Adult mammals, unlike some lower organisms, lack the ability to regenerate damaged hearts through cardiomyocytes (CMs) dedifferentiation into cells with regenerative capacity. Developing conditions to induce such naturally unavailable cells with potential to proliferate and differentiate into CMs, i.e., regenerative cardiac cells (RCCs), in mammals will provide new insights and tools for heart regeneration research. In this study, we demonstrate that a two-compound combination, CHIR99021 and A-485 (2C), effectively induces RCCs from human embryonic stem cell (hESC)-derived TNNT2+ CMs in vitro, as evidenced by lineage tracing experiments. Functional analysis shows that these RCCs express a broad spectrum of cardiogenesis genes and have the potential to differentiate into functional CMs, endothelial cells (ECs), and smooth muscle cells (SMCs). Importantly, similar results were observed in neonatal rat CMs both in vitro and in vivo. Remarkably, administering 2C in adult mouse hearts significantly enhances survival and improves heart function post-myocardial infarction. Mechanistically, CHIR99021 is crucial for the transcriptional and epigenetic activation of genes essential for RCC development, while A-485 primarily suppresses H3K27Ac and particularly H3K9Ac in CMs. Their synergistic effect enhances these modifications on RCC genes, facilitating the transition from CMs to RCCs. Therefore, our findings demonstrate the feasibility and reveal the mechanisms of pharmacological induction of RCCs from endogenous CMs, which could offer a promising regenerative strategy to repair injured hearts.
Making cardiac cells from fibroblasts Reprogramming noncardiac cells into functional cardiomyocytes without any genetic manipulation could open up new avenues for cardiac regenerative therapies. Cao et al. identified a combination of nine small molecules that could epigenetically activate human fibroblasts, efficiently reprogramming them into chemically induced cardiomyocytes (ciCMs). The ciCMs contracted uniformly and resembled human cardiomyocytes. This method may be adapted for reprogramming multiple cell types and have important implications in regenerative medicine. Science , this issue p. 1216
Ectopic expression of Oct4, Sox2, Klf4, and c-Myc can reprogram differentiated somatic cells into induced pluripotent stem cells (iPSCs). For years, Oct4 has been considered the key reprogramming factor core of the four factors. Here, we challenge this view by reporting a core function of Sox2 and Klf4 in reprogramming. We found that polycistronic expression of Sox2 and Klf4 was sufficient to induce pluripotency in the absence of exogenous Oct4, and the stoichiometry of Sox2 and Klf4 was essential. Sox2 and Klf4 cooperatively bound across the genome, leading to epigenetic remodeling of their targets, including pluripotency genes and gradual activation of the pluripotency network. Interestingly, cells of different germ layer origins, fibroblasts (mesoderm) and neural progenitor cells (ectoderm), showed convergent reprogramming trajectories and similar efficiency. This work demonstrates a core function of Sox2 and Klf4 in pluripotency induction and shows that this mechanism is independent of germ layer origin.
The selective GSK-3β inhibitor 1-azakenpaullone has broad applications in cellular regeneration and regenerative medicine. A two-step protocol featuring an indium-trichloride-mediated intramolecular cyclization to 1-azakenpaullone is disclosed.
Nanog was identified by its ability to sustain the LIF-independent self-renewal of mouse embryonic stem (ES) cells and has recently been shown to play a role in reprogramming adult fibroblasts into pluripotent stem cells. However, little is known about the structural basis of these remarkable activities of Nanog. We have previously identified an unusually strong transactivator named CD2 at its C terminus. Here we demonstrate that CD2 is required for Nanog to mediate ES cell self-renewal. Furthermore, deletion and point mutation analysis revealed that CD2 relies on at least seven aromatic amino acid residues to generate its potent transactivating activity. A mutant Nanog bearing alanine substitutions for these seven residues fails to confer LIF-independent self-renewal in mouse ES cells. Substitution of CD2 by the viral transactivator VP16 gave rise to Nanog-VP16, which is 10 times more active than wild-type Nanog in ES cells. Surprisingly, the expression of Nanog-VP16 in mouse ES cells induces differentiation and is thus unable to sustain LIF-independent self-renewal for mouse ES cells. Taken together, our results demonstrate that the CD2 domain of Nanog is a unique transactivator that utilizes aromatic residues to confer specific activity absolutely required for ES self-renewal. Nanog was identified by its ability to sustain the LIF-independent self-renewal of mouse embryonic stem (ES) cells and has recently been shown to play a role in reprogramming adult fibroblasts into pluripotent stem