-CSF (10 ng/ml) (R & D Systems, Minneapolis, MN), and 20% heat-inactivated FBS (Invitrogen). Cells were cultured in 6-well plates and incubated at 37 °C in a humidified atmosphere of 5% CO2. Culture media were changed every other day.In Vitro Osteoclastogenesis—RAW 264.7 cells were cultured in 6-well plates for 7 days in a medium containing RANKL (20 ng/ml) (R & D Systems). RANKL (20 ng/ml) was also added to BMMs (2 × 105) cultured in 6-well plates with α-minimum Eagle's medium containing M-CSF (10 ng/ml). To determine whether calpain is involved in RANKL-supported osteoclastogenesis, media containing cell-permeable calpain inhibitors, including calpastatin peptide (1 μm) and calpeptin (5 μm) (Calbiochem), were added to each well in the presence of RANKL and/or M-CSF. On day 7, TRAP staining was performed to evaluate TRAP(+)-multinucleated osteoclast formation. Protein was also extracted to compare the expression of osteoclastogenic markers on immunoblotting as described later. For statistical evaluation, each experiment was repeated four times independently.Plasmids and Transfection—Human full-length μ-calpain cDNA in pSRD (1.5 μg) and human calpain small subunit cDNA in pcDNA3.1 (1.5 μg) (kindly provided by Dr. Hiroyuki Sorimachi, University of Tokyo, Japan) were co-transfected into RAW 264.7 cells (5 × 105)in the presence or absence of RANKL using Superfect (Qiagen, Valencia, CA). To examine whether calpain augments RANKL-supported osteoclastogenesis, RAW 264.7 cells were pre-cultured with media containing RANKL (20 ng/ml) for 2 days. On day 3, each cDNA was transfected to evaluate augmentation of osteoclastogenesis by calpain. Four days after transfection, cells were stained to evaluate TRAP(+)-multinucleated osteoclast formation. To compare the expression of other osteoclastogenic markers, protein was extracted. For statistical evaluation, each experiment was repeated six times independently.Mouse TRAP Enzyme-linked Immunosorbent Assay—The amount and activity of tartrate-resistant acid phosphatase form 5b (TRAP5b) in the conditioned media were analyzed with a mouse TRAP assay kit (SBA Sciences, Turku, Finland) according to the manufacturer's instructions. Briefly, 100 μl of standard TRAP and conditioned medium were added to each well pre-coated with monoclonal antibody against mouse TRAP5b. Then 25 μl of releasing agent was added to each well and incubated for 1 h at room temperature on a horizontal orbital microplate shaker at 950 rpm. Each well was washed three times with 300 μl of 1× washing buffer. After washing, 100 μl of substrate solution was added to each well, mixed thoroughly, and incubated for 2 h at 37 °C. Finally, 25 μl of stop solution was added to each well, and the absorbance was measured at 405 nm. For statistical evaluation, each experiment was repeated four times independently.TRAP Staining—After 7 days of culturing, RANKL and/or M-CSF-treated RAW 264.7 cells and/or BMMs were fixed with a solution containing acetone and citrate for 30 s and washed twice with double distilled water. TRAP staining was performed with a kit purchased from Sigma according to the manufacturer's instructions. TRAP(+) cells with four or more nuclei were scored as multinucleated osteoclasts under light microscopy. For statistical evaluation, cell counting was done using four different fields of view and was repeated four times.TRAP Promoter Assay—The reporter plasmid, pTRAP-Luc, containing a 1.85-kb KpnI-BglII fragment of the mouse TRAP promoter (kindly provided by Dr. Hiroshi Takayanagi, Tokyo Medical and Dental University, Tokyo, Japan) was transfected into RAW 264.7 cells using Superfect (Qiagen). Three hours after transfection, RANKL and/or calpain inhibitors were added to the cells. Luciferase activity was examined 24 h after treatment by using a luciferase activity assay kit (Promega, Madison, WI). For statistical evaluation, each experiment was repeated four times independently.Immunoblotting—RAW 264.7 cells and BMMs treated with RANKL and/or M-CSF in conjunction with calpain inhibitors were harvested at 1,200 × g and suspended with 100 μl of lysis buffer containing Tris/Cl, pH 7.4 (10 mm), NaCl (150 mm), 1% Triton X-100, 0.25% Nonidet P-40, and EDTA (2 mm) and supplemented with a protease inhibitor mixture tablet (Roche Diagnostics). Cells were then incubated on ice for 30 min. After centrifugation