Histone modification is important for maintaining chromatin structure and function. Recently, histone acetylation has been shown to have a critical regulatory role in both transcription and DNA repair. We report here that expression of histone acetyltransferase (HAT) genes is associated with cisplatin resistance. We found that Tip60 is overexpressed in cisplatin-resistant cells. The expression of two other HAT genes, HAT1 and MYST1, did not differ between drug-sensitive and -resistant cells. Knockdown of Tip60 expression rendered cells sensitive to cisplatin but not to oxaliplatin, vincristine, and etoposide. Tip60 expression is significantly correlated with cisplatin sensitivity in human lung cancer cell lines. Interestingly, the promoter region of the Tip60 gene contains several E boxes, and its expression was regulated by the E-box binding circadian transcription factor Clock but not by other E-box binding transcription factors such as c-Myc, Twist, and USF1. Hyperacetylation of H3K14 and H4K16 was found in cisplatin-resistant cells. The microarray study reveals that several genes for DNA repair are down-regulated by the knockdown of Tip60 expression. Our data show that HAT gene expression is required for cisplatin resistance and suggest that Clock and Tip60 regulate not only transcription, but also DNA repair, through periodic histone acetylation. Histone modification is important for maintaining chromatin structure and function. Recently, histone acetylation has been shown to have a critical regulatory role in both transcription and DNA repair. We report here that expression of histone acetyltransferase (HAT) genes is associated with cisplatin resistance. We found that Tip60 is overexpressed in cisplatin-resistant cells. The expression of two other HAT genes, HAT1 and MYST1, did not differ between drug-sensitive and -resistant cells. Knockdown of Tip60 expression rendered cells sensitive to cisplatin but not to oxaliplatin, vincristine, and etoposide. Tip60 expression is significantly correlated with cisplatin sensitivity in human lung cancer cell lines. Interestingly, the promoter region of the Tip60 gene contains several E boxes, and its expression was regulated by the E-box binding circadian transcription factor Clock but not by other E-box binding transcription factors such as c-Myc, Twist, and USF1. Hyperacetylation of H3K14 and H4K16 was found in cisplatin-resistant cells. The microarray study reveals that several genes for DNA repair are down-regulated by the knockdown of Tip60 expression. Our data show that HAT gene expression is required for cisplatin resistance and suggest that Clock and Tip60 regulate not only transcription, but also DNA repair, through periodic histone acetylation. Our research has focused on factors affecting cellular sensitivity of solid tumors to anticancer agents and investigation of promising molecular targets for cancer treatment (1Kohno K. Uchiumi T. Niina I. Wakasugi T. Igarashi T. Momii Y. Yoshida T. Matsuo K. Miyamoto N. Izumi H. Eur. J. Cancer. 2005; 41: 2577-2586Abstract Full Text Full Text PDF PubMed Scopus (70) Google Scholar, 2Torigoe T. Izumi H. Ishiguchi H. Yoshida Y. Tanabe M. Yoshida T. Igarashi T. Niina I. Wakasugi T. Imaizumi T. Momii Y. Kuwano M. Kohno K. Curr. Med. Chem. Anti-Canc. Agents. 