beta-Carotene biochemistry is a fundamental process in mammalian biology. Aberrations either through malnutrition or potentially through genetic variation may lead to vitamin A deficiency, which is a substantial public health burden. In addition, understanding the genetic regulation of this process may enable bovine improvement. While many bovine QTL have been reported, few of the causative genes and mutations have been identified. We discovered a QTL for milk beta-carotene and subsequently identified a premature stop codon in bovine beta-carotene oxygenase 2 (BCO2), which also affects serum beta-carotene content. The BCO2 enzyme is thereby identified as a key regulator of beta-carotene metabolism.
Regulation of milk synthesis and secretion is controlled mostly through local (intramammary) mechanisms. To gain insight into the molecular pathways comprising this response, an analysis of mammary gene expression was conducted in 12 lactating cows shifted from twice daily to once daily milking. Tissues were sampled by biopsy from adjacent mammary quarters of these animals during the two milking frequencies, allowing changes in gene expression to be assessed within each animal. Using bovine-specific, oligonucleotide arrays representing 21,495 unique transcripts, a range of differentially expressed genes were found as a result of less frequent milk removal, constituting transcripts and pathways related to apoptotic signaling (NF-kappaB, JUN, ATF3, IGFBP5, TNFSF12A) mechanical stress and epithelial tight junction synthesis (CYR61, CTGF, THBS1, CLDN4, CLDN8), and downregulated milk synthesis (LALBA, B4GALT1, UGP2, CSN2, GPAM, LPL). Quantitative real-time PCR was used to assess the expression of 13 genes in the study, and all 13 of these were correlated (P < 0.05) with values derived from array analysis. It can be concluded that the physiological changes that occur in the bovine mammary gland as a result of reduced milk removal frequency likely comprise the earliest stages of the involution response and that mechano-signal transduction cascades associated with udder distension may play a role in triggering these events.
Gephyrin (GPHN) is an organizational protein that clusters and localizes the inhibitory glycine (GlyR) and GABAA receptors to the microtubular matrix of the neuronal postsynaptic membrane. Mice deficient in gephyrin develop a hereditary molybdenum cofactor deficiency and a neurological phenotype that mimics startle disease (hyperekplexia). This neuromotor disorder is associated with mutations in the GlyR α1 and β subunit genes (GLRA1 and GLRB). Further genetic heterogeneity is suspected, and we hypothesized that patients lacking mutations in GLRA1 and GLRB might have mutations in the gephyrin gene (GPHN). In addition, we adopted a yeast two-hybrid screen, using the GlyR β subunit intracellular loop as bait, in an attempt to identify further GlyR-interacting proteins implicated in hyperekplexia. Gephyrin cDNAs were isolated, and subsequent RT-PCR analysis from human tissues demonstrated the presence of five alternatively spliced GPHN exons concentrated in the central linker region of the gene. This region generated 11 distinct GPHN transcript isoforms, with 10 being specific to neuronal tissue. Mutation analysis of GPHN exons in hyperekplexia patients revealed a missense mutation (A28T) in one patient causing an amino acid substitution (N10Y). Functional testing demonstrated that GPHNN10Y does not disrupt GlyR-gephyrin interactions or collybistininduced cell-surface clustering. We provide evidence that GlyR-gephyrin binding is dependent on the presence of an intact C-terminal MoeA homology domain. Therefore, the N10Y mutation and alternative splicing of GPHN transcripts do not affect interactions with GlyRs but may affect other interactions with the cytoskeleton or gephyrin accessory proteins. Gephyrin (GPHN) is an organizational protein that clusters and localizes the inhibitory glycine (GlyR) and GABAA receptors to the microtubular matrix of the neuronal postsynaptic membrane. Mice deficient in gephyrin develop a hereditary molybdenum cofactor deficiency and a neurological phenotype that mimics startle disease (hyperekplexia). This neuromotor disorder is associated with mutations in the GlyR α1 and β subunit genes (GLRA1 and GLRB). Further genetic heterogeneity is suspected, and we hypothesized that patients lacking mutations in GLRA1 and GLRB might have mutations in the gephyrin gene (GPHN). In addition, we adopted a yeast two-hybrid screen, using the GlyR β subunit intracellular loop as bait, in an attempt to identify further GlyR-interacting proteins implicated in hyperekplexia. Gephyrin cDNAs were isolated, and subsequent RT-PCR analysis from human tissues demonstrated the presence of five alternatively spliced GPHN exons concentrated in the central linker region of the gene. This region generated 11 distinct GPHN transcript isoforms, with 10 being specific to neuronal tissue. Mutation analysis of GPHN exons in hyperekplexia patients revealed a missense mutation (A28T) in one patient causing an amino acid substitution (N10Y). Functional testing demonstrated that GPHNN10Y does not disrupt GlyR-gephyrin