at 15, 000 × g for 15 min at 4 °C, supernatants were collected, and the amount of protein was quantified. Equal amounts of protein were mixed with 2× SDS sample buffer and directly subjected to electrophoresis on a 4-20% BisTris glycine gel (Invitrogen). Separated proteins were transferred to a polyvinylidene difluoride membrane (Bio-Rad) and incubated with the following antibodies: cathepsin K (Calbiochem), α(II)-spectrin (Biomol, Plymouth Meeting, PA), α-actin (Sigma), μ- and m-calpains (Triple Point Biologics Inc., Forest Grove, OR), IκBα (C21) (Santa Cruz Biotechnology), and MMP9 (Sigma).In Vitro IκBα Cleavage—Murine RAW 264.7 cells (9 × 104) cultured in a 6-well plate with Dulbecco's modified Eagle's medium containing 10% FBS were treated with recombinant RANKL (20 ng/ml) (R & D Systems) in a time-dependent manner to confirm that RANKL-induces IκBα cleavage. Cell-permeable calpain inhibitors, including calpeptin (5 μm) and ALLM (1 μm), were added to the media in the presence of RANKL to verify that calpain inhibition decreases RANKL-induced IκBα cleavage. The cells were also subjected to a proteasome inhibitor, MG132 (1 μm). Each cell was then divided into cytoplasmic and nuclear fractions using a nuclear extract kit (Active Motif, Carlsbad, CA) according to the manufacturer's instructions. The cytoplasmic fractions were subjected to immunoblot for detection of decreased IκBα. Each band was quantified using NIH Image. For statistical evaluation, each experiment was repeated four times independently.Calpain Activity Assay—Murine RAW 264.7 cells (9 × 104) were cultured in media containing RANKL (0, 5, 20, and 50 ng/ml) (R & D Systems) in a 6-well plate. The media were changed every other day. On day 7, conditioned media were examined for TRAP activity. At the same time, the cytoplasmic fractions were used to measure calpain activity with a calpain activity assay kit (Biovision, Mountain View, CA) according to the manufacturer's instructions. Cells were harvested at 1,200 × g and lysed with extraction buffer provided by the manufacturer. Cell lysates were centrifuged at 12,000 × g at 4 °C for 10 min, and the supernatants were collected. After quantification of protein in the supernatant, 50 μg of protein was used for the calpain activity assay with Ac-LLY-AFC, a fluorescent calpain substrate. Recombinant human m-calpain and calpastatin were used for positive and negative controls, respectively. The samples were read in a fluorometer equipped with 400-nm excitation and 505-nm emission filters. For statistical evaluation, each experiment was repeated four times.Pathway Profiling SEAP Assay—A Mercury™ pathway profiling system (BD Biosciences) was used to confirm signaling pathways affected by calpastatin in murine RAW 264.7 cells. 1 μg of each reporter plasmid (TAL-SEAP (negative control), pSEAP2 (positive control), and pNF-κB-SEAP) was transfected into the cells (9 × 104) by using Superfect (Qiagen). Transfection efficiency for each plasmid was calibrated with the positive control. After transfection, media containing 10% serum were changed to media containing 0.5% serum in order to minimize any background. Twelve hours later, 1 μm of calpastatin peptide (Calbiochem) was added to the cells in the presence of RANKL (20 ng/ml) (R & D Systems). Twenty four hours after treatment with calpastatin peptide, conditioned media were subjected to a SEAP assay using a Great EscAPe SEAP chemiluminescence detection kit (BD Biosciences) according to the manufacturer's instructions. For statistical evaluation, each experiment was repeated three times independently.Real Time RT-PCR—Total RNA was isolated from RAW 264.7 cells treated with RANKL by using an RNeasy mini kit (Qiagen) according to the manufacturer's instructions. Single-stranded cDNA was synthesized with 0.2 μg of total RNA using an Omniscript reverse transcription kit (Qiagen) with oligo(dT)20 (Invitrogen). Real time RT-PCR for each target was performed with Light Cycler Fast Start DNA Master SYBR Green I (Roche Diagnostics) using a Smart Cycler® system (Cepheid, Sunnyvale, CA). Primers were designed on the basis of mouse GAPDH (GenBank™ accession number NM_001001303), m-calpain (GenBank™ accession number NM_009794), and μ-calpain (Gen-Bank™ accession number NM_007600) as follows: 1) 5′-GAPDH, AGAACATCATCCCTGCATCC; 2) 3′-GAPDH, AGTTGCTGTTGAAGTCGC; 