2005; 5: 15-27Crossref PubMed Scopus (105) Google Scholar). Among many drugs, cis-diamminechloroplatinum (II) (cisplatin) plays a crucial role in the treatment of various solid tumors (3Zamble D.B. Lippard S.J. Trends Biochem. Sci. 1995; 20: 435-439Abstract Full Text PDF PubMed Scopus (483) Google Scholar, 4Cohen S.M. Lippard S.J. Prog. Nucleic Acids Res. Mol. Biol. 2001; 67: 93-130Crossref PubMed Scopus (555) Google Scholar). Cisplatin has been shown to form a cross-link between adjacent purines in genomic DNA and can cause DNA-damaging signals to induce apoptosis (1Kohno K. Uchiumi T. Niina I. Wakasugi T. Igarashi T. Momii Y. Yoshida T. Matsuo K. Miyamoto N. Izumi H. Eur. J. Cancer. 2005; 41: 2577-2586Abstract Full Text Full Text PDF PubMed Scopus (70) Google Scholar, 2Torigoe T. Izumi H. Ishiguchi H. Yoshida Y. Tanabe M. Yoshida T. Igarashi T. Niina I. Wakasugi T. Imaizumi T. Momii Y. Kuwano M. Kohno K. Curr. Med. Chem. Anti-Canc. Agents. 2005; 5: 15-27Crossref PubMed Scopus (105) Google Scholar). Cisplatin treatment also induces oxidative and endoplasmic reticulum stresses (5Wada T. Penninger J.M. Oncogene. 2004; 23: 2838-2849Crossref PubMed Scopus (1248) Google Scholar). Thus, the nature of cellular sensitivity to cisplatin is highly complex. The development of cisplatin resistance is a major clinical limitation in cancer chemotherapy. Cisplatin resistance is influenced by many factors which affect intracellular drug accumulation (6Fujii R. Mutou M. Niwa K. Yamada K. Akitou T. Nakagawa M. Kuwano M. Akiyama S. Jpn. J. Cancer Res. 1994; 85: 426-433Crossref PubMed Scopus (86) Google Scholar, 7Komatsu M. Sumizawa T. Mutou M. Chen Z.S. Terada K. Furukawa T. Yang X.L. Gao H. Miura N. Sugiyama T. Akiyama S. Cancer Res. 2000; 60: 1312-1316PubMed Google Scholar, 8Nakayama K. Kanzaki A. Ogawa K. Miyazaki K. Neamati N. Takebayashi Y. Int. J. Cancer. 2002; 101: 488-495Crossref PubMed Scopus (128) Google Scholar), increased activity of intracellular thiol production (9Lai G.M. Ozols R.F. Young R.C. Hamilton T.C. J. Natl. Cancer Inst. 1989; 81: 535-539Crossref PubMed Scopus (165) Google Scholar, 10Tew K.D. Cancer Res. 1994; 54: 4313-4320PubMed Google Scholar), and DNA repair (11Chaney S.G. Sancar A. J. Natl. Cancer Inst. 1996; 88: 1346-1360Crossref PubMed Scopus (251) Google Scholar, 12Husain A. He G. Venkatraman E.S. Spriggs D.R. Cancer Res. 1998; 58: 1120-1123PubMed Google Scholar). However, little is known about the molecular mechanisms involved in drug resistance. Cellular factors involved in transcription contribute to the induction of apoptosis or transient or acquired resistance. We have tried to identify the cisplatin-inducible transcription factors and transcription-related factors that are highly expressed in drug-resistant cells (1Kohno K. Uchiumi T. Niina I. Wakasugi T. Igarashi T. Momii Y. Yoshida T. Matsuo K. Miyamoto N. Izumi H. Eur. J. Cancer. 2005; 41: 2577-2586Abstract Full Text Full Text PDF PubMed Scopus (70) Google Scholar, 2Torigoe T. Izumi H. Ishiguchi H. Yoshida Y. Tanabe M. Yoshida T. Igarashi T. Niina I. Wakasugi T. Imaizumi T. Momii Y. Kuwano M. Kohno K. Curr. Med. Chem. Anti-Canc. Agents. 2005; 5: 15-27Crossref PubMed Scopus (105) Google Scholar, 13Murakami T. Shibuya I. Ise T. Chen Z.S. Akiyama S. Nakagawa M. Izumi H. Nakamura T. Matsuo K. Yamada Y. Kohno K. Int. J. Cancer. 