cells. However, little is known about the structural basis of these remarkable activities of Nanog. We have previously identified an unusually strong transactivator named CD2 at its C terminus. Here we demonstrate that CD2 is required for Nanog to mediate ES cell self-renewal. Furthermore, deletion and point mutation analysis revealed that CD2 relies on at least seven aromatic amino acid residues to generate its potent transactivating activity. A mutant Nanog bearing alanine substitutions for these seven residues fails to confer LIF-independent self-renewal in mouse ES cells. Substitution of CD2 by the viral transactivator VP16 gave rise to Nanog-VP16, which is 10 times more active than wild-type Nanog in ES cells. Surprisingly, the expression of Nanog-VP16 in mouse ES cells induces differentiation and is thus unable to sustain LIF-independent self-renewal for mouse ES cells. Taken together, our results demonstrate that the CD2 domain of Nanog is a unique transactivator that utilizes aromatic residues to confer specific activity absolutely required for ES self-renewal. Embryonic stem cells are the only pluripotent cells capable of generating the 200 or so cell types in our body and thus possess unmatched potentials to restore diseased or aged tissues or organs through transplantations (1Pan G.J. Chang Z.Y. Scholer H.R. Pei D. Cell Res. 2002; 12: 321-329Crossref PubMed Scopus (283) Google Scholar, 2Pan G. Thomson J.A. Cell Res. 2007; 17: 42-49Crossref PubMed Scopus (440) Google Scholar). As such, stem cell-based therapies are promising solutions to many of current unmet medical needs such as diabetes and Parkinson disease. Yet formidable obstacles have to be overcome before human ES 2The abbreviations used are: ESembryonic stemRTreverse transcription. cells can be applied in human diseases both safely and efficaciously. Investigations into the basic biology of ES cells may provide rational approaches to obstacles such as maintaining ES cells at the pluripotent state and inducing them to differentiate toward a specified lineage under culture conditions. embryonic stem reverse transcription. The pluripotency of mouse ES cells appears to be governed by a network of transcription factors including Oct4, Sox2, FoxD3, and Nanog (1Pan G.J. Chang Z.Y. Scholer H.R. Pei D. Cell Res. 2002; 12: 321-329Crossref PubMed Scopus (283) Google Scholar, 3Pan G. Li J. Zhou Y. Zheng H. Pei D. FASEB J. 2006; 20: 1730-1732Crossref PubMed Scopus (191) Google Scholar, 4Boyer L.A. Lee T.I. Cole M.F. Johnstone S.E. Levine S.S. Zucker J.P. Guenther M.G. Kumar R.M. Murray H.L. Jenner R.G. Gifford D.K. Melton D.A. Jaenisch R. Young R.A. Cell. 2005; 122: 947-956Abstract Full Text Full Text PDF PubMed Scopus (3546) Google Scholar, 5Mitsui K. Tokuzawa Y. Itoh H. Segawa K. Murakami M. Takahashi K. Maruyama M. Maeda M. Yamanaka S. Cell. 2003; 113: 631-642Abstract Full Text Full Text PDF PubMed Scopus (2604) Google Scholar, 6Chambers I. Colby D. Robertson M. Nichols J. Lee S. Tweedie S. Smith A. Cell. 2003; 113: 643-655Abstract Full Text Full Text PDF PubMed Scopus (2678) Google Scholar). Although volumes of data have been generated through large scale biological tools such as microarrays and proteomics about these core regulators of stem cell pluripotency (4Boyer L.A. Lee T.I. Cole M.F. Johnstone S.E. Levine S.S. Zucker J.P. Guenther M.G. Kumar R.M. Murray H.L. Jenner R.G. Gifford D.K. Melton D.A. Jaenisch R. Young R.A. Cell. 2005; 122: 947-956Abstract Full Text Full Text PDF PubMed Scopus (3546) Google Scholar, 7Assou S. Le Carrour T. Tondeur S. Strom S. Gabelle A. Marty S. Nadal L. Pantesco V. Reme T. Hugnot J.P. Gasca S. Hovatta O. Hamamah S. Klein B. De Vos J. Stem Cells. 2007; 25: 961-973Crossref PubMed Scopus (283) Google Scholar, 8Orkin S.H. Cell. 2005; 122: 828-830Abstract Full Text Full Text PDF PubMed Scopus (36) Google Scholar, 9Wang J. Rao S. Chu J. Shen X. Levasseur D.N. Theunissen T.W. Orkin S.H. Nature. 2006; 444: 364-368Crossref PubMed Scopus (913) Google Scholar), little is known about the molecular mechanisms that govern their mechanism of action. To this end, we have focused on the transcription mechanism specified by Nanog, a gene known to sustain mouse ES cell self-renewal in the absence of LIF in culture conditions. We have defined two potent transactivators at its C terminus (2Pan G. Thomson J.A. Cell Res. 2007; 17: 42-49Crossref PubMed Scopus (440) Google Scholar, 10Pan G. Pei D. J. Biol. Chem. 2005; 280: 1401-1407Abstract Full Text Full Text PDF PubMed Scopus (65) Google Scholar, 11Pan G.J. Pei D.Q. Cell Res. 2003; 13: 499-502Crossref PubMed Scopus (49) Google Scholar). One of them is CD2 (C-terminal domain 2), which has been shown to be as potent as the virally encoded VP16 in a Gal4-based transactivation assay (10Pan G. Pei D. J. Biol. Chem. 2005; 280: 1401-1407Abstract Full Text Full Text PDF PubMed Scopus (65) Google Scholar). Here we demonstrate that CD2 is required for Nanog-mediated self-renewal of ES cells