3) 5′-μCAPN, GCATGAGTGCCTATGAGATGAG; 4) 3′-μCAPN, AGAATGGAAGAACAAAGGCAA; 5) 5′-mCAPN, AACGCCAAGACATCAAGTC; and 6) 3′-mCAPN, TCAAAGTCGATGATTAGCTCG.Statistical Analyses—Statistical analyses were performed with the Statistical Package for the Social Sciences (SPSS) software (version 10) (SPSS, Chicago, IL). Differences between treated and control groups were analyzed with the t test or the Scheffe test in a one-way analysis of variance, and a p value of less than 0.01 was considered significant. Data are expressed as mean ± S.D. unless otherwise indicated.RESULTSα(II)-Spectrinolysis Suggested Calpain Activation in Response to RANKL—Although it has been suggested that calpain is activated by TNF-α, the role of calpain in the regulation of RANKL-supported osteoclastogenesis is not well understood. Therefore, calpain activation in response to RANKL was examined based on α(II)-spectrinolysis in a murine macrophage RAW 264.7 cellular system. By using this method, calpain activation can be readily detected by the proteolysis of full-length α(II)-spectrin (240 kDa), a well known calpain substrate, to its breakdown product (150 kDa). As shown in Fig. 1A, the continuous addition of RANKL to RAW 264.7 cells for 7 days increased the amount of α(II)) spectrin breakdown product, suggesting that calpain was activated in response to RANKL. In contrast, the cell-permeable calpastatin peptide decreased the level of α(II)) spectrin breakdown product, suggesting that calpastatin suppresses RANKL-induced calpain activation in RAW 264.7 cells.To confirm whether RANKL-induced calpain activation also occurs in normal pre-osteoclasts, RANKL was added to cultured BMM progenitors, which were obtained from C57BL/6J mice, for 5 days in the presence of M-CSF. As shown in Fig. 1B, the amount of α(II)) spectrin breakdown product (150 kDa) increased, suggesting that calpain activation in response to RANKL indeed occurs in normal pre-osteoclasts. Calpastatin peptide also decreased the level of α(II)) spectrin breakdown product, suggesting that calpastatin suppresses RANKL-induced calpain activation in normal pre-osteoclasts.Calpain Activity Increased in a RANKL-dependent Manner in RAW 264.7 Cells—To examine further calpain activation in response to RANKL, calpain activity was assayed with synthetic Ac-LLY-AFC, a fluorescent calpain substrate, using RAW 264.7 cell lysates treated with RANKL. Various concentrations of RANKL (0, 5, 20, and 50 ng/ml) were added to the cells every other day and were allowed to incubate for 7 days to generate fully differentiated, multinucleated osteoclasts as shown in Fig. 2A-2.Fig. 2RANKL induces an increase in both calpain and TRAP activities in RAW 264.7 cells. A-1, RANKL treatment (0, 5, 20, and 50 ng/ml) for 7 days increased both calpain and TRAP activities in a dose-dependent manner. Each of the samples shown A-2 was used for calpain and TRAP activity assays. TRAP and calpain activities were indicated as units/liter (units/liter) and relative fluorescence unit (RFU)/mg of protein, respectively. Results are expressed as the mean ± S.D. of four independent experiments. A-2, RANKL treatment for 7 days induced the generation of fully differentiated osteoclasts. B-1, RANKL decreased immature μ-calpain judging from immunoblot with specific antibody capable of detecting its extreme N-terminal region. In contrast, m-calpain did not show such changes in response to RANKL. α-Actin was used for a loading control. B-2, real time RT-PCR showed that levels of μ- and m-calpain mRNA were unchanged in response to RANKL.View Large Image Figure ViewerDownload (PPT)The temporal correlation between osteoclastogenic markers and increased endogenous calpain activity in response to RANKL provided an important clue that calpain is involved in the regulation of RANKL-supported osteoclastogenesis. Therefore, we examined changes in calpain and TRAP activities by using supernatants and media from RANKL-treated and -untreated RAW 264.7 cells.As shown in Fig. 2A-1, calpain and TRAP activities simultaneously increased in a RANKL-dependent manner. These results suggested that calpain is critically involved in RANKL-supported osteoclastogenesis. Although additional factors may exist, RANKL-induced calpain activation is likely the result of a transient increase in the level of cytoplasmic Ca2+ due to the activation of phospholipase C and the subsequent release of Ca2+ from intracellular stores (27Bharti A.C. Takada Y. Aggarwal B.B. J. Immunol. 