interactions or collybistininduced cell-surface clustering. We provide evidence that GlyR-gephyrin binding is dependent on the presence of an intact C-terminal MoeA homology domain. Therefore, the N10Y mutation and alternative splicing of GPHN transcripts do not affect interactions with GlyRs but may affect other interactions with the cytoskeleton or gephyrin accessory proteins. Neuronal postsynaptic membranes contain a wide variety of ion channels and receptor proteins that contribute to the balance of excitatory and inhibitory neurotransmission in the human central nervous system. Mature postnatal neuroinhibition is mediated by postsynaptic glycinergic and GABAA 1The abbreviations used are: GABAA, γ-aminobutyric acid type A; GPHN, gephyrin; GlyR, glycine receptor; GLRA1, α1-subunit gene of GlyRs; GLRB, β-subunit gene of GlyRs; GlyR α1, α1-subunit polypeptide of GlyRs; GlyR β, β-subunit polypeptide of GlyRs; TM, transmembrane domain; RT, reverse transcriptase; YTH, yeast two-hybrid; SNP, single nucleotide polymorphism; BAC, bacterial artificial chromosome; SSCP, single-stranded conformation polymorphism; DDF, dideoxy fingerprinting; dHPLC, denaturing high performance liquid chromatography; contig, group of overlapping clones; TRITC, tetramethylrhodamine isothiocyanate; EGFP, enhanced green fluorescent protein. 1The abbreviations used are: GABAA, γ-aminobutyric acid type A; GPHN, gephyrin; GlyR, glycine receptor; GLRA1, α1-subunit gene of GlyRs; GLRB, β-subunit gene of GlyRs; GlyR α1, α1-subunit polypeptide of GlyRs; GlyR β, β-subunit polypeptide of GlyRs; TM, transmembrane domain; RT, reverse transcriptase; YTH, yeast two-hybrid; SNP, single nucleotide polymorphism; BAC, bacterial artificial chromosome; SSCP, single-stranded conformation polymorphism; DDF, dideoxy fingerprinting; dHPLC, denaturing high performance liquid chromatography; contig, group of overlapping clones; TRITC, tetramethylrhodamine isothiocyanate; EGFP, enhanced green fluorescent protein. receptor systems that are structurally related to the nicotinic receptors with a typical pentameric structure constructed from heterogeneous subunit constituents containing four transmembrane (TM) domains and a large intracellular loop between TM3 and TM4 (1Grenningloh G. Rienitz A. Schmitt B. Methfessel C. Zensen M. Beyreuther K. Gundelfinger E.D. Betz H. Nature. 1987; 328: 215-220Google Scholar, 2Langosch D. Becker C.M. Betz H. Eur. J. Biochem. 1990; 194: 1-8Google Scholar). These subunits combine to form fast response, ligand-gated chloride channels that modify excitatory neurotransmission in the human brainstem and spinal cord (3Langosch D. Thomas L. Betz H. Proc. Natl. Acad. Sci. U. S. A. 1988; 85: 7394-7398Google Scholar, 4Betz H. Trends Neurosci. 1991; 14: 458-461Google Scholar, 5Kuhse J. Laube B. Magalei D. Betz H. Neuron. 1993; 11: 1049-1056Google Scholar). Inhibitory glycine receptors (GlyRs) are composed of three ligand-binding α1 subunits (GlyR α1) and two structural β subunits (GlyR β) that are anchored and clustered on the postsynaptic membrane of inhibitory neurons by the interaction of a motif within the TM3-TM4 loop of the GlyRβ subunit with anchoring protein, gephyrin (6Langosch D. Hoch W. Betz H. FEBS Lett. 1992; 298: 113-117Google Scholar, 7Meyer G. Kirsch J. Betz H. Langosch D. Neuron. 1995; 15: 563-572Google Scholar, 8Kneussel M. Hermann A. Kirsch J. Betz H. J. Neurochem. 1999; 72: 1323-1326Google Scholar). In contrast to GlyRs, there is a lack of evidence for a direct physical interaction between gephyrin and GABAA receptor subunit(s) (7Meyer G. Kirsch J. Betz H. Langosch D. Neuron. 1995; 15: 563-572Google Scholar, 9Kannenberg K. Baur R. Sigel E. J. Neurochem. 1997; 68: 1352-1360Google Scholar), although immunohistochemical studies have detected co-localization of gephyrin with major subtypes of GABAA receptors at GABAergic postsynaptic sites in murine and rat brain (10Essrich C. Lorez M. Benson J.A. Fritschy J.M. Luscher B. Nat. Neurosci. 1998; 1: 563-571Google Scholar, 11Baer K. Essrich C. Benson J.A. Benke D. Bluethmann H. Fritschy J.M. Luscher B. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 12860-12865Google Scholar, 12Kneussel M. Brandstatter J.H. Laube B. Stahl S. Muller U. Betz H. J. Neurosci. 1999; 19: 9289-9297Google Scholar, 13Sassoe-Pognetto M. Panzanelli P. Sieghart W. Fritschy J.M. J. Comp. Neurol. 2000; 420: 481-498Google Scholar, 14Kneussel M. Betz H. J. Physiol. 2000; 525: 1-9Google Scholar). Gephyrin (GPHN) belongs to a group of cytoskeletal elements that are critical for receptor-associated synaptic localization and organization. First identified as a 93-kDa protein by co-purification with GlyRs from rat spinal cord, GPHN demonstrated high affinity binding to tubulin (15Pfeiffer F. Graham D. Betz H. J. Biol. Chem. 1982; 257: 9389-9393Google Scholar, 16Graham D. Pfeiffer F. Simler R. Betz H. Biochemistry. 1985; 24: 990-994Google Scholar, 17Kirsch J. Langosch D. Prior P. Littauer U.Z. Schmitt B. Betz H. J. Biol. Chem. 1991; 266: 22242-22245Google Scholar). It is suggested that gephyrin forms a postsynaptic organizational lattice structure that dynamically immobilizes and clusters inhibitory receptors onto the cytoskeletal infrastructure (14Kneussel M. Betz H. J. Physiol. 