without LIF. Furthermore, we have uncovered an array of aromatic residues within CD2 that are required both for its transactivation activity and ES cell self-renewal. Cell Lines and Plasmids–HEK 293T cells were cultured in Dulbecco's modified Eagle's medium (Invitrogen) supplemented with 10% fetal bovine serum (Hyclone, UT) and antibiotics (penicillin and streptomycin, 100 μg/ml) as described (10Pan G. Pei D. J. Biol. Chem. 2005; 280: 1401-1407Abstract Full Text Full Text PDF PubMed Scopus (65) Google Scholar). P19 cells and F9 cells were cultured in Dulbecco's modified Eagle's medium (Invitrogen) supplemented with 15% fetal bovine serum (Hyclone, UT) and antibiotics (penicillin and streptomycin, 100 μg/ml) (3Pan G. Li J. Zhou Y. Zheng H. Pei D. FASEB J. 2006; 20: 1730-1732Crossref PubMed Scopus (191) Google Scholar, 10Pan G. Pei D. J. Biol. Chem. 2005; 280: 1401-1407Abstract Full Text Full Text PDF PubMed Scopus (65) Google Scholar). Mouse ES cells (CGR8 ES) were cultured on 0.1% gelatin-coated substrates and cultured in Glasgow minimum essential medium (Sigma) supplemented with 20% fetal bovine serum (Invitrogen), 100 mm nonessential amino acids (Invitrogen), 0.55 mm mercaptoethanol (Sigma), 2 mm l-glutamine (Invitrogen), and 1,000 units/ml human recombinant LIF (Chemicon) as described (3Pan G. Li J. Zhou Y. Zheng H. Pei D. FASEB J. 2006; 20: 1730-1732Crossref PubMed Scopus (191) Google Scholar, 5Mitsui K. Tokuzawa Y. Itoh H. Segawa K. Murakami M. Takahashi K. Maruyama M. Maeda M. Yamanaka S. Cell. 2003; 113: 631-642Abstract Full Text Full Text PDF PubMed Scopus (2604) Google Scholar, 6Chambers I. Colby D. Robertson M. Nichols J. Lee S. Tweedie S. Smith A. Cell. 2003; 113: 643-655Abstract Full Text Full Text PDF PubMed Scopus (2678) Google Scholar, 10Pan G. Pei D. J. Biol. Chem. 2005; 280: 1401-1407Abstract Full Text Full Text PDF PubMed Scopus (65) Google Scholar). The expression plasmid pCR3.1-Gal4DBD was prepared as described (11Pan G.J. Pei D.Q. Cell Res. 2003; 13: 499-502Crossref PubMed Scopus (49) Google Scholar). Gal4-CD2 and a series of truncated Gal4-CD2 plasmids were constructed by inserting a PCR fragment, which was amplified by reverse transcription-PCR from plasmids pCR3.1-NanogF (described in Ref. 11Pan G.J. Pei D.Q. Cell Res. 2003; 13: 499-502Crossref PubMed Scopus (49) Google Scholar), to the downstream EcoRV site of pCR3.1-Gal4DBD as described (11Pan G.J. Pei D.Q. Cell Res. 2003; 13: 499-502Crossref PubMed Scopus (49) Google Scholar). The primers used are shown in Table 1. A series of mutant Gal4-CD2 were generated by site-directed mutagenesis (described in Ref. 11Pan G.J. Pei D.Q. Cell Res. 2003; 13: 499-502Crossref PubMed Scopus (49) Google Scholar); the primers used are shown in Table 2.TABLE 1Primer for series of truncated Gal4-CD2 constructionNameForward sequence (5′-3′)Reverse sequence (5′-3′)CD2aatgctgctccgctccataactcatatttcacctggtggagCD2(Δ7)aatgctgctccgctccataactcaagagtagttcaggaataattccaCD2(Δ10)aatgctgctccgctccataaccaggaataattccaaggcttgtgCD2(Δ13)aatgctgctccgctccataactcattccaaggcttgtggggtgcCD2(Δ20)aatgctgctccgctccataacaaaatgcgcatggctttccctag(Δ6)CD2aacttcggggaggactttctcatatttcacctggtggag(Δ8)CD2ggggaggactttctgcagcctcatatttcacctggtggag(Δ10)CD2gactttctgcagccttacgttcatatttcacctggtggag(Δ14)CD2ccttacgtacagttgcagcatcatatttcacctggtggag(Δ16)CD2gtacagttgcagcaaaactttcatatttcacctggtggag(Δ20)CD2caaaacttctctgccagtgatcatatttcacctggtggag Open table in a new tab TABLE 2Primer for site-directed mutagenesisNameForward sequence (5′-3′)Reverse sequence (5′-3′)Gal4-LFL50-52mugccttggaagcagccgcgaactactctgtgactccaccGgtggagtcacagagtagttcgcggctgcttccaaggcGal4-NYS53-55muccccacaagccttggaattattcctggccgccgctgtgacgtcacagcggcggccaggaataattccaaggcttgtggggGal4-LFLNYS50-55muccccacaagccttggaagcagccgcggccgccgctgtgacgtcacagcggcggccgcggctgcttccaaggcttgtggggGal4-L50muccccacaagccttggaagcattcctgaactactctgtgacgtcacagagtagttcaggaatgcttccaaggcttgtggggGal4-L52muccccacaagccttggaattattcgcgaactactctgtgactccaccaggtAcctggtggagtcacagagtagttcgcgaataattccaaggcttgtggggGal4-LFL50-52muccccacaagccttggaagcattcgcgaactactctgtgacgtcacagagtagttcgcgaatgcttccaaggcttgtggggGal4-F51muccccacaagccttggaattagccctgaactactctgtgacgtcacagagtagttcagggctaattccaaggcttgtggggGal4-CD2-F/W mugccttggaattatggctgaactactctgtgacGtcacagagtagttcagccataattccaaggcGal4-CD2-F/Y mugccttggaattatacctgaactactctgtgactccaccGgtggagtcacagagtagttcaggtataattccaaggcGal4-CD2-F/D mugccttggaattagacctgaactactctgtgactccaccGgtggagtcacagagtagttcaggtctaattccaaggcGal4-CD2-F/E mugccttggaattagagctgaactactctgtgactccaccGgtggagtcacagagtagttcagctctaattccaaggcGal4-CD2-F/GgccttggaattaggcctgaactactctgtgactccaccGgtggagtcacagagtagttcaggcctaattccaaggcGal4-CD2-F/L mugccttggaattattgCtgaactactctgtgactccaccGgtggagtcacagagtagttcagcaataattccaaggcGal4-CD2-F/S mugccttggaattatccctgaactactctgtgactccaccGgtggagtcacagagtagttcagggataattccaaggcGal4-CD2-F/C mugccttggaattatgcctgaactactctgtgactccaccGgtggagtcacagagtagttcaggcataattccaaggcGal4-CD2-F/P mugccttggaattacccctgaactactctgtgactccaccGgtggagtcacagagtagttcaggggtaattccaaggcGal4-CD2-F/H