2001; 93: 869-874Crossref PubMed Scopus (127) Google Scholar). We have previously shown that expression of activating transcription factor 4 (ATF4) 2The abbreviations used are: ATF4, transcription factor 4; Tip60, human immunodeficiency virus-1-tat interactive protein; HAT, histone acetyltransferase; ERCC1, excision repair cross-complementation group 1; APE1, apurinic/apyrimidinic exonuclease 1; Clock, circadian locomotor output cycles kaput; Bmal1, brain and muscle ARNT-like protein 1; USF1, upstream stimulatory factor 1; MYST1, MYST histone acetyltransferase 1; siRNA, small interference RNA; PCNA, proliferating cell nuclear antigen; ChIP, chromatin immunoprecipitation; HA, hemagglutinin. is inducible by cisplatin treatment and is high in cisplatin-resistant cells (14Tanabe M. Izumi H. Ise T. Chen S.J. Higuchi S. Yamori T. Yasumoto K. Kohno K. Cancer Res. 2003; 63: 8592-8595PubMed Google Scholar). The cellular level of ATF4 expression correlates with cisplatin sensitivity in human lung cancer cell lines. DNA microarray analysis has revealed that ATF4 regulates genes involved in glutathione biosynthesis and conjugation (15Harding H.P. Zhang Y. Zeng H. Novoa I. Lu P.D. Calfon M. Sadri N. Yun C. Popko B. Stojdl D.F. Bell J.C. Hettmann T. Leiden J.M. Ron D. Mol. Cell. 2003; 11: 619-633Abstract Full Text Full Text PDF PubMed Scopus (2410) Google Scholar). Interestingly, we have found that ATF4 gene expression is regulated by the circadian transcription factor Clock, which is also overexpressed in cisplatin-resistant cells (16Igarashi T. Izumi H. Uchiumi T. Nishio K. Arao T. Tanabe M. Uramoto H. Sugio K. Yasumoto K. Sasaguri Y. Wang K.W. Otsuji Y. Kohno K. Oncogene. 2007; 26: 4749-4760Crossref PubMed Scopus (117) Google Scholar). It has recently been shown that histones are periodically acetylated (17Etchegaray J.P. Lee C. Wada P.A. Reppert S.M. Nature. 2003; 421: 177-182Crossref PubMed Scopus (546) Google Scholar) and that Clock is a member of the histone acetyltransferases (18Doi M. Hirayama J. Sassone-Corsi P. Cell. 2006; 125: 497-508Abstract Full Text Full Text PDF PubMed Scopus (665) Google Scholar). Clock seems to have a highly specific enzymatic activity and acetylates histone 3 and histone 4 (19Nakahata Y. Grimaldi B. Sahar S. Hirayama J. Sassone-Corsi P. Curr. Opin. Cell Biol. 2007; 19: 230-237Crossref PubMed Scopus (75) Google Scholar). Acetylation of histone 4 has been shown to be required for repair of DNA double-strand breaks. The yeast human histone acetyltransferases (HAT) Esa1 mutant is defective for NHEJ (non-homologous end joining) and is markedly hypersensitive to DNA-damaging agents, such as camptothecin-11 and methyl methanesulfonate (20Bird A.W. Yu D.Y. Pray-Grant M.G. Qiu Q. Harmon K.E. Megee P.C. Grant P.A. Smith M.M. Christman M.F. Nature. 2002; 419: 411-415Crossref PubMed Scopus (468) Google Scholar). The acetyl-CoA binding motif is found in Clock and shows high sequence similarity to yeast Esa1 and other MYST members. One of the MYST family members, Tip60, has been shown to be involved in DNA repair and apoptosis (21Ikura T. Ogryzko V.V. Grigoriev M. Groisman R. Wang J. Horikoshi M. Scully R. Qin J. Nakatani Y. Cell. 2000; 102: 463-473Abstract Full Text Full Text PDF PubMed Scopus (876) Google Scholar). Through our studies seeking to determine the role of HAT in cisplatin resistance, we found that Tip60, but not