2000; 525: 1-9Google Scholar, 18Meier J. Vannier C. Serge A. Triller A. Choquet D. Nat. Neurosci. 2001; 4: 253-260Google Scholar). In support of this, GPHN-dependent postsynaptic clustering of GlyRs was demonstrated by cellular antisense experiments and from studies of a gphn knock-out mouse model (12Kneussel M. Brandstatter J.H. Laube B. Stahl S. Muller U. Betz H. J. Neurosci. 1999; 19: 9289-9297Google Scholar, 19Kirsch J. Wolters I. Triller A. Betz H. Nature. 1993; 366: 745-748Google Scholar, 20Feng G. Tintrup H. Kirsch J. Nichol M.C. Kuhse J. Betz H. Sanes J.R. Science. 1998; 282: 1321-1324Google Scholar). Heterogeneous roles for gephyrin have been implicated by protein-protein interactions with a range of determinants such as RAFT1, tubulin, profilin, collybistin, and the dynein light chains 1 and 2 (17Kirsch J. Langosch D. Prior P. Littauer U.Z. Schmitt B. Betz H. J. Biol. Chem. 1991; 266: 22242-22245Google Scholar, 21Sabatini D.M. Barrow R.K. Blackshaw S. Burnett P.E. Lai M.M. Field M.E. Bahr B.A. Kirsch J. Betz H. Snyder S.H. Science. 1999; 284: 1161-1164Google Scholar, 22Mammoto A. Sasaki T. Asakura T. Hotta I. Imamura H. Takahashi K. Matsuura Y. Shirao T. Takai Y. Biochem. Biophys. Res. Commun. 1998; 243: 86-89Google Scholar, 23Kins S. Betz H. Kirsch J. Nat. Neurosci. 2000; 3: 22-29Google Scholar, 24Fuhrmann J.C. Kins S. Rostaing P. El Far O. Kirsch J. Sheng M. Triller A. Betz H. Kneussel M. J. Neurosci. 2002; 22: 5393-5402Google Scholar). The preliminary structure of the gephyrin gene (GPHN) has been described in mice and humans (25Ramming M. Kins S. Werner N. Hermann A. Betz H. Kirsch J. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 10266-10271Google Scholar, 26Rees M.I. Am. Soc. Hum. Genet. 2001; 69 (Abstr. 2623): 627Google Scholar, 27David-Watine B. Gene (Amst.). 2001; 271: 239-245Google Scholar), although there is a degree of ambiguity in the number of exons due to the presence of multiple transcript isoforms, and it is uncertain that all exons have been located and identified. Indeed, GPHN expression is not restricted to rat brain and spinal cord but is also found in liver, kidney, lung, and retina (28Prior P. Schmitt B. Grenningloh G. Pribilla I. Multhaup G. Beyreuther K. Maulet Y. Werner P. Langosch D. Kirsch J. Betz H. Neuron. 1992; 8: 1161-1170Google Scholar, 29Sassoe-Pognetto M. Kirsch J. Grunert U. Greferath U. Fritschy J.M. Mohler H. Betz H. Wassle H. J. Comp. Neurol. 1995; 357: 1-14Google Scholar, 30Kawasaki B.T. Hoffman K.B. Yamamoto R.S. Bahr B.A. J. Neurosci. Res. 1997; 49: 381-388Google Scholar). Gephyrin knock-out mice and reconstitutive cell culture assays have demonstrated that gephyrin expression in nonneuronal tissue is a requirement for the biosynthesis of molybdenum cofactor (20Feng G. Tintrup H. Kirsch J. Nichol M.C. Kuhse J. Betz H. Sanes J.R. Science. 1998; 282: 1321-1324Google Scholar, 31Stallmeyer B. Schwarz G. Schulze J. Nerlich A. Reiss J. Kirsch J. Mendel R.R. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 1333-1338Google Scholar). Striking homologies are observed between the primary structure of GPHN and proteins involved in bacterial, plant, and invertebrate molybdenum cofactor biosynthesis. Gephyrin, therefore, has a synaptic function as a postsynaptic anchoring and clustering protein in neurons while facilitating a highly conserved metabolic purpose in nonneuronal tissues (32Kirsch J. Curr. Opin. Neurobiol. 1999; 9: 329-335Google Scholar). The genetic and structural basis of the functional dichotomy is not established; however, in rats, a putative explanation may lie in the generation of distinct transcript isoforms of gephyrin constructed from alternative splicing of eight exonic "cassettes" within four regions of GPHN (25Ramming M. Kins S. Werner N. Hermann A. Betz H. Kirsch J. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 10266-10271Google Scholar, 28Prior P. Schmitt B. Grenningloh G. Pribilla I. Multhaup G. Beyreuther K. Maulet Y. Werner P. Langosch D. Kirsch J. Betz H. Neuron. 1992; 8: 1161-1170Google Scholar, 33Kirsch J. Malosio M.L. Wolters I. Betz H. Eur. J. Neurosci. 1993; 5: 1109-1117Google Scholar). Apart from conferring neuronal and nonneuronal characteristics to the mature polypeptide products, the purpose of the transcript heterogeneity pattern is unclear, and the number of isoform combinations in human tissue remains unestablished. In addition to major disruption of molybdenum cofactor biosynthesis, gephyrin-deficient mice display a neuromotor phenotype, which resembles human hereditary hyperekplexia. This neurological condition (Mendelian Inheritance of Man: 149400 and 138491) can be caused by dominant and recessive mutations in the GLRA1 and GLRB receptor genes and is characterized by an abnormal, persistent startle response to unexpected stimuli, neonatal hypertonia, and a chronic accumulation of injuries caused by unprotected, startle-induced falls (34Shiang R. Ryan S.G. Zhu Y.Z. Hahn A.F. O'Connell P. Wasmuth J.J. Nat. Genet. 1993; 5: 351-358Google Scholar, 35Rees M.I. Andrew M. Jawad S. Owen M.J. Hum. Mol. Genet. 