mugccttggaattacacctgaactactctgtgactccaccGgtggagtcacagagtagttcaggtgtaattccaaggcGal4-CD2-F/Q mugccttggaattacagctgaactactctgtgactccaccGgtggagtcacagagtagttcagctgtaattccaaggcGal4-CD2-F/R mugccttggaattacgcctgaactactctgtgactccaccGgtggagtcacagagtagttcaggcgtaattccaaggcGal4-CD2-F/I mugccttggaattaatcctgaactactctgtgactccaccGgtggagtcacagagtagttcaggattaattccaaggcGal4-CD2-F/M mugccttggaattaatgctgaactactctgtgactccaccGgtggagtcacagagtagttcagcattaattccaaggcGal4-CD2-F/N mugccttggaattaaacctgaactactctgtgactccaccGgtggagtcacagagtagttcaggtttaattccaaggcGal4-CD2-F/T mugccttggaattaaccctgaactactctgtgactccaccGgtggagtcacagagtagttcagggttaattccaaggcGal4-CD2-F/K musgccttggaattaaagctgaactactctgtgactccaccGgtggagtcacagagtagttcagctttaattccaaggcGal4-CD2-F/V mugccttggaattagtcctgaactactctgtgactccaccGgtggagtcacagagtagttcaggactaattccaaggcGal4-CD2-F8muccgctccataacgccggggaggactttctgcGcagaaagtcctccccggcgttatggagcggGal4-CD2-F12muggggaggacgctctgcagccttacgtacagttgcGcaactgtacgtaaggctgcagagcgtcctccccGal4-CD2-Y16muctgcagcctgccgtacagttgcagcaaaacttctctgccGgcagagaagttttgctgcaactgtacggcaggctgcagGal4-CD2-F8F12Y16muccgctccataacgccggggaggacgctctgcagcctgccgcggcaggctgcagagcgtcctccccggcgttatggagcggGal4-CD2-F23mucagttgcagcaaaacgcctctgccagtgatttggaggCctccaaatcactggcagaggcgttttgctgcaactgGal4-CD2-CD2-F42mugggaaagccatgcgcatgctagcaccccacaagccGgcttgtggggtgctagcatgcgcatggctttcccGal4-CD2-F51Y54(W)muccataactggggggaggactggctgcagccttgggtacagctgtacccaaggctgcagccagtcctccccccagttatggGal4-CD2-F8F12Y16(W)muggaattagccctgaacgcctctgtgactccaccaggCctggtggagtcacagaggcgttcagggctaattccGal4-CD2-F23(W)mucagttgcagcaaaactggtctgccagtgatttggaggCctccaaatcactggcagaccagttttgctgcaactgGal4-CD2-F42(W)mugggaaagccatgcgcattggagcaccccacaagccGgcttgtggggtgctccaatgcgcatggctttccc Open table in a new tab The plasmids used for generating ES stable lines were constructed by inserting a PCR fragment, which was amplified by reverse transcription-PCR from plasmids pCR3.1-Nanog, pCR3.1-Nanog-mu1, and pCR3.1-Nanog-mu2 (generated through site-directed mutagenesis with above primers in pCR3.1-Nanog as template), to the MCS xho1 and NotI site of pPyCAGIP vector. The primers used are as follows: forward, 5′-atactcgagaccatgagtgtgggtcttcc-3′; reverse, 5′-tatgcggccgctcatatttcacctggtggag-3′. Transfections, Western Blotting, and Reporter Assay–HEK293T cells were transfected by calcium phosphate co-precipitation methods. F9, P19, and CGR8 ES cells were transfected by Lipofectamine 2000 (Invitrogen). For Western blotting analysis, HEK293T cells cultured in 24-well tissue culture plates were transfected by a calcium phosphate co-precipitation method with expression plasmids (0.8 μg each) as described (11Pan G.J. Pei D.Q. Cell Res. 2003; 13: 499-502Crossref PubMed Scopus (49) Google Scholar). After transfection (24 h), the cells were washed by phosphate-buffered saline and lysed on ice by radioimmune precipitation assay buffer (50 mm Tris-HCl, pH 7.5, 150 mm NaCl, 0.25% sodium deoxycholate, 0.1% Nonidet P-40, 0.1% Triton X-100) for 10 min and cleared of debris by centrifugation at 15,000 rpm for 15 min at 4 °C. After boiling with an equal volume of 2× SDS loading buffer for 5 min, the cell lysates were electrophoresed with 10% SDS-PAGE and blotted to polyvinylidene difluoride membranes (Millipore). The membranes were then blotted with 5% nonfat milk and incubated with anti-FLAG antibody (1:5000), followed by alkaline phosphatase-conjugated anti-mouse (1:5000) second antibodies. The membranes were then washed extensively and developed by incubating in a solution containing nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate. For reporter assays, the cells seeded in 24-well plates were transiently transfected with p5G-e1b-luciferase (0.2 μg/well) and effector plasmids (0.4 μg/well) using Lipofectamine 2000 (Invitrogen) according to the manufacturer's instruction. pCMV-Renilla plasmids (0.002μg/transfection; Promega, WI) were co-transfected in each well as internal references, and the DNA concentrations for all transfections were normalized to equal amounts with the parental pCR3.1 vector. 36 h later, the cells were washed by phosphate-buffered saline and lysed by 50 μl of 1× PLB buffer (Promega, WI). Luciferase activity was measured using a dual luciferase reporter assay system (Promega) and a TD2020 Luminometer (Turner Design). Each transfection was carried out in duplicate and repeated at least five times. Real Time Reverse Transcription (RT)-PCR Analysis–2 μg of total RNA was reverse transcripted in a final volume of 20 μl as previously described (3Pan G. Li J. Zhou Y. Zheng H. Pei D. FASEB J. 2006; 20: 1730-1732Crossref PubMed Scopus (191) Google Scholar). PCRs were undertaken using the real time PCR Master Mix (SYBR GREEN) reagent kit (Toyobo), according to the manufacturer's protocol. PCR was performed in 15 μl of total volume for 45 cycles. The primers used are shown in Table 3.TABLE 3Primer for real time PCRNameForward sequence (5′-3′)Reverse sequence (5′-3′)ActinagtgtgacgttgacatccgtTgctaggagccagagcagtaNanogctcaagtcctgaggctgacaTgaaacctgtccttgagtgcRex-1cagccagaccaccatctgtcGtctccgatttgcatatctcctgOct4aggccagtccagaataccagtaggtatccgtcagggaagc Open table in a new tab Stable Cell Line Selection–Feeder free ES cells (CGR8) maintained in ES medium containing 103u/ml LIF (Chemicon) were seeded in 3.5-cm dishes and transfected with 2 μg of each expression plasmid. 