HAT1 and MYST1, was overexpressed in cisplatin-resistant cells. Silencing of Tip60 expression effectively sensitized both parental and resistant cells to cisplatin, but not to oxaliplatin, vincristine, and etoposide. These results can open new aspects of cisplatin resistance. Cell Culture—Human epidermoid cancer KB cells and human prostate cancer PC3 cells were cultured in Eagle's minimal essential medium. This medium was purchased from Nissui Seiyaku (Tokyo, Japan) and contained 10% fetal bovine serum. The cisplatin-resistant KB/CP4 and P/CDP6 cells were derived from KB and PC3 cells as described previously (13Murakami T. Shibuya I. Ise T. Chen Z.S. Akiyama S. Nakagawa M. Izumi H. Nakamura T. Matsuo K. Yamada Y. Kohno K. Int. J. Cancer. 2001; 93: 869-874Crossref PubMed Scopus (127) Google Scholar) and were found to be 23–63-fold more resistant to cisplatin than their parental cells (6Fujii R. Mutou M. Niwa K. Yamada K. Akitou T. Nakagawa M. Kuwano M. Akiyama S. Jpn. J. Cancer Res. 1994; 85: 426-433Crossref PubMed Scopus (86) Google Scholar). Eleven lung cancer cell lines were cultured as described previously (14Tanabe M. Izumi H. Ise T. Chen S.J. Higuchi S. Yamori T. Yasumoto K. Kohno K. Cancer Res. 2003; 63: 8592-8595PubMed Google Scholar). Cell lines were maintained in a 5% CO2 atmosphere at 37 °C. Antibodies and Drugs—Antibodies against c-Myc (sc-764), Clock (sc-6927, sc-25361X), USF1 (sc-8983), Tip60 (sc-5727), PCNA (sc-56), HAT1 (sc-8752), MYST1 (sc-13677), Twist (sc-15393), H4K16 (sc-8662), and ERCC1 (sc-10785) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Anti-H3K9 (31388) and anti-H3K14 (30020) antibodies were purchased from Upstate (Charlottesville, VA). Anti-H2AK5 antibody (#2576) and anti-APE1 antibody (#4128) was purchased from Cell Signaling (Danvers, MA). Anti-β-actin antibody (AC-15) was purchased from Sigma. Cisplatin, vincristine, and etoposide were purchased from Sigma. Oxaliplatin was kindly provided from Yakult (Tokyo, Japan). Plasmid Construction—To obtain the full-length complementary DNA (cDNAs) for human Clock and human Bmal1, PCR was carried out on a SuperScript cDNA library (Invitrogen) using the following primer pairs (double underlining indicates the start codons): TTGTTTACCGTAAGCTGTAG and CTACTGTGGTTGAACCTTGGAAG for clock and GCAGACCAGAGAATGGAC and TTACAGCGGCCATGGCAAGTC for Bmal1. These PCR products were cloned into the pGEM-T easy vector (Promega, Madison, WI). To construct a pcDNA3-Bmal1, the EcoRI fragment including Bmal1 cDNA was ligated into a pcDNA3 vector (Invitrogen). To construct a plasmid expressing 3×FLAG-HA-tagged Clock, pcDNA3-FLAG vector was prepared by ligation of BamHI-EcoRI fragment including a 3-times repeat FLAG and HA into a pcDNA3 vector (Invitrogen). pcDNA3-3×FLAG-HA Clock was obtained by ligation of NotI fragment including Clock cDNA into a pcDNA3-3×FLAG-HA vector. The core promoter and partial first exon (-63 to +233) of the wild-type Tip60 gene was amplified by PCR using placenta DNA and the primer pair 5′-AGATCTCACGTGACCCGCTCCGCATACACGTG-3′ and 5′-AAGCTTCCGGCCCCTCTGGGAGACGTCAC-3′. PCR was also performed to introduce the E-box mutations into the Tip60 promoter using the primer pairs 5′-AGATCTACCCGCTCCGCATA-3′ and 5′-AAGCTTCCGGCCCCTCTGGGAGACGTCAC-3′ for MT. Single and double underlined nucleotides indicate wild-type E-boxes and mutated E-boxes, respectively. To prepare Tip60-WT-Luc containing wild-type E-boxes and Tip60-MT-Luc containing mutated E-boxes, these PCR products were cloned and ligated into the BglII-HindIII sites of the pGL3-basic vector (Promega). Western Blot Analysis—Preparation of whole-cell lysates and whole-nuclear lysates have been described previously (16Igarashi T. Izumi H. Uchiumi T. Nishio K. Arao T. Tanabe M. Uramoto H. Sugio K. Yasumoto K. Sasaguri Y. Wang K.W. Otsuji Y. Kohno K. Oncogene. 