1994; 3: 2175-2179Google Scholar, 36Rees M.I. Lewis T.M. Vafa B. Ferrie C. Corry P. Muntoni F. Jungbluth H. Stephenson J.B. Kerr M. Snell R.G. Schofield P.R. Owen M.J. Hum. Genet. 2001; 109: 267-270Google Scholar, 37Rees M.I. Lewis T.M. Kwok J.B. Mortier G.R. Govaert P. Snell R.G. Schofield P.R. Owen M.J. Hum. Mol. Genet. 2002; 11: 853-860Google Scholar, 38Andermann F. Keene D.L. Andermann E. Quesney L.F. Brain. 1980; 103: 985-997Google Scholar, 39Saenz-Lope E. Herranz-Tanarro F.J. Masdeu J.C. Chacon Pena J.R. Ann. Neurol. 1984; 15: 36-41Google Scholar, 40Brown P. Adv. Neurol. 2002; 89: 153-159Google Scholar). Furthermore, autoimmunity to GPHN was detected in a patient with Stiff-Man syndrome, a disorder that has a degree of phenotypic overlap with hyperekplexia (41Butler M.H. Hayashi A. Ohkoshi N. Villmann C. Becker C.M. Feng G. De Camilli P. Solimena M. Neuron. 2000; 26: 307-312Google Scholar). Collectively, this indicates that GPHN is a candidate gene for neurological and metabolic disorders, and support for the latter has recently emerged with a description of a GPHN reading frame mutation in a family with hereditary molybdenum cofactor deficiency (42Reiss J. Gross-Hardt S. Christensen E. Schmidt P. Mendel R.R. Schwarz G. Am. J. Hum. Genet. 2001; 68: 208-213Google Scholar). In response to the candidacy of gephyrin for hyperekplexia, we pursued the definitive genomic structure of gephyrin by a combination of in silico BAC contig construction and multitissue RT-PCR methods. Using a yeast two-hybrid (YTH) screen, with the GlyR β subunit intracellular loop as bait, we attempted to identify further GlyR-interacting proteins that might be implicated in hyperekplexia. The results of this screen, together with the extensive search for all human GPHN transcripts in both neuronal and nonneuronal tissues, suggest the presence of one new GPHN exon and at least 11 neurological transcript isoform combinations that redefine the genomic organization of GPHN. Having established the number of exons in the GPHN gene, we completed a systematic exon by exon mutation analysis of GPHN in a cohort of hyperekplexia patients devoid of GLRA1 and GLRB mutations. One novel mutation (N10Y) and several SNPs are reported; however, the functional effect of the mutation remains elusive despite assays for receptor targeting and clustering. We also present evidence that GlyR-gephyrin binding is dependent on the presence of an intact C-terminal MoeA homology domain and that the heterogeneous GPHN linker region is not the physical determinant for gephyrin-GlyR binding. RT-PCR Analysis of GPNH Alternative Splicing—A GPHN gene-specific primer (Table I) was used in a first-strand cDNA synthesis reaction (SuperScript II; Invitrogen) from total RNA derived from adult brain, fetal brain, cerebellum, and human spinal cord (Clontech). In addition to neurological tissue, cDNA was synthesized from a selection of nonneurological tissues including heart, liver, lung, kidney, trachea, fetal liver, pancreas, and placenta (Clontech). In the first instance, exonic primers were designed in constitutional regions surrounding the candidate regions of alternative splicing, namely regions C1/2, C3, C4/5, and C6/7 (Table I). To validate the initial RT-PCR methodology, downstream nested primers within the GPHN spliced exons were used in conjunction with primers from upstream invariant portions of the GPHN message (Table I). In the presence of multiple PCR products, DNA fragments were cloned into pGEM-Easy vectors (Stratagene), and the transformants were PCR-screened and assessed for size differences by molecular screening agarose (Roche Applied Sciences) and 10% nondenaturing polyacrylamide gels (Sigma). Minipreparations of clones were digested with EcoRI, and inserts were sequenced using ABI 3100 technology.Table IRT-PCR primers for the spliced regions of GPHNAssayForward primer 5′ → 3′Reverse primer 5′ → 3′Exonic 1st StrandSynthesis Primerex26GTTCTTGGTGATGCCAAGTTAGTATRegion C1/25′-UTRCTTCTCTGGCTCCCTAGCTGTCCTGGCAGGTTAATTATGAGCex6Region C3ex7CAGTGGTGTTGCTTCAACAGAGCGATTCTGAAGGAGTAGTGCex9Region C4/5ex9ACTCCATCATTTCTCGTGGTGTCAGAGGAAAAGGAGACATGCex14Region 6/7ex17ATCGTTTCATCATTGGGGAATATTCCCTGTTGACATGACTGCex20Combinatory C3-C4ex7CAGTGGTGTTGCTTCAACAGATCAGAGGAAAAGGAGACATGCex14Invariant 1ex14AACATTCTCAGAGCCATCACACGGACAGCATAGCCATCTTTTex18Invariant 2ex20ATCGCCATGACATTAAAAGAGTGATCCTCGTCCAGAATACCAex26Nested C3-C4Aex7CAGTGGTGTTGCTTCAACAGATTTGAGGGATCCAACC4ANested C3-C4Bex7CAGTGGTGTTGCTTCAACAGAATTTACTCTGAGAGAC4BNested C3-C4Cex7CAGTGGTGTTGCTTCAACAGACTCAGATACACTATAC4CNested C3-C4Dex7CAGTGGTGTTGCTTCAACAGATCTTAAGTCGTAGCCC4D Open table in a new tab YTH Screening—To identify GlyR β subunit interactors in human brain, we cloned the large intracellular loop of the human GlyR β subunit into the plasmid vector pYTH9 (43Handford C.A. Lynch J.W. Baker E. Webb G.C. Ford J.H. Sutherland G.R. Schofield P.R. Brain Res. Mol. Brain Res. 1996; 35: 211-219Google Scholar, 44Fuller K.J. Morse M.A. White J.H. Dowell S.J. Sims M.J. BioTechniques. 1998; 25 (90–92): 85-88Google Scholar). In this manner, the large TM3-TM4 intracellular loop (known to harbor a gephyrin binding motif) (8Kneussel M. Hermann A. Kirsch J. Betz H. J. Neurochem. 