24 h after transfection, the cells were divided by 1:50 and seeded to new 6-cm dishes for selection. Puromycin (2 μg/ml; Invitrogen) was added to the medium for selection. After selection for 10 days, single clone was picked up and expanded in 12-well tissue culture plate for further Western and real time RT-PCR analysis. The CD2 of Nanog Is Required for Nanog-mediated LIF-independent ES Cell Self-renewal–Nanog was discovered based on its ability to sustain LIF-independent ES cell self-renewal, presumably by repressing the expression of genes involved in specifying the primitive endoderm lineage (5Mitsui K. Tokuzawa Y. Itoh H. Segawa K. Murakami M. Takahashi K. Maruyama M. Maeda M. Yamanaka S. Cell. 2003; 113: 631-642Abstract Full Text Full Text PDF PubMed Scopus (2604) Google Scholar, 6Chambers I. Colby D. Robertson M. Nichols J. Lee S. Tweedie S. Smith A. Cell. 2003; 113: 643-655Abstract Full Text Full Text PDF PubMed Scopus (2678) Google Scholar). Although the repressor function of Nanog remains to be demonstrated, we have demonstrated that Nanog encodes two potent transactivators, WR and CD2 (10Pan G. Pei D. J. Biol. Chem. 2005; 280: 1401-1407Abstract Full Text Full Text PDF PubMed Scopus (65) Google Scholar, 11Pan G.J. Pei D.Q. Cell Res. 2003; 13: 499-502Crossref PubMed Scopus (49) Google Scholar). Because CD2 is more potent than WR in mediating transcription using the Gal4 system (10Pan G. Pei D. J. Biol. Chem. 2005; 280: 1401-1407Abstract Full Text Full Text PDF PubMed Scopus (65) Google Scholar), we wished to assess the role of CD2 in mediating LIF-independent ES cell self-renewal. We have previously generated a CD2-truncated Nanog and demonstrated that it remains active in mediating the transactivation of reporters bearing Nanog-binding sites (10Pan G. Pei D. J. Biol. Chem. 2005; 280: 1401-1407Abstract Full Text Full Text PDF PubMed Scopus (65) Google Scholar). To begin to assess the role CD2 in ES cell self-renewal, this mutant was cloned into the expression vector pPyCAGIP (a gift from Chambers (6Chambers I. Colby D. Robertson M. Nichols J. Lee S. Tweedie S. Smith A. Cell. 2003; 113: 643-655Abstract Full Text Full Text PDF PubMed Scopus (2678) Google Scholar)) and stably transfected into mouse ES cells. As shown in Fig. 1A (panel 1), mouse ES cells transfected with control vector (panels a and d) underwent spontaneous differentiation in the absence of LIF (panel d versus panel a) morphologically, forming disorganized clumps of flat cells. As expected, ES cells overexpressing wild type Nanog showed pluripotent morphology in the absence of LIF (Fig. 1A, panels e versus panels b) with clones of small and compact cells (6Chambers I. Colby D. Robertson M. Nichols J. Lee S. Tweedie S. Smith A. Cell. 2003; 113: 643-655Abstract Full Text Full Text PDF PubMed Scopus (2678) Google Scholar). On the other hand, ES cells expressing CD2-truncated Nanog became differentiated in the absence of LIF as the control (Fig. 1A, panels f versus panels d), suggesting that the CD2 domain is required for Nanog-mediated LIF-independent ES cell self-renewal. Representative clones from similar experiments in Fig. 1A (panel 1) were shown with higher magnification in Fig. 1A (panel 2). To further confirm the pluripotent states of the cells in Fig. 1A, we analyzed the expression levels of pluripotent markers Nanog, Oct4, and Rex1 by quantitative RT-PCR as presented in Fig. 1B. In the absence of LIF, ES cells expressing the CD2 truncation mutant did not sustain the expression of both Rex1 and Oct4, whereas ES cells expressing the wild type Nanog did (Fig. 1B). Because the primers we used for Nanog detection were designed for both endogenous and the transfected Nanog constructs in Fig. 1B (left column), we estimate that the contribution of exogenous Nanog or NanogCD2 to the overall Nanog expression levels to be ∼ 1× or 2×, respectively, in agreement with the results from Western blots shown in Fig. 1C. Together, these results demonstrate that CD2 is critical for Nanog-mediated LIF-independent ES cell self-renewal. Aromatic Amino Acids Are Critical for the Transactivaiton Function of CD2–We then wished to determine the structural requirement for CD2 transactivation activity. To discern the critical subdomain or residues, we made serial deletions of CD2 to generate CD2(Δ7), CD2(Δ10), CD2(Δ13), and CD2(Δ20) in fusion forms to the DNA-binding domain of Gal4, respectively (Fig. 2A). These constructs were then evaluated with a reporter construct, p5G-elb-luciferase as described (10Pan G. Pei D. J. Biol. Chem. 2005; 280: 1401-1407Abstract Full Text Full Text PDF PubMed Scopus (65) Google Scholar, 