Abstract Background Partial anomalous pulmonary venous connection (PAPVC) is a congenital anomaly disease, which is more common on the right side and rarely involves the left .Turner syndrome(TS)is one of the most common chromosomal abnormalities in humans,and about half of people with TS have congenital or acquired cardiovascular disease.This is the only case of PAPVC with TS in our hospital in more than 70 years, and the disease is extremely rare internationally. We analyzed and studied these two unexpected related diseases from the aspects of clinical diagnosis and surgery, hoping to provide help for the research of TS disease in the cardiovascular field. Case presentation We report an unusual type of bilateral PAPVC, involving the right superior pulmonary veins(RSPV) draining into the superior vena cava(SVC)and the left superior pulmonary veins(LSPV) flowing into the left brachiocephalic vein(LBV) in a young child who was eventually diagnosed with TS.There is an intact intracardiac structure and no other obvious manifestations except for unexplained short stature.The child underwent successful surgery with cardiopulmonary bypass (CPB) support, behaving good recovery and was discharged on 8 days. Conclusions: Our findings identified a novel pattern of pulmonary venous variation in patients with TS and provide new insights in the large vascular neighborhood of the heart.Thanks to advances in image-assisted diagnosis and chromosomal karyotyping, this child was diagnosed at an early stage of the disease, avoiding the occurrence of poor prognosis. We should exclude the presence of PAPVC in TS patients, strengthen the understanding of the disease, develop individualized surgical treatment plan, so as to shun medical errors.
Recently, metabolomic methods have been used to explore the complex pathogenesis of cancer and the mechanism of action of traditional Chinese medicine (TCM) formulae. In this study, first, modified Si Jun Zi Tang (MSJZT) was prepared with strict quality control using the instrument method of ultra performance liquid chromatography and photodiode array detector (UPLC-PDA). Subsequently, in vivo experiments with tumour-bearing nude mice demonstrated that MSJZT exerted good antitumour effects. MSJZT not only significantly increased mouse body weight but also shrank the tumour volume. Then, the HILIC UHPLC-Q-TOF/MS-based metabolomics approach was used for exploring the pathogenesis of gastric cancer and the molecular mechanism of MSJZT. A total of 59 potential biomarkers in plasma were identified, and 6 pathways were found to be disturbed in gastric cancer. In contrast, after 3 weeks of MSJZT intervention, 32 potential biomarkers were identified, and 4 altered pathways were detected. The changes in glycolytic, amino acid, and lipid metabolisms could be partially regulated by MSJZT through decreasing the content of lactic dehydrogenase (LDH), glutamine synthetase (GS), phosphocholine cytidylyltransferase (PCYT2) mRNA, and protein level. In conclusion, we established a HILIC UHPLC-Q-TOF/MS metabolomic analysis method to demonstrate a complex metabolic profile of gastric cancer. The disordered metabolism could be partially regulated by MSJZT. These findings not only establish a solid foundation for TCM to treat gastric cancer but also provide a basis for further exploration of the precise mechanism of MSJZT activity.
Promoter status of O6-methylguanine-DNA methyltransferase (MGMT) has been widely established as a clinically relevant factor in glioblastoma (GBM) patients. However, in addition to varied therapy schedule, the prognosis of GBM patients is also affected by variations of age, race, primary or recurrent tumor. This study comprehensively investigated the association between MGMT promoter status and prognosis in overall GBM patients and in different GBM subtype including new diagnosed patients, recurrent patients and elderly patients.A comprehensive search was performed using PubMed, EMBASE, Cochrane databases to identify literatures (published from January 1, 2005 to April 1, 2017) that evaluated the associations between MGMT promoter methylation and prognosis of GBM patients.Totally, 66 studies including 7,886 patients met the inclusion criteria. Overall GBM patients with a methylated status of MGMT receiving temozolomide (TMZ)-containing treatment had better overall survival (OS) and progression-free survival (PFS) [OS: hazard ratio (HR) = 0.46, 95% confidence interval (CI): 0.41-0.52, p < 0.001, Bon = 0.017; PFS: HR = 0.48, 95% CI 0.40-0.57, p < 0.001, Bon = 0.014], but no significant advantage on OS or PFS in GBM patients with TMZ-free treatment was observed (OS: HR = 0.97, 95% CI 0.91-1.03, p = 0.08, Bon = 1; PFS: HR = 0.76, 95% CI 0.57-1.02, p = 0.068, Bon = 0.748). These different impacts of MGMT status on OS were similar in newly diagnosed GBM patients, elderly GBM patients and recurrent GBM. Among patients receiving TMZ-free treatment, survival benefit in Asian patients was not observed anymore after Bonferroni correction (Asian OS: HR = 0.78, 95% CI 0.64-0.95, p = 0.02, Bon = 0.24, I2 = 0%; PFS: HR = 0.69, 95% CI 0.50-0.94, p = 0.02, Bon = 0.24). No benefit was observed in Caucasian receiving TMZ-free therapy regardless of Bonferroni adjustment.The meta-analysis highlights the universal predictive value of MGMT methylation in newly diagnosed GBM patients, elderly GBM patients and recurrent GBM patients. For elderly methylated GBM patients, TMZ alone therapy might be a more suitable option than radiotherapy alone therapy. Future clinical trials should be designed in order to optimize therapeutics in different GBM subpopulation.