1999; 72: 1323-1326Google Scholar) was fused to the GAL4 DNA binding domain. pYTH9 is advantageous for YTH screening, since the bait plasmid can be stably integrated into the yeast genome at the trp-1 locus. An adult human brain cDNA library in pACT2 (HL4004AH; Clontech) was be screened by transformation of library DNA into the pYTH9-GlyR β yeast strain. Transformed yeast were plated on selective dropout media lacking leucine, tryptophan, and histidine, supplemented with 10 mm 3-amino-1,2,4-triazole, a competitive inhibitor of the HIS3 gene product. Transformation plates were incubated at 30 °C for 12 days to allow histidine prototropic colonies to emerge. Surviving colonies were restreaked onto selective agar, lifted onto Whatman 54 paper, and screened for protein-protein interactions using a standard freeze-thaw fracture assay for the lacZ reporter gene (44Fuller K.J. Morse M.A. White J.H. Dowell S.J. Sims M.J. BioTechniques. 1998; 25 (90–92): 85-88Google Scholar). Library plasmid DNAs were recovered from β-galactosidase-positive colonies using the Yeastmaker plasmid isolation kit (Clontech), transformed into Escherichia coli XL1-blue (Stratagene), miniprepped, and sequenced. True interactions were checked by retransformation of library plasmids into yeast containing pYTH16 (an episomal version of pYTH9) and pYTH16-GlyR β. Library plasmids that were capable of autoactivation (i.e. activated lacZ with pYTH16 alone) were excluded from further analysis. Constructs, Human Embryonic Kidney (HEK) Cell Transfection, and Confocal Microscopy—For the pDSRed-GlyR β construct, the large intracellular loop of the human GlyR β subunit was amplified using the primers BDSRed1 (5′-GCTGAATTCGCCACCATGGCAGTTGTCCAGGTGATGCT-3′) and BDSRed2 (5′-AACGGATCCCTTGCATAAAGATCAATTCGC-3′) and cloned into the EcoRI and BamHI sites of pDSRed-N1 (Clontech). For the pEGFP-gephyrin construct, the entire coding region of the rat gephyrin P1 isoform (28Prior P. Schmitt B. Grenningloh G. Pribilla I. Multhaup G. Beyreuther K. Maulet Y. Werner P. Langosch D. Kirsch J. Betz H. Neuron. 1992; 8: 1161-1170Google Scholar) was amplified using the primers G1 (5′-CGCTGATCAACATGGCGACCGAGGGA-3′) and G14 (5′-TGGCTCGAGTCATAGCCGTCCGATGA-3′), cut with BclI and XhoI, and cloned into the BglII and SalI sites of pEGFPC2 (Clontech). The N10Y mutation was introduced into pEGFP-gephyrin by site-directed mutagenesis, using 27-mer oligonucleotides and the QuikChange kit (Stratagene). Collybistin cDNAs were amplified from postnatal (P0) rat brain first-strand cDNA using the primers CB1 (5′-GTGGGATCCATGCAGTGGATTAGAGGCGGA-3′) and CB3 (5′-TTAGAATTCTCTGCCTTCCTATAGGTATTA-3′ and cloned into the BamHI and EcoRI and sites of the vector pRK5myc. The construct used in this study (pRK5mycCB2SH3–) encodes the collybistin II isoform (23Kins S. Betz H. Kirsch J. Nat. Neurosci. 2000; 3: 22-29Google Scholar). All amplifications were performed using Pfu Turbo proofreading DNA polymerase (Stratagene), and DNAs for transfection were made using the Plasmid Maxi Kit (Qiagen). All constructs were sequenced using the BigDye ready reaction mix (PerkinElmer Life Sciences) and an ABI 310 automated DNA sequencer (Applied Biosystems). HEK cells (ATCC CRL1573) were grown in Dulbecco's modified Eagle's medium supplemented with 10% fetal calf serum, 2 mm glutamine, 100 units ml–1 penicillin G, and 100 mg ml–1 streptomycin at 37 °C in 95% air-5% CO2 (45Harvey R.J. Vreugdenhil E. Zaman S.H. Bhandal N.S. Usherwood P.N. Barnard E.A. Darlison M.G. EMBO J. 1991; 10: 3239-3245Google Scholar). Exponentially growing cells were electroporated (400 V, infinite resistance, 125 microfarads; Bio-Rad Gene Electropulser II) with various combinations of three plasmid constructs: pDSRed-GlyR β, pEGFP-gephyrinN10Y, or pRK5myc-collybistin II. After 24 h, cells were washed twice in phosphate-buffered saline and fixed for 5 min in 4% (w/v) phosphonoformic acid (PFA) in phosphate-buffered saline. Myc-tagged collybistin II was detected using an anti-9E10 monoclonal antibody (Sigma) and TRITC-conjugated secondary antibodies (Jackson ImmunoResearch) using standard protocols. Confocal microscopy was performed as previously described (46Dunne E.L. Hosie A.M. Wooltorton J.R. Duguid I.C. Harvey K. Moss S.J. Harvey R.J. Smart T.G. Br. J. Pharmacol. 2002; 137: 29-38Google Scholar). In Silico Determination of Human Gephyrin Gene Structure—Rat cDNA (28Prior P. Schmitt B. Grenningloh G. Pribilla I. Multhaup G. Beyreuther K. Maulet Y. Werner P. Langosch D. Kirsch J. Betz H. Neuron. 1992; 8: 1161-1170Google Scholar) and human expressed tag sites similar to rat gephyrin were submitted for BLAST searches (available on the World Wide Web at www.ncbi.nlm.nih.gov/BLAST/). Portions of rat cDNA fragments displayed 90–95% homology with dispersed regions of several chromosome 14 human genome BACs submitted to GenBank™. Exon/intron organization was established from the genomic BAC contig, and a putative promoter region was identified through sequence homologies. Details of the human GPHN gene have subsequently been described by David-Watine (27David-Watine B. Gene (Amst.). 