11Pan G.J. Pei D.Q. Cell Res. 2003; 13: 499-502Crossref PubMed Scopus (49) Google Scholar) (“Methods and Materials”), into HEK293T, mouse ES cells, F9 germ tumor cells, and P19 germ tumor cells, respectively, and their activities were quantified as described (11Pan G.J. Pei D.Q. Cell Res. 2003; 13: 499-502Crossref PubMed Scopus (49) Google Scholar) and presented in Fig. 2B. These results suggest that the sequence 50LFL may play a critical role in CD2 activity (CD2(Δ13) versus CD2(Δ10)), whereas the deletion of 53NYS also reduces its activity significantly. We then performed alanine substitution individually or in combination for the 50LFLNYS region as illustrated in Fig. 2A (lower panel). Their corresponding activities were measured as in Fig. 2B and presented in Fig. 2C. Consistent with the deletion data in Fig. 2B, substitutions at LFL resulted in almost complete loss of transactivation activity, whereas substitutions at NYS had about 40% reduction (Fig. 2C). Individual substitution at Leu50, Leu52, or Phe51 led to progressive reduction of activity (Fig. 2C). Interestingly, F9 cells appeared to be more sensitive toward these substitutions (Fig. 2C). All of these constructs were well expressed at the protein level as demonstrated in Fig. 2 (D and E). Together, these results defined the critical role of 50LFL, particularly Phe51 in CD2 activity. We then focused on Phe51 and performed a systematic substitution to determine which amino acid residue is preferred at this position. We mutated Phe51 into the rest of the amino acid family, including aromatic, hydrophobic, hydrophilic, and charged amino acids as shown in Fig. 3A. The activity of each substitution was determined in HEK293T, mES, F9, and P19 cells as described in Fig. 2 and presented in Fig. 3 (C–F), and summarized in Fig. 3B. Interestingly, tryptophan, an aromatic residue, was able to replace Phe51 completely, generating equal or more robust activity in all four cell lines tested. Substitution of Phe51 with Leu, Ile, or Tyr resulted in CD2 with activities ranging from 50 to 100% of the wild type transactivator (Fig. 3B). Other substitutions led to more severe reduction of activity such as Phe → Glu or Phe → Lys (Fig. 3, B–F). Western blot analysis revealed similar levels of expression of these constructs (Fig. 3G). Based on these results, we conclude that the amino acid at Phe51 should be an aromatic residue. To define additional structural feature for CD2, we performed N-terminal deletions and alanine substitutions as illustrated in Fig. 4A. Transactivation activity data presented in Fig. 4B revealed a progressive loss of activity between Δ 6 to Δ20. The deletion mutant (Δ20)CD2 lost almost all of its activity (Fig. 4B). Within the 20-amino acid segment deleted, there are two Phe residues and one Tyr residue that may contribute to the transactivating activity of CD2. To test this idea, we mutated all three of these residues to Ala as illustrated in Fig. 4A and measured the activity as presented in Fig. 4C. All three individual substitutions resulted in significant reduction of CD2 activity, whereas the combined mutation CD2-F8F12Y16Mu lost its activity entirely (Fig. 4C), suggesting that these three aromatic residues play a critical role in maintaining CD2 activity. Requirement of Aromatic Residues in CD2 for LIF-independent ES Cell Self-renewal–Aromatic residues have been demonstrated to play a critical role in mediating the transactivation function of the potent transactivator VP16 (12Regier J.L. Shen F. Triezenberg S.J. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 883-887Crossref PubMed Scopus (226) Google Scholar). Our mutagenesis studies presented above also indicate that the aromatic residues within CD2 are of critical importance in mediating its transactivation function. As shown in Fig. 1, CD2 is required for Nanog to mediate ES cell self-renewal. So, we tested the role of these aromatic residues in Nanog-mediated ES cell self-renewal. First, we designed three CD2 mutants carrying multiple substitutions as shown in Fig. 5A, CD2-mu1 with alanine substitutions at positions Phe8-Phe12-Tyr16, Phe23-Phe42, and Leu50-Phe51-Leu52; CD2-mu2 with alanine substitutions of the seven aromatic amino acids at positions Phe8, Phe12, Tyr16, Phe23, Phe42, Phe51, and Tyr54; and CD2-F/Y-W with tryptophan substitutions of the seven aromatic amino acids at the same positions as CD2-mu2. Both alanine substitution mutants, CD2-mu1 and CD2-mu2, are inactive in the Gal4 reporter assay system as shown in Fig. 5B in all four different cell types. However, the tryptophan substitution mutant CD2-F/Y-W remains almost equal activity as wild type CD2 in all three pluoripotent cell types (F9, P19, and mES), but with less activity in HEK293T as shown in Fig. 5D. We then engineered all three mutants back into the full-length Nanog and then inserted these fragments into both PCR3.1-FLAG and pPyCAGIP expression vectors as shown in Fig. 5F. Employing p5N, which harbors five