This study aimed to compare the efficiencies of clustered regulatory interspaced short palindromic repeat (CRISPR)/Cas9-mediated gene knock-ins with zinc finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs) in bovine and dairy goat fetal fibroblasts. To test the knock-in efficiency, a set of ZFNs and CRISPR/Cas9 plasmids were designed to edit the bovine myostatin (MSTN) gene at exon 2, while a set of TALENs and CRISPR/Cas9 plasmids were designed for editing the dairy goat β-casein gene at exon 2. Donor plasmids utilizing the ZFNs, TALENs, and CRISPR/Cas9 cutting sites were constructed in the GFP-PGK-NeoR plasmid background, including a 5' and 3' homologous arm flanking the genes humanized Fat-1 (hFat-1) or enhanced green fluorescent protein (eGFP). Subsequently, the ZFNs, TALENs, or CRISPR/Cas9 and the hFat-1 or eGFP plasmids were co-transfected by electroporation into bovine and dairy goat fetal fibroblasts. After G418 (Geneticin) selection, single cells were obtained by mouth pipetting, flow cytometry or a cell shove. The gene knock-in events were screened by PCR across the homologous arms. The results showed that in bovine fetal fibrobalsts, the efficiencies of ZFNs-mediated eGFP and hFat-1 gene knock-ins were 13.68 and 0%, respectively. The efficiencies of CRISPR/Cas9-mediated eGFP and hFat-1 gene knock-ins were 77.02 and 79.01%, respectively. The eGFP gene knock-in efficiency using CRISPR/Cas9 was about 5.6 times higher than when using the ZFNs gene editing system. Additionally, the hFat-1 gene knock-in was only obtained when using the CRISPR/Cas9 system. The difference of knock-in efficiencies between the ZFNs and CRISPR/Cas9 systems were extremely significant (P<0.01). In the dairy goat fetal fibroblasts, the efficiencies of TALENs-mediated eGFP and hFat-1 gene knock-ins were 32.35 and 26.47%, respectively. The efficiencies of eGFP and hFat-1 gene knock-ins using CRISPR/Cas9 were 70.37 and 74.29%, respectively. The knock-in efficiencies difference between the TALENs and CRISPR/Cas9 systems were extremely significant (P<0.01). This study demonstrated that CRISPR/Cas9 was more efficient at gene knock-ins in domesticated animal cells than ZFNs and TALENs. The CRISPR/Cas9 technology offers a new era of precise gene editing in domesticated animal cell lines.
As Th22 subsets are identified, their involvement in the pathogenesis of numerous autoimmune diseases has become apparent. In this study, we investigated differentiation of Th22 cells in the autoimmune thyroid diseases including Hashimoto's thyroiditis (HT) and Graves' disease (GD). Besides, we also explored the involvement of Th22 cells in an iodine-induced autoimmune thyroiditis (AIT) model (i.e., NOD.H-2(h4) mice). In HT patients, we showed the level of circulating Th22 cells correlated with the level of serum IL-22, and was significantly higher than in GD patients and healthy control subjects. Levels of serum IL-6, a major Th22 cell differentiation effector, were also higher in HT, and correlated with Th22 cells concentration. Peripheral blood mononuclear cells isolated from HT patients produced larger amounts of IL-6 in vitro than did those isolated from other groups. Furthermore, unlike those from GD patients, T lymphocytes from HT patients showed an enhanced differentiation in vitro into Th22 cells in the presence of recombinant IL-6 and TNF-α. In addition, levels of circulating Th22 cells and titers of thyroid peroxidase antibody were positively correlated in HT patients. In NOD.H-2(h4) mice, higher numbers of Th22 cells were observed in the spleens of the AIT group, while splenocytes of this group also produced larger amounts of IL-6 and IL-22 in vitro compared with the control. Intra-thyroid infiltrating IL-22+ lymphocytes were significantly increased in mice of the AIT group compared with the control. Our results indicate that Th22 cells may contribute to the pathogenesis of HT.