2001; 271: 239-245Google Scholar), and the BAC clones are accessible from GenBank™. Hyperekplexia Patients—The majority of patients included in the mutation analysis of the GPHN gene (n = 31) are described elsewhere (37Rees M.I. Lewis T.M. Kwok J.B. Mortier G.R. Govaert P. Snell R.G. Schofield P.R. Owen M.J. Hum. Mol. Genet. 2002; 11: 853-860Google Scholar). In addition, a further seven unrelated hyperekplexia patients all exhibited to the diagnostic criteria of inclusion, which involves a history of neonatal hypertonia, a nose tap response, and an exaggerated startle response, leading to injurious fall down consequences with preservation of consciousness. PCR Analysis of GPHN in Hyperekplexia—The GPHN promoter region, exons and flanking intronic sequences, and 5′- and 3′-untranslated regions were amplified from patient DNA. Primer sets were designed by Primer 3.0 criteria via the online facility (available on the World Wide Web at www-genome.wi.mit.edu/cgi-bin/primer/primer3.0). Each 25-μl reaction contained 60 ng of genomic DNA, 10 pmol of each primer, 1.5 mm MgCl2, 50 mm KCl, 10 mm Tris-HCl (pH 8.3), 200 μm dNTPs (Amersham Biosciences), and 1 unit of Taq polymerase (Qiagen). Promoter regions were amplified with Expand Fidelity Taq (Roche Applied Science) accompanied by 10% (v/v) Me2SO (Sigma) because of the high GC content of the region. The DNA was amplified in MJ Research or PerkinElmer Life Sciences thermocyclers. SSCP—Samples for screening were prepared by denaturing 5 μl of GPHN PCR products with 7 μl of formamide dye at 94 °C for 5 min. Samples were cooled and applied to 10% nondenaturing gels (49:1; Sigma) and run at 75 V for 12–16 h at room temperature and 4 °C. All SSCP gels were silver-stained as previously described (47Budowle B. Chakraborty R. Giusti A.M. Eisenberg A.J. Allen R.C. Am. J. Hum. Genet. 1991; 48: 137-144Google Scholar). Bidirectional Dideoxy Fingerprinting (DDF) Analysis—DDF analysis was carried out using [α-33P]ddNTP/dNTP mixtures and thermosequenase reactions (Amersham Biosciences). DDF patterns for GPHN assays were resolved on MDE nondenaturing gels (48Sarkar G. Yoon H.S. Sommer S.S. Genomics. 1992; 13: 441-443Google Scholar, 49Liu Q. Feng J. Sommer S.S. Hum. Mol. Genet. 1996; 5: 107-114Google Scholar). dHPLC—Analysis was carried out using the Transgenomics dHPLC 2100 WAVER DNA Fragment Analysis System and DNASepR column (Transgenomic, Santa Clara, CA). The dHPLCMelt program was used to predict the optimal melting conditions for PCR fragments, which were analyzed on a WAVE DNA fragment analyzer at temperatures recommended by predicted helicity profiles across the DNA fragment. Variant dHPLC profiles suggestive of sequence heterogeneity were sequenced. The WAVE was run under partially denaturing conditions for mutation detection and SNP discovery. Wavemaker 4.0 software was used to control the rate of flow of buffers and column running. A volume of between 4 and 8 μl of patient and control PCRs were injected into the column depending on the DNA concentration of the PCR. DNA Sequencing—GPHN SNPs were detected by radionucleotide [α-33P] cycle sequencing. Sequencing was initiated using a denaturation stage at 94 °C for 5 min followed by 45 cycles of primer annealing temperatures at 55 °C for 30 s, primer extension at 72 °C for 1 min, and denaturation at 94 °C for 30 s. Denatured samples were applied to a 6% denaturing polyacrylamide gels (Sigma) and resolved at 85 watts for 1–2 h at room temperature. The sequence content of RT-PCR products and clones were determined by ABI 3100 equipment using BigDYE chemistry (PerkinElmer Life Sciences). Each amplimer was sequenced with sense and antisense primers using an ABI PRISM™ BigDye Terminator cycle sequencing kit and AmpliTaq DNA polymerase (PerkinElmer Life Sciences). Population Studies—The population frequency of identified sequence variations (potentially pathogenic mutations and SNPs) were established in a variable number of unrelated controls of Caucasian descent and derived from blood donor clinics in New Zealand (Table II). In instances where a restriction site change was predicted by the polymorphism, the relevant restriction fragment length polymorphism assay was designed and resolved by agarose gel electrophoresis or polyacrylamide gel electrophoresis. For those SNPs devoid of restriction site changes, the SNP frequency in the normal population was determined by comparison of mutation profiles versus normal profiles using mutation screening techniques SSCP, DDF, or dHPLC (see Table II).Table IIPolymorphisms within GPHNSequence changesClassification of changePredicted consequenceFrequency in hyperekplexiaFrequency in controlsAssay-972 del (tgga)5′-UTR deletionUnknown1 from 31 (0.04)1 from 58 (0.02)SSCPC-772TSNPUnknown6 from 31 (0.20)7 from 38 (0.18)SSCPA28T (ex 1)Missense mutationN10Y1 from 310 from 94DDFIVS1 -9(T → C)SNPNo effect6 from 31 (0.20)7 from 32 (0.22)SSCPIVS3 -38(G → A)SNPNo effect5 from 31 (0.16)7 from 32 (0.22)ApoI RFLPIVS3 -6(T → C)SNPNo effect3 from 31 (0.10)2 from 32 (0.07)DDFT1851C (ex 22)SNPNo effect1 from 31 (0.04)1 from 48 (0.02)AatII RFLPIVS24 -38(G → T)SNPNo effect1 from 31 (0.04)2 from 32 (0.07)HincII RFLPIVS24 -14(A → T)SNPNo effect2 from 31 (0.07)5 from 48 (0.10)MboII RFLPIVS25 -59(C → T)SNPNo effect3 from 