copies of the Nanog-binding site, as a reporter (described in Fig. 5F) (10Pan G. Pei D. J. Biol. Chem. 2005; 280: 1401-1407Abstract Full Text Full Text PDF PubMed Scopus (65) Google Scholar), we assayed the transactivation activity of these mutants in mES cells. Consistent with the results in Gal4 reporter system, N3, a Nanog mutant with CD2 truncated, is ∼50%, Nanog-CD2-mu1 and Nanog-CD2-mu2 ∼70%, and Nanog-CD2-F/Y-W ∼100% as wild type Nanog (Fig. 5G). These constructs generated stable protein products as revealed by Western blot analysis (Fig. 5H). We then generated stable clones in ES cells. Representative clones from ES cell carrying control vector, Nanog, Nanog-CD2-mu1, Nanog-CD2-mu2, and Nanog-CD2-F/Y-W were grown in the absence or presence of LIF (Fig. 5I, panels 1 and 2) and then analyzed for Nanog expression by Western blotting (Fig. 5K). As shown in Fig. 5K, the transgenes were expressed in the ES cell clones, especially in the absence of LIF (lanes 4, 6, 8, and 10) as expected. We then tested whether Nanog-CD2-mu1, -mu2, and -F/Y-W are able to sustain ES cell self-renewal in the absence of LIF. As shown in Fig. 5I, ES cells carrying the Nanog and Nanog-CD2-F/Y-W transgene remain pluripotent morphologically, whereas those carrying Nannog-CD2-mu1 and -mu2 failed to maintain their pluripotent morphology. The morphological phenotypes observed in Fig. 5I were corroborated by the expression of pluripotent markers such as Nanog, Oct4, and Rex-1 as measured by quantitative RT-PCR (Fig. 5J). Based on these observations, we conclude that Nanog relies on the aromatic residues in the CD2 transactivation domain to maintain ES cell self-renewal and pluripotency.FIGURE 5Substitution of aromatic residues in CD2 by Ala, but not Trp, abolished the transactivation activity of CD2 and its self-renewal activity of Nanog. A, schematic illustration of CD2 and its aromatic residue substitution mutants. B and D, transcription activity of CD2 and those mutants in A assayed in the Gal4-reporter system in four cell lines as indicated. Note that CD2-mu1 and -mu2 lost all their activity, whereas CD2-F/Y-W remains fully active in mES, F9, and P19 cells. C and E, Western analysis of Gal4-CD2 and its mutants with anti-FLAG antibody as described (11Pan G.J. Pei D.Q. Cell Res. 2003; 13: 499-502Crossref PubMed Scopus (49) Google Scholar). F, left panel, reporters for full-length Nanog. Right panel, Nanog and CD2 deficient N3. G, transcription activity of Nanog, N3, and Nanog-CD2-mu1, -mu2, and -F/Y-W determined with p5N reporter as described (11Pan G.J. Pei D.Q. Cell Res. 2003; 13: 499-502Crossref PubMed Scopus (49) Google Scholar). The results were the average of two independent experiments with triplicates, and the error bars were derived from standard deviations. H, Western blot analysis of constructs used in G and each construct expressed at the expected size. I, morphology of CGR8 ES cells constitutively expressing the vector (mock), wild-type Nanog, and Nanog-CD2-mu1, Nanog-CD2-mu2, or Nanog-CD2-F/Y-W cultured with or without LIF for 5 days. The pictures in I-1 and I-2 were taken with different magnifications. Note that CD2-F/Y-W behaves as the wild-type Nanog in promoting ES cell self-renewal. J, expression level of the pluripotency markers Nanog, Oct4, and Rex1. After being cultured both with or without LIF for 5 days, RNAs of above cells described in I were assayed by quantitative RT-PCR. The relative fold values were derived based on the values for mock ES cells cultured with LIF, which had all three values set as 1. K, cell lysates of cells described in I were isolated with radioimmune precipitation assay buffer and then analyzed by Western blot (WB) with anti-Nanog antibody and anti-actin antibody (as internal reference), respectively.View Large Image Figure ViewerDownload Hi-res image Download (PPT) The Self-renewing Activity of CD2 Cannot Be Substituted by VP16–We have shown previously, based on the Gal4 reporter system, that CD2 is almost as active as VP16 (10Pan G. Pei D. J. Biol. Chem. 2005; 280: 1401-1407Abstract Full Text Full Text PDF PubMed Scopus (65) Google Scholar, 11Pan G.J. Pei D.Q. Cell Res. 2003; 13: 499-502Crossref PubMed Scopus (49) Google Scholar). To see whether VP16 is capable of substituting the activity of CD2 in both transactivation activity and pluripotency, we engineered Nanog-VP16 as shown in Fig. 6A. Employing the p5N reporter system, this mutant reveals a ∼12-fold activity compared with wild type Nanog in mouse ES cells (shown in Fig. 6C). However, when we introduced the pPyCAGIP-Nanog-VP16 into mES cells as described in Fig. 1, it fails to sustain ES cell self-renewal and but induces ES cells differentiation morphologically (shown in Fig. 6B). Western blot analysis shown in Fig. 6D revealed that the transgene of Nanog-VP16 is well expressed (upper band), whereas the endogenous Nanog declined in expression even in the presence of LIF. Accordingly, the expression of differentiation markers