2007; 26: 4749-4760Crossref PubMed Scopus (117) Google Scholar, 22Wakasugi T. Izumi H. Uchiumi T. Suzuki H. Arao T. Nishio K. Kohno K. Oncogene. 2007; 26: 5194-5203Crossref PubMed Scopus (50) Google Scholar). Briefly, to prepare whole-nuclear lysates, isolated nuclei were directly sonicated for 10 s. The indicated amounts of whole-cell lysates or whole-nuclear lysates were separated by SDS-PAGE (10 or 15% gel). The proteins were transferred to polyvinylidene difluoride microporous membranes (Millipore, Bedford, MA) using a semidry blotter. The blotted membranes were treated with 5% (w/v) skimmed milk in 10 mm Tris, 150 mm NaCl, 0.2% (v/v) Tween 20, and incubated for 2 h at room temperature with a 1:5000 dilution of anti-Clock (sc-6927), USF1, c-Myc, and β-actin antibodies, a 1:2500 dilution of anti-Tip60, HAT1, MYST1, H2AK5, and H4K16 antibodies, a 1:2000 dilution of anti-PCNA, H3K9, and H3K14 antibodies, a 1:1000 dilution of anti-ERCC1 antibody, and a 1:500 dilution of anti-Twist, and APE1 antibodies. The membrane was then incubated with a peroxidase-conjugated secondary antibody for 40 min at room temperature and developed using a chemiluminescence protocol (Amersham Biosciences). Gel staining with Coomassie Brilliant Blue was used as an internal control. Transient Transfection and Luciferase Assay—Transient transfection and a luciferase assay were performed as described previously (16Igarashi T. Izumi H. Uchiumi T. Nishio K. Arao T. Tanabe M. Uramoto H. Sugio K. Yasumoto K. Sasaguri Y. Wang K.W. Otsuji Y. Kohno K. Oncogene. 2007; 26: 4749-4760Crossref PubMed Scopus (117) Google Scholar, 22Wakasugi T. Izumi H. Uchiumi T. Suzuki H. Arao T. Nishio K. Kohno K. Oncogene. 2007; 26: 5194-5203Crossref PubMed Scopus (50) Google Scholar). The indicated amounts of Tip60 reporter plasmid and the expression plasmid were co-transfected using Superfect reagent (Qiagen, Hilden, Germany) according to the manufacturer's instructions. After transfection the cells were cultured for 48 h. Luciferase activity was detected by a Picagene kit (Toyoinki, Tokyo, Japan), and the light intensity was measured with a luminometer (Luminescencer JNII RAB-2300; ATTO) according to the manufacturer's instructions. The results shown are normalized to β-galactosidase activity and are representative of at least three independent experiments. Knockdown Analysis Using Small Interfering RNAs—The following double-stranded RNA 25-base pair oligonucleotides were commercially generated (Invitrogen): Clock small interfering RNA (siRNA), 5′-UAAAGUCUGUUGUUGUAUCAUGUGC-3′ (sense) and 5′-GCACAUGAUACAACAACAGACUUUA-3′ (antisense); Tip60 siRNA, 5′-AUAGUACAGUGUCUUAUGGUCAAGG-3′ (sense) and 5′-CCUUGACCAUAAGACACUGUACUAU-3′ (antisense); HAT1 siRNA, 5′-UAUGAACUGUUUCAAGAAGUUGAGC-3′ (sense) and 5′-GCUCAACUUCUUGAAACAGUUCAUA-3′ (antisense); MYST1 siRNA, 5′-UUGGGCUGUUUCCCAUAGUCUUCGG-3′ (sense) and 5′-CCGAAGACUAUGGGAAACAGCCCAA-3′ (antisense); Twist siRNA, 5′-UUGAGGGUCUGAAUCUUGCUCAGCU-3′ (sense) and 5′-AGCUGAGCAAGAUUCAGACCCUCAA-3′ (antisense); c-Myc siRNA, 5′-UUUGUGUUUCAACUGUUCUCGUCGU-3′ (sense) and 5′-GCACAUGAUACAACAACAGACUUUA-3′ (antisense); USF1 siRNA, 5′-UCACAAAGAAUUGACCAGUGCCAGG-3′ (sense) and 5′-CCUUGACCAUAAGACACUGUACUAU-3′ (antisense). siRNA transfections were performed according to the manufacturer's instructions with modifications (Invitrogen). Ten microliters of Lipofectamine transfection reagent was diluted in 250 μl of Opti-MEM I medium and incubated for 5 min at room temperature. Next, 500 or 250 pmol of Clock, Tip60, HAT1, MYST1, Twist, c-Myc, USF1, and inverted control duplex Stealth RNA (Invitrogen) diluted in 250 μl of Opti-MEM I were added gently and incubated for 20 min at room temperature. Oligomer-Lipofectamine complexes and aliquots of 1 × 106 PC3 cells in 500 μl of culture medium were combined and incubated for 10 min at room temperature. Aliquots of 4 × 102 PC3 cells or 6 × 102 P/CDP6 cells were used for a colony-formation assay as described below. The remaining cells were seeded in 100-mm dishes with 10 ml of culture medium and harvested after 96 h culture for Western blotting, as described above. Chromatin Immunoprecipitation Assay (ChIP)—The ChIP assay was performed as described previously (16Igarashi T. Izumi H. Uchiumi T. Nishio K. Arao T. Tanabe M. Uramoto H. Sugio K. Yasumoto K. Sasaguri Y. Wang K.W. Otsuji Y. Kohno K. Oncogene. 2007; 26: 4749-4760Crossref PubMed Scopus (117) Google Scholar, 22Wakasugi T. Izumi H. Uchiumi T. Suzuki H. Arao T. Nishio K. Kohno K. Oncogene. 2007; 26: 5194-5203Crossref PubMed Scopus (50) Google Scholar). Briefly, soluble chromatin from 1 × 106 PC3 or PCDP6 cells was incubated with 2 μg of anti-Clock antibody (sc-25361X), anti-H3K14 anti-body, anti-H4K16 antibody, and normal goat or rabbit immunoglobulin G (IgG). For transfection experiments, PC3 cells were transiently transfected with 3×FLAG-HA vector or 3×FLAG-HA Clock plasmid and cultured for 48 h as described above. Soluble chromatin from 1 × 106 cells was incubated with 2 μg of anti-FLAG (M2) affinity gel or normal mouse IgG. Immunoprecipitated DNAs with protein A/G-agarose were purified and dissolved in 20 μl of distilled H2O. Each 2 μl of DNA was used for PCR analysis with the following primer pairs; Tip60 #1 (-2586 to -2073), 5′-ATTACAGGAGCGAGCCACTGCGCAC-3′ (forward) and 5′-GGTAACTTCCTGCCGTTGCCATGGC-3′ (reverse); Tip60 #2 (-1336 to -944), 5′-CCCTTGAGCACCTATGCTCAGCCGG-3′ (forward) and 5′-GGCGCGGTGGCTCACGCCTATAATC-3′ (reverse); Tip60 #3 (-467 to +233), 5′-AGATCTAGACCATCCTGGCCAACATGG-3′ (forward) and 5′-AAGCTTCCGGCCCCTCTGGGAGACGTCAC-3′ (reverse); Tip60 #4 (+823 to +1212), 5′-TTCTGGGCCTGAGGTGGGGCATCAG-3′ (forward) and 5′-AGGACTAGCTACTGGACTCTGGGAGC-3′ (reverse). The PCR products were separated by electrophoresis on 2% agarose gels and stained with ethidium bromide. Cytotoxicity Assay—For the colony-formation assay, 4 × 102 PC3 cells or 6 × 102 P/CDP6 cells transfected with siRNA were seeded in 35-mm dishes with 2 ml of culture medium. The following day the cells were treated with indicated concentrations of cisplatin, oxaliplatin, etoposide, and vincristine. After 7 days, the number of colonies was counted. For correlation analysis, we calculated 