31 (0.10)5 from 48 (0.10)SSCP Open table in a new tab GlyR β Subunit YTH Screen—In an attempt to identify further GlyR-interacting proteins that may be implicated in hyperekplexia, we carried out a YTH screen of an adult human brain cDNA library, using the GlyR β subunit TM3-TM4 intracellular loop as bait. The cDNA library had an original complexity of 3.5 × 106 independent cDNA clones, and 8 × 106 cDNAs were screened. Twelve positive clones were recovered, which specifically interacted with the GlyR β subunit bait. These represented eight independent cDNAs encoding variants of the human homologue of GPHN (Fig. 1). No other interacting proteins were found. Some of our gephyrin cDNAs (e.g. Geph1) were full-length, which allowed us to predict the entire coding sequence of the human gephyrin polypeptide. Structurally, the N-
Glycine receptors (GlyRs) and specific subtypes of GABA A receptors are clustered at synapses by the multidomain protein gephyrin, which in turn is translocated to the cell membrane by the GDP-GTP exchange factor collybistin. We report the characterization of several new variants of collybistin, which are created by alternative splicing of exons encoding an N-terminal src homology 3 (SH3) domain and three alternate C termini (CB1, CB2, and CB3). The presence of the SH3 domain negatively regulates the ability of collybistin to translocate gephyrin to submembrane microaggregates in transfected mammalian cells. Because the majority of native collybistin isoforms appear to harbor the SH3 domain, this suggests that collybistin activity may be regulated by protein-protein interactions at the SH3 domain. We localized the binding sites for collybistin and the GlyR β subunit to the C-terminal MoeA homology domain of gephyrin and show that multimerization of this domain is required for collybistin-gephyrin and GlyR-gephyrin interactions. We also demonstrate that gephyrin clustering in recombinant systems and cultured neurons requires both collybistin-gephyrin interactions and an intact collybistin pleckstrin homology domain. The vital importance of collybistin for inhibitory synaptogenesis is underlined by the discovery of a mutation (G55A) in exon 2 of the human collybistin gene ( ARHGEF9 ) in a patient with clinical symptoms of both hyperekplexia and epilepsy. The clinical manifestation of this collybistin missense mutation may result, at least in part, from mislocalization of gephyrin and a major GABA A receptor subtype.
We assessed the hypotheses that non-major histocompatibility complex multiple sclerosis (MS) susceptibility loci would be common to sporadic cases and multiplex families, that they would have larger effects in multiplex families, and that the aggregation of susceptibility loci contributes to the increased prevalence of MS in such families.A set of 43 multiplex families comprising 732 individuals and 211 affected subjects was genotyped for 13 MS candidate genes identified by genome-wide association. A control data set of 182 healthy individuals was also genotyped to perform a case-control analysis alongside the family-based pedigree disequilibrium association test, although this may have been underpowered.An effect of the IL2RA and CD58 loci was shown in multiplex families as in sporadic MS. The aggregate of the IL2RA, IL7R, EVI5, KIAA0350, and CD58 risk genotypes in affected individuals from multiplex families was found to be notably different from controls (chi(2) = 112, p = 1 x 10(-22)).Although differences between individual families can only be suggested, the aggregate results in multiplex families demonstrate effect sizes that are increased as compared with those reported in previous studies for sporadic cases. In addition, they imply that concentrations of susceptibility alleles at IL2RA, IL7R, EVI5, KIAA0350, and CD58 are partly responsible for the heightened prevalence of multiple sclerosis within multiplex families.
2-DE and MALDI mass fingerprinting were used to analyse mammary tissue from lactating Friesian cows. The goal was detection of enzymes in metabolic pathways for synthesis of milk molecules including fatty acids and lactose. Of 418 protein spots analysed by PMF, 328 were matched to database sequences, resulting in 215 unique proteins. We detected 11 out of the 15 enzymes in the direct pathways for conversion of glucose to fatty acids, two of the pentose phosphate pathway enzymes and two of the enzymes for lactose synthesis from glucose. We did not detect enzymes that catalyse the first three reactions of glycolysis. Our results are typical of enzyme detection using 2-DE of mammalian tissues. We therefore advocate caution when relating enzyme abundances measured by 2-DE to metabolic output as not all relevant proteins are detected. 2-D DIGE was used to measure interindividual variation in enzyme abundance from eight animals. We extracted relative protein abundances from 2-D DIGE data and used a logratio transformation that is appropriate for compositional data of the kind represented in many proteomics experiments. Coefficients of variation for abundances of detected enzymes were 3-8%. We recommend use of this transformation for DIGE and other compositional data.