were induced by Nanog-VP16 based on both RT-PCR (Fig. 6E) and quantitative RT-PCR (Fig. 6F) analyses. Surprisingly, Nanog-VP16 appears to have induced the ES cells differentiating into primitive endoderm, mesoderm, and even trophectoderm based on these markers. These results suggest that CD2 plays an critical role in mediating Nanog-dependent ES cells self-renewal, which may not be substituted by other transactivation domain. Here we demonstrate that 1) the CD2, a strong transactivator at the C terminus of Nanog, is required for Nanog-mediated ES cell self-renewal; 2) the transactivation activity of CD2 is dependent on aromatic residues; and 3) the self-renewing activity of CD2 cannot be substituted by VP16. These findings are significant for the following reasons: 1) Although Nanog is recognized as a key regulator of ES cell pluripotency and its overexpression alone can sustain ES cell self-renewal independent of LIF, the mechanism of action for Nanog remains undefined. We first reported the transactivation function of Nanog but did not establish the role of transactivation function of Nanog in stem cell self-renewal. In this report, we presented evidence that CD2 activity is required for Nanog mediated self-renewal of ES cells. Our results from Nanog-VP16 appear to suggest that CD2 function in ES cell self-renewal is unique and cannot be replaced by other transactivation domains (Fig. 6). Thus, further delineation of downstream genes regulated by CD2 would greatly enhance our understanding of Nanog-mediated ES cell self-renewal. 2) We were surprised that the most critical residues within CD2 are aromatic residues. As pointed out in our previous reports, CD2 does not have any known structural features found in other transactivation domains and thus may regulate transcription through a distinct mechanism. Our approaches involving N- and C-terminal deletion analysis coupled with point mutagenesis revealed that aromatic residues play a critical role in sustaining CD2 activities. Interestingly, VP16, the most potent transactivator reported so far, utilizes aromatic residues to mediate strong transcription activity (12Regier J.L. Shen F. Triezenberg S.J. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 883-887Crossref PubMed Scopus (226) Google Scholar). Although CD2 and VP16 share little sequence homology, the similar requirement for aromatic residues suggests that they may share a common organizing principle based on aromatic residues. Structural determination of CD2 and VP16 may help to confirm this prediction. 3) By mutating the aromatic residues in CD2, we have generated a Nanog mutant that cannot sustain LIF-independent self-renewal yet does not interfere with the activity of endogenous Nanog. One would have expected that Nanog-CD2-mu1 or -mu2 behave as dominant negative mutants as we demonstrated for Oct4 and Sox2. ES cells expressing both mutants remain pluripotent in the presence of LIF, suggesting that endogenous Nanog functions well in the presence of these two mutants. Our experimental approach exploits the unique property of Nanog in its ability to sustain ES cell self-renewal in the absence of LIF upon overexpression. By quantitative RT-PCR, we estimated that the wild type Nanog transgene is expressed at ∼1× the endogenous level, whereas the mutants at ∼2–3× the endogenous genes (Fig. 1B). Apparently, the level of expression contributed from the wild type Nanog transgene is sufficient to maintain the pluripotency of ES cells in the absence of LIF for the duration of our assay. Interestingly, these ES cells can be induced to undergo differentiation in the presence of RA (data not shown), suggesting that the amount of Nanog contributed by the transgene in our experimental system is insufficient to prevent ES cell differentiation. This observation is in contrast to those originally reported by Chambers et al. (6Chambers I. Colby D. Robertson M. Nichols J. Lee S. Tweedie S. Smith A. Cell. 2003; 113: 643-655Abstract Full Text Full Text PDF PubMed Scopus (2678) Google Scholar) and Matsui et al. (5Mitsui K. Tokuzawa Y. Itoh H. Segawa K. Murakami M. Takahashi K. Maruyama M. Maeda M. Yamanaka S. Cell. 2003; 113: 631-642Abstract Full Text Full Text PDF PubMed Scopus (2604) Google Scholar). This discrepancy may reflect the expression levels of the transgene delivered by the different expression systems (episomal versus integrated). The episome strategy employed by Chambers et al. and Matsui et al. in general can deliver much stronger expression than the integrated approach we adopted. Nevertheless, our results suggest that Nanog function can be analyzed in wild type ES cells upon overexpression at ∼1× that of endogenous level.
'/%3e%3cuse xlink:href='%23a' transform='rotate(23.036 .093 25.536)'/%3e%3cuse xlink:href='%23a' transform='rotate(45.87 1.273 16.18)'/%3e%3cuse xlink:href='%23a' transform='rotate(69.945 .996 12.078)'/%3e%3cuse xlink:href='%23a' transform='rotate(20.66 -19.689 31.932)'/%3e%3c/svg%3e)