50% inhibitory concentration (IC50) from the concentration-response curves. RNA Isolation—Total RNA was extracted using Qiagen™ RNeasy Mini kits (Qiagen, Valencia, CA) following the RNeasy mini protocols for isolation from animal cells (I. spin protocol). RNA quality and integrity were determined using the Eukaryote Total RNA Nano 6000 assay (Agilent RNA 6000 Nano LabChip kit) on the Agilent Technologies 2100 Bioanalyzer and quantified by measuring A260 nm on a UV-visible spectrophotometer (ND-1000, NanoDrop Technologies, Rockland, DE). Microarray Studies and Data Analysis—High quality RNA samples (200 ng each) prepared from PC3 cells 72 h after transfection with control or Tip60 siRNA were amplified and labeled with Cy5-and Cy3-CTP (Amersham Biosciences) to produce labeled cRNA using Agilent low RNA input fluorescent linear amplification kits following the manufacturer's protocol. After the amplification and labeling, the dye-incorporation ratio was determined using a Nanodrop spectrophotometer, and the ratios were within 10 to 20 pmol per μg of cRNA, the range the manufacturer suggests before hybridization. For hybridization, 750 ng of cyanine 3- and 750 ng of cyanine 5-labeled cRNA were fragmented and hybridized to an Agilent Technologies Human 1A (V2) Gene Expression Microarray using the Agilent Gene Expression hybridization kit as described in the Two-color Microarray-based Gene Expression Analysis Version 4.0 manual. After hybridization, all microarrays were washed as described in the manual and scanned using the Agilent dual-laser DNA microarray scanner. The scans were converted to data files with Agilent Feature Extraction software (Version 8.5). Data were analyzed using Microsoft Access and Spotfire. The arrays were scanned by the Agilent dual-laser DNA microarray scanner using SureScan technology, extracted by feature Extraction software, and analyzed by Rosetta Resolver® software. An average of three replicate samples was used for each experiment. Statistical Analysis—Expression levels of protein assayed by Western blotting were assessed numerically with the NIH image program (NIH, Bethesda, MD). The Pearson correlation was used for statistical analysis, and significance was set at the 5% level. Tip60 Is Overexpressed in Cisplatin-resistant Cells—HATs are categorized into three groups on the basis of their catalytic domains (23Lee K.K. Workman J.L. Nat. Rev. Mol. Cell Biol. 2007; 8: 284-295Crossref PubMed Scopus (803) Google Scholar). The Gcn5 N-acetyltransferase family includes GCN5 and HAT1. The MYST family is named for the members of HAT family: MOZ, Ybf2, Sas2, and Tip60. Other HATs include p300/CBP (CBP, cAMP-response element-binding protein (CREB)-binding protein) and one of the nuclear receptor co-activators (24Kimura A. Matsubara K. Horikoshi M. J. Biochem. (Tokyo). 2005; 138: 647-662Crossref PubMed Scopus (112) Google Scholar). We first investigated the expression levels of three human HAT genes, Tip60, MYST1, and HAT1, in cisplatin-sensitive and -resistant cells. As shown in Fig. 1, Tip60 was overexpressed in cisplatin-resistant cells when compared with sensitive cells. On the other hand, cellular expression of two HAT genes, MYST1 and HAT1, was almost similar in drug-sensitive and -resistant cells. Although we also examined other proteins, β-actin and PCNA, there was no