2004; 172: 5940-5947Crossref PubMed Scopus (216) Google Scholar).RANKL-activated μ-Calpain in RAW 264.7 Cells—The N-terminal ends of μ- and m-calpain are autoproteolyzed when activated by an increase in calcium concentration (14Goll D.E. Thompson V.F. Li H. Wei W. Cong J. Physiol. Rev. 2003; 83: 731-801Crossref PubMed Scopus (2329) Google Scholar). In order to confirm which calpain species is/are activated in response to RANKL, changes in the amount of their latent forms were examined by using immunoblot. The antibodies used in this experiment recognized only the N-terminal ends of each species, thus the N-terminal processed form (resulting from activation) was not identified. Examination of changes in the amount of latent form represents a reliable parameter by which to analyze calpain activation in response to RANKL.As shown in Fig. 2B-1, RANKL treatment activated μ-calpain in a dose-dependent manner and thus decreased the amount of its latent full-length form. Because this change could have been the result of a decreased amount of μ-calpain mRNA, we checked its mRNA level upon RANKL treatment. As shown in Fig. 2B-2, we detected neither an increase nor a decrease at the mRNA level. Therefore, we concluded that this decrease in latent full-length form was indeed a consequence of μ-calpain activation. These data provide compelling evidence that μ-calpain is activated by RANKL in RAW 264.7 cells. It is also important to note that no significant changes in the level of full-length m-calpain or m-calpain mRNA were revealed as indicated in Fig. 2, B-1 and -2.Calpain Inhibitors Suppressed RANKL-supported Osteoclastogenesis in RAW 264.7 Cells—To investigate further the calpain involvement in RANKL-supported osteoclastogenesis, calpain inhibitors were added to RAW 264.7 cells in the presence of RANKL. TRAP staining clearly demonstrated that both cell-permeable calpastatin peptide, an endogenous calpain inhibitor, and calpeptin sufficiently suppressed the generation of TRAP(+)-multinucleated cells (Fig. 3, A-1 and -2). Immunoblot analyses revealed a decrease in the level of osteoclastogenic markers, including cathepsin K (data not shown) and MMP9 compared with control cells that were not treated with calpain inhibitors (Fig. 3B).Fig. 3Calpain inhibitor decreases RANKL-supported osteoclastogenesis in RAW 264.7 cells. A-1, calpain inhibitors, including calpastatin (1 μm) and calpeptin (5 μm), were sufficient to suppress the generation of TRAP(+)-multinucleated cells in murine RAW 264.7 cells. Images of both TRAP(+)-mononuclear and multinucleated cells were obtained after 7 days of treatment (original magnification, ×100). The representative pictures were chosen for comparison. Each arrow indicates a TRAP(+)-multinucleated cell. A-2, TRAP(+)-multinucleated cells were counted under a microscope, and cells with four or more nuclei with TRAP(+) staining were counted as TRAP(+)-multinucleated cells. Count was performed with four different fields for each sample. Results are expressed as the mean ± S.D. of four independent experiments. **, significantly different between calpain inhibitor-treated and -untreated samples; p < 0.01. B, calpain inhibitors in the presence of RANKL suppressed the expression of the osteoclastogenic marker, MMP9. No TMT, no treatment; RL, RANKL; CPT, calpeptin; CPST, calpastatin. Black triangles indicate MMP9 and α-actin (loading control). C, activation of the TRAP promoter by RANKL was inhibited by calpain inhibitors, including calpastatin, calpeptin, and ALLM. Results are expressed as the mean ± S.D. of four independent experiments. **, significantly different between calpain inhibitor-treated and -untreated samples; p < 0.01.View Large Image Figure ViewerDownload (PPT)In addition, we verified that calpain inhibitors suppress TRAP promoter activity judging from a pTRAP-luciferase assay system that measures changes in luciferase activity. As shown in Fig. 3C, RANKL treatment resulted in the activation of the TRAP promoter in RAW 264.7 cells, which was in turn arrested by calpain inhibitors.Calpain Inhibitors Suppressed RANKL-supported Osteoclastogenesis in Normal Pre-osteoclasts—We then confirmed that our findings in RAW 264.7 cells also occur in normal pre-osteoclasts using bone marrow-derived monocyte/macrophage progenitors. As shown in Fig. 4, A-1 and -2, cell-permeable calpastatin peptide and