Milk samples from 10,641 dairy cattle were screened by a mass spectrometry method for extreme concentrations of the A or B isoforms of the whey protein, β-lactoglobulin (BLG), to identify causative genetic variation driving changes in BLG concentration.A cohort of cows, from a single sire family, was identified that produced milk containing a low concentration of the BLG B protein isoform. A genome-wide association study (GWAS) of BLG B protein isoform concentration in milk from AB heterozygous cows, detected a group of highly significant single nucleotide polymorphisms (SNPs) within or close to the BLG gene. Among these was a synonymous G/A variation at position + 78 bp in exon 1 of the BLG gene (chr11:103256256G > A). The effect of the A allele of this SNP (which we named B') on BLG expression was evaluated in a luciferase reporter assay in transfected CHO-K1 and MCF-7 cells. In both cell types, the presence of the B' allele in a plasmid containing the bovine BLG gene from -922 to + 898 bp (relative to the transcription initiation site) resulted in a 60% relative reduction in mRNA expression, compared to the plasmid containing the wild-type B sequence allele. Examination of a mammary RNAseq dataset (n = 391) identified 14 heterozygous carriers of the B' allele which were homozygous for the BLG B protein isoform (BB'). The level of expression of the BLG B' allele was 41.9 ± 1.0% of that of the wild-type BLG B allele. Milk samples from three cows, homozygous for the A allele at chr11:103,256,256 (B'B'), were analysed (HPLC) and showed BLG concentrations of 1.04, 1.26 and 1.83 g/L relative to a mean of 4.84 g/L in milk from 16 herd contemporaries of mixed (A and B) BLG genotypes. The mechanism by which B' downregulates milk BLG concentration remains to be determined.High-throughput screening and identification of outliers, enabled the discovery of a synonymous G > A mutation in exon 1 of the B allele of the BLG gene (B'), which reduced the milk concentration of β-lactoglobulin B protein isoform, by more than 50%. Milk from cows carrying the B' allele is expected to have improved processing characteristics, particularly for cheese-making.
Running Head: Milking Frequency and Gene Expression 1 2 3 Effects of reduced frequency of milk removal on gene expression in the bovine 4 mammary gland 5 6 M. D. Littlejohn, C. G. Walker, H. E. Ward, K. B. Lehnert, R. G. Snell, G. A. Verkerk, 7 R. J. Spelman, D. A. Clark, S. R. Davis 8 9 DairyNZ Ltd., Hamilton, NZ 10 ViaLactia BioSciences, Auckland, NZ 11 Livestock Improvement Corporation, Hamilton, NZ 12 13 * Corresponding author 14 Contact: matt.littlejohn@dairynz.co.nz 15 16 17 18 19 20 21 22 23 24 This research was supported in part by Dairy InSight (Wellington, New Zealand). 25 Articles in PresS. Physiol Genomics (December 8, 2009). doi:10.1152/physiolgenomics.00108.2009
Selective breeding has strongly reduced the genetic diversity in livestock species and contemporary breeding practices exclude potentially beneficial rare genetic variation from the future gene pool. Here we test whether important traits arising by new mutations can be identified and rescued in highly selected populations. We screened milks from 2.5 million cows to identify an exceptional individual which produced milk with reduced saturated fat content and improved unsaturated and omega-3 fatty acid concentrations. The milk traits were transmitted dominantly to her offspring and genetic mapping and genome sequencing revealed a new mutation in a previously unknown splice enhancer of the DGAT1 gene. Homozygous carriers show features of human diarrheal disorders and may be useful for the development of therapeutic strategies. Our study demonstrates that high-throughput phenotypic screening can uncover rich genetic diversity even in inbred populations and introduces a novel strategy to develop novel milks with improved nutritional properties.
'/%3e%3cuse xlink:href='%23a' transform='rotate(72 0 0)'/%3e%3cuse xlink:href='%23a' transform='rotate(-72 0 0)'/%3e%3cuse xlink:href='%23a' transform='scale(-1 1) rotate(72)'/%3e%3c/g%3e%3c/defs%3e%3cpath fill='%23012169' d='M0 0h1200v600H0z'/%3e%3cpath stroke='%23FFF' stroke-width='60' d='m0 0 600 300M0 300 600 0' clip-path='url(%23b)'/%3e%3cpath stroke='%23C8102E' stroke-width='40' d='m0 0 600 300M0 300 600 0' clip-path='url(%23c)'/%3e%3cpath stroke='%23FFF' stroke-width='100' d='M300 0v300M0 150h600' clip-path='url(%23b)'/%3e%3cpath stroke='%23C8102E' stroke-width='60' d='M300 0v300M0 150h600' clip-path='url(%23b)'/%3e%3cuse xlink:href='%23d' fill='%23FFF' transform='matrix(45.4 0 0 45.4 900 120)'/%3e%3cuse xlink:href='%23d' fill='%23C8102E' transform='matrix(30 0 0 30 900 120)'/%3e%3cg transform='rotate(82 900 240)'%3e%3cuse xlink:href='%23d' fill='%23FFF' transform='rotate(-82 519.022 -457.666) scale(40.4)'/%3e%3cuse xlink:href='%23d' fill='%23C8102E' transform='rotate(-82 519.022 -457.666) scale(25)'/%3e%3c/g%3e%3cg transform='rotate(82 900 240)'%3e%3cuse xlink:href='%23d' fill='%23FFF' transform='rotate(-82 668.57 -327.666) scale(45.4)'/%3e%3cuse xlink:href='%23d' fill='%23C8102E' transform='rotate(-82 668.57 -327.666) scale(30)'/%3e%3c/g%3e%3cuse xlink:href='%23d' fill='%23FFF' transform='matrix(50.4 0 0 50.4 900 480)'/%3e%3cuse xlink:href='%23d' fill='%23C8102E' transform='matrix(35 0 0 35 900 480)'/%3e%3c/svg%3e)
'%3e%3cpath fill='%23012169' d='M0 0v30h60V0z'/%3e%3cpath stroke='%23fff' stroke-width='6' d='m0 0 60 30m0-30L0 30'/%3e%3cpath stroke='%23C8102E' stroke-width='4' d='m0 0 60 30m0-30L0 30' clip-path='url(%23b)'/%3e%3cpath stroke='%23fff' stroke-width='10' d='M30 0v30M0 15h60'/%3e%3cpath stroke='%23C8102E' stroke-width='6' d='M30 0v30M0 15h60'/%3e%3c/g%3e%3c/svg%3e)