Microwave pretreatment, as a greener alternative to hot-air roasting, in producing sesame oil was evaluated. Microwaves (900 W) were more time-efficient in generating seed interior porosity and cell destruction while maintaining more husk than hot air (200 ℃, 20 min). The oil yield was improved more by microwaves (+45.72%) than by hot-air roasting (+26.92%). Microwaves facilitated more release of γ-tocopherol in sesame oil (349.3-408.5 mg/kg) than hot air (304.9 mg/kg). Appropriate microwaves (6 min) accelerated the generation of aroma-active heterocyclics, aldehydes, ketones, and phenols in sesame oil, and produced sesame oil with a comparable sensory profile to hot-air roasting. Microwaves reduced concentrations of harman (≤775.17 ng/g), norharman (≤1,069.99 ng/g), and benzo(a)pyrene (≤1.59 μg/g) in sesame oil compared with hot-air roasting (1,319.85 ng/g, 1,168.40 ng/g, and 1.83 μg/g). Prolonged microwaves (10 min) caused a later decrease in aroma-active compounds, pyrolysis of γ-tocopherol, and compromised sensory quality of sesame oil.
Abstract BackgroundX-linked adrenoleukodysrophy (ALD) is an inherited peroxisomal metabolism disorder, results from the loss-of-function mutation of ATP-binding cassette protein subfamily D1 ( ABCD1 ) gene. The dysfunction of ALD protein, a peroxisomal ATP-binding cassette transporter, results in the excessive saturated very long chain fatty acids (VLCFAs) accumulation in organs including brain, spine and adrenal cortex. X-ALD is characterized as the childhood, adolescent, adult cerebral ALD, adrenomyeloneuropathy (AMN), adrenal insufficiency, and asymptomatic phenotypes, exhibiting a high variety of clinical neurological manifestations with or without adrenocortical insufficiency. ResultsIn this study, we reported two cases of X-ALD, which were firstly diagnosed as adrenal insufficiency (Addison’s disease) and treated with adrenocortical supplement. However, both of the cases progressed as neurological symptoms and signs after decades. Elevated VLCFAs level, brain MRI scan and genetic analysis confirmed final diagnosis. In addition, we identified two novel mutations of ABCD1 gene, c.874_876delGAG (p.Glu292del) and c.96_97delCT (p.Tyr33Profs*161) in exon 1 of ABCD1 gene. Sanger sequencing confirmed that the proband’s mother of the first case was hemizygous carrying the same variant. Adrenal insufficiency-only type is very rare, however, it may be the starting performance of X-ALD. In addition, we summarized reported mutation sites and clinical manifestations to investigate the correlationship of phenotype-genotype of X-ALD. ConclusionsThe early warning manifestations should be noticed, and the probability of X-ALD should be considered. This report could be beneficial for the early diagnosis and genetic counseling for patients with X-ALD.
The CRISPR/Cas9 mediates efficient gene editing but has off-target effects inconducive to animal breeding. In this study, the efficacy of CRISPR/Cas9 vectors containing different lengths of gRNA in reduction of the off-target phenomenon in the bovine MSTN gene knockout fibroblast cell lines was assessed, providing insight into improved methods for livestock breeding. A 20-bp gRNA was designed for the second exon of the bovine MSTN gene, and CRISPR/Cas9-B was constructed to guide the Cas9 protein to the AGAACCAGGAGAAGATGGACTGG site. The alternative CRISPR/Cas9-19, CRISPR/Cas9-18, CRISPR/Cas9-17 and CRISPR/Cas9-15 vectors were constructed using gRNAs truncated by 1, 2, 3 and 5 bp, respectively. These vectors were then introduced into bovine fetal fibroblasts by the electroporation method, and single cells were obtained by flow cytometry sorting. PCR was performed for each off-target site. All samples were sequenced and analyzed, and finally the efficiency of each vector in target and off-target sites was compared. The CRISPR/Cas9-B vector successfully knocked out the MSTN gene, but the off-target phenomenon was observed. The efficiencies of CRISPR/Cas-B, CRISPR/Cas9-19, CRISPR/Cas9-18, CRISPR/Cas9-17 and CRISPR/Cas9-15 in triggering gene mutations at MSTN targeting sites were 62.16, 17.39, 7.69, 74.29 and 3.85%, respectively; rates of each at the Off-MSTN-1 locus were 52.86, 0, 0, 8.82 and 0%, respectively; all were 0% at the Off-MSTN-2 locus; rates at the Off-MSTN-3 site were 44.87, 51.72, 86.36, 0 and 50%, respectively. The efficiency of the CRISPR/Cas9-17 plasmid in the MSTN site was higher than that in the CRISPR/Cas9-B plasmid, and the effect at the three off-target sites was significantly lower. This study demonstrated that the CRISPR/Cas9-17 plasmid constructed by truncating 3 bp gRNA can effectively reduce the off-target effect without reducing the efficiency of bovine MSTN gene targeting. This finding will provide more effective gene editing strategy for use of CRISPR/Cas9 technology.
'/%3e%3cuse xlink:href='%23a' transform='rotate(23.036 .093 25.536)'/%3e%3cuse xlink:href='%23a' transform='rotate(45.87 1.273 16.18)'/%3e%3cuse xlink:href='%23a' transform='rotate(69.945 .996 12.078)'/%3e%3cuse xlink:href='%23a' transform='rotate(20.66 -19.689 31.932)'/%3e%3c/svg%3e)