Objectives: To estimate the prevalence rate of hypertension, the changes of health behavior, and compliance for the drug treatment after diagnosed as hypertension. Methods: 7,030 persons who live in Cheonan City of Chungnam Province were selected by the cluster sampling method, and 5,372 persons were surveyed by questionnaire and health examination. This data is analyzed by Chi-square test on each variable. Results: 49.8%- of men and 38.8%- of women had been diagnosed as hypertension, and the prevalence rate of hypertension was significantly increased with aging in both gender. The prevalence rate tended to decrease in highly educated women group. Unemployed persons or obese persons showed relatively higher prevalence rate. The prevalence rate of hypertension increased in groups with higher total cholesterol levels over 240 mg/dl, and groups with glucose level over 200 mg/dl. 53.1%- of male patients and 66.6%- of female patients showed compliance for antihypertensive treatment. Compliance for treatment was higher in aged group or lower educated group in both gender. Among men, proportion of compliant subjects was higher in unemployed group(49.3%-), and lower in labor or primary industry than the others but among women, there was not any significant difference. And men with compliance for treatment had higher monthly income than the others, but women did not show any. Conclusion : This population had a high prevalence rate of hypertension which may lead to cardiovascular disease. Therefore health education programs and distribution of information must be emphasized in order to increase compliance to treatment and encourage the change of health behavior to promote health.
Background: Implant loosening is associated with inflammatory bone loss induced by ultra-high molecular weight polyethylene wear debris. We hypothesized that a hydroxyapatite-bisphosphonate composite improves periprosthetic bone quality and osseous integration of an intramedullary implant even in the presence of ultra-high molecular weight polyethylene particles in an experimental rat femur model. Methods: A preliminary in vitro study determined the optimal concentration of zoledronate (50 μM) that would maximally decrease osteoclasts without harming osteoblasts. Hydroxyapatite-coated intramedullary nails were implanted bilaterally in the femora of sixteen rats (the control group), and hydroxyapatite-zoledronate-coated nails were implanted bilaterally in the femora of sixteen rats (the experimental group). Ultra-high molecular weight polyethylene particles were introduced into the femoral canal before implantation. Eight rats from each group were killed at six weeks, and the remaining rats were killed at six months. Periprosthetic bone mass was analyzed by dual x-ray absorptiometry and microcomputed tomography. Osseous integration was examined by biomechanical testing of pullout strength. Results: The mean bone area (and standard deviation) in the periprosthetic bone region was significantly greater (p < 0.0001) in the hydroxyapatite-zoledronate group (2.388 ± 0.960 mm2) than in the control group (0.933 ± 0.571 mm2). This difference was larger in the six-week group than in the six-month group (p = 0.03). The average peak pullout force for the treated femora (241.0 ± 95.1 N) was significantly greater (p < 0.0001) than that for the controls (55.6 ± 49.0 N). This difference was similar in the six-week and six-month groups. The energy required for nail pullout was significantly greater (p < 0.0001) for the treated femora (521.6 ± 293.8 N-mm) than for the controls (142.2 ± 152.1 N-mm). This difference in energy to pullout was similar in the six-week and six-month groups. Regression analysis demonstrated a high correlation between periprosthetic bone mass and peak pullout force for both the six-week (r = 0.766, p = 0.0005) and six-month (r = 0.838, p < 0.0001) groups. Conclusions: Surface modification of implants with hydroxyapatite-zoledronate improves periprosthetic bone quality and osseous integration. Clinical Relevance: Hydroxyapatite-based site-specific delivery of bisphosphonates may be one way of reducing ultra-high molecular weight polyethylene wear particle-induced periprosthetic osteolysis and implant loosening.
Objectives : To evaluate the internal burden and hazardous effects associated with smoking in middle and high school students. Methods : We analysed urinary cotinine(U-cotinine) concentrations and the frequency of Sister Chromatid Exchanges (SCE). A comparison was done of U-cotinine concentrations and the frequency of SCE in peripheral lymphocytes across school levels (middle vs. high) and smoking types (direct: daily & occasional smoking, indirect; usual indirect & non-smoking), in 122 males. Results : The middle school student group comprised 6.8% daily smokers, 15.9% occasional smokers, 40.9% daily indirect smokers, and 35.4% nonsmokers, while the high school student group comprised 18.0%, 20.5%, 35.7%, and 21.8%, respectively. The U-cotinine concentration and the frequency of SCE among the middle school students were and 2.0 per cell, respectively, which were significantly lower than the (p=0.078) and 2.6 per cell (p=0.005) of the high school students. Among the 40 direct smokers, these two biomarkers were and 2.59 per cell, significantly higher than the (p=0.0001) and 2.1 per cell (p=0.003) among indirect smoking groups. The variation in individual U-cotinine concentration ranged widely in both the indirect and direct smoking groups. Conclusion : Urinary cotinine concentrations and the frequency of Sister Chromatid Exchange seem to objectively and effectively evaluate student exposure whether it was direct or indirect smoking. Consequently, these biomarkers may be useful in monitoring the objective efficacy of anti-smoking programs in adolescent populations.
To estimate the effects of environmental noise on inhabitants' life in an apartment area at Taejon, noise levels and traffic volume of major roads were measured. 203 housewives were surveyed by questionaires including general factors, noise related factors and three items of life effects: subjective evaluations on the general environment, annoyance, and life disturbance due to environmental noise. At the boundary adjacent to the road with more traffic volume, noise level was higher; according to the time, the amount of noise level was in the morning, in the evening, at noon, and at night in order. Most of boundary noise levels were higher than those of recommended standard environmental noise levels in a residential area. The boundary noise level showed a very significant linear relationship with traffic volume of near roads. Noise level difference in the apartments adjacent to three roads was ranged 2.4~6.7dB between in windows open and close state. The apartments adjacent to 9 lane or 6 lane-road, which were protected by noise prevention wall and 20m or more distance from the roads, showed higher noise level at middle floors and high floors than those of low floors; but the buildings adjacent to 4 lane-road, with no protection, showed higher noise level at low and middle floors than those of high floors. Among 203 housewives, 120(59.1%) participated in this study, and 86(73.2%) of them answered that the most serious environmental noise was traffic noise from near roads. Comparing traffic noise levels with those of before-migration, 67.0% participants found the environmental noise became louder. Fifty eight(49.5%) of the participants wanted noise protection wall and 15(25.9%) of them were willing to charge the fee. Less perception on the present noise comparing to those before-migration, less traffic volume, and lower noise levels in the apartments were related to higher scores of self-evaluation on the environment. Higher susceptibility on the present noise, areas with more traffic volume, higher boundary noise levels, and higher noise levels showed higher scores of annoyance on environmental noise and life disturbance. Considering above all things, it was suggested that traffic noise in this area was the major problem of environmental noise, and its' effect was so serious that inhabitants needed some preventive measures for better life quality.
Tobacco smoke is an environmental mixture including polycyclic aromatic hydrocarbons and may interfere in endocrine system as an EDC in aging. Thus, we performed a molecular epidemiological approach with in-depth biological monitoring of combustible cigarette smoking among adolescents and adults in South Korea (N=620) with exposure biomarkers, i.e., exhaled CO, urinary cotinine, t,t-muconic acid (TTMA), malondialdehyde (MDA), and obtained information of their lifestyle and tobacco addiction status. We also diagnosed the genetic polymorphisms on the 96 SNPs for tobacco-metabolism, -addiction, and expression differences and compared mtDNA abnormalities in buccal and blood cells. As results, there were positive associations among the above tobacco exposure biomarkers. Man or youth smokers showed high frequency in some of mtDNA alteration, such as ‘SNPs for inconsistent bases between buccal and blood cells’. Among the SNPs, the polymorphisms on SULT1A1, DRD2, and ADH1B were related to multi-exposure biomarkers. Interestingly, youth showed similar levels of urinary TTMA and MDA to adults, although their pack-year was approx. 1/6 volume of that of adults. We also observed the negative association between urinary MDA levels and the growth rate in the adolescents (p<0.05). In conclusion, the present biological monitoring provides high susceptible population, i.e., adolescents rather than adults, and reliable genetic factors affecting tobacco exposure. The inferred environment-gene-gene interaction suggests tobacco smoking accelerats aging in adolescents as an EDC.
This study examined levels of blood lead and mercury, and urinary cadmium, and associated sociodemographic factors in 3–18 year-old Korean children and adolescents. We used the nationally representative Korean Environmental Health Survey in Children and Adolescents data for 2012–2014 and identified 2388 children and adolescents aged 3–18 years. The median and 95th percentile exposure biomarker levels with 95% confidence intervals (CIs) were calculated. Multivariate regression analyses were performed on log transformed exposure biomarker levels adjusted for age, sex, area, household income, and father's education level. The median exposure biomarker levels were compared with data from Germany, the US, and Canada, as well as the levels of Korean children measured at different times. The median levels of blood lead and mercury, as well as urinary cadmium were 1.23 μg/dL, 1.80 μg/L, and 0.40 μg/L (95% CIs, 1.21–1.25, 1.77–1.83, and 0.39–0.41, respectively). The blood lead levels were significantly higher in boys and younger children (p < 0.0001) and children with less educated fathers (p = 0.004) after adjusting for covariates. Urinary cadmium level increased with age (p < 0.0001). The median levels of blood mercury and urinary cadmium were much higher in Korean children and adolescents than those in their peers in Germany, the US, and Canada. Blood lead levels tended to decrease with increasing age and divergence between the sexes, particularly in the early teen years. Median levels of blood lead and urinary cadmium decreased since 2010. Sociodemographic factors, including age, sex, and father's education level were associated with environmental exposure to heavy metals in Korean children and adolescents. These biomonitoring data are valuable for ongoing surveillance of environmental exposure in this vulnerable population.
'%3e%3cg id='b'%3e%3cpath id='a' stroke='%23000' stroke-width='2' d='M-6-25H6m-12 3H6m-12 3H6'/%3e%3cuse xlink:href='%23a' y='44'/%3e%3c/g%3e%3cpath stroke='%23fff' d='M0 17v10'/%3e%3ccircle r='12' fill='%23cd2e3a'/%3e%3cpath fill='%230047a0' d='M0-12A6 6 0 0 0 0 0a6 6 0 0 1 0 12 12 12 0 0 1 0-24z'/%3e%3c/g%3e%3cg transform='rotate(-123.69)'%3e%3cuse xlink:href='%23b'/%3e%3cpath stroke='%23fff' d='M0-23.5v3M0 17v3.5m0 3v3'/%3e%3c/g%3e%3c/svg%3e)