difference in their expression in drug-sensitive and -resistant cells. Tip60 Silencing Effectively Sensitizes Cells to Cisplatin—To examine whether Tip60 is involved in drug resistance, an siRNA strategy was employed (Fig. 2A). Cisplatin sensitivity was significantly enhanced by the knockdown of Tip60 expression (Fig. 2B). Knockdown of Tip60 expression did not induce cellular sensitivity to vincristine, etoposide, and oxaliplatin (Fig. 2B). We next investigated whether down-regulation of Tip60 expression partially overcomes cisplatin resistance in cisplatin-resistant cell line P/CDP6. As shown in Fig. 2C, down-regulation of Tip60 expression partially overcame cisplatin resistance. We also confirmed that knockdown of other HAT genes, MYST1 and HAT1, did not induce cellular sensitivity to cisplatin (data not shown). Circadian Transcription Factor Clock Regulates Tip60 Gene Expression—To explore the reason why Tip60 was overexpressed in cisplatin-resistant cells, we analyzed the function of the promoter of the Tip60 gene. There are two proximal E-boxes in the core promoter region of the Tip60 gene (see Fig. 4A). We have previously shown that the E-box binding transcription factor Clock is overexpressed in cisplatin-resistant cells (16Igarashi T. Izumi H. Uchiumi T. Nishio K. Arao T. Tanabe M. Uramoto H. Sugio K. Yasumoto K. Sasaguri Y. Wang K.W. Otsuji Y. Kohno K. Oncogene. 2007; 26: 4749-4760Crossref PubMed Scopus (117) Google Scholar). This prompted us to examine whether circadian transcription factor Clock is involved in Tip60 gene expression. Knockdown of Clock expression markedly reduced the expression of Tip60 in two human cancer PC3 and KB cell lines (Fig. 3A). On the other hand, the expression of other E-box binding factors, c-Myc, Twist, and USF1, did not influence the expression of Tip60 (Fig. 3B). The heterodimeric transcription factors Clock/Bmal1 that bind to E-box plays an indispensable role in driving the transcription of target genes. We have introduced the mutation in the two proximal E-boxes of Tip60 promoter as shown in Fig. 4A. The reporter assay showed that cotransfection of both Clock and Bmal1 expression plasmids displayed an 8-fold higher level of luciferase activity. However, no transactivation was observed when the Tip60-MT-Luc was used (Fig. 4B). Furthermore, silencing of Clock expression reduced the promoter activity of the Tip60 gene (Fig. 4C).FIGURE 3Tip60 gene expression is regulated through the E-boxes located in the promoter region by Clock but not by c-Myc, Twist, and USF1. A, control siRNA (100 pmol) or Clock siRNA (100 pmol) were transfected into PC3 cells and KB cells. Fifty μg of whole-nuclear lysates were subjected to SDS-PAGE, and Western blotting was performed with the indicated antibodies. Relative intensity is shown under each blot. B, indicated siRNAs (100 pmol) were transfected into PC3 cells and KB cells. Whole-nuclear lysates (50 μg for c-Myc and USF1, and 100 μg for Twist) were subjected to SDS-PAGE, and Western blotting was performed with the indicated antibodies. Relative intensity is shown under each blot. CBB, Coomassie Brilliant Blue.View Large Image Figure ViewerDownload Hi-res image Download (PPT) Differences in Histone Acetylation in Cisplatin-sensitive and -resistant Cells—It has been shown that Clock is a HAT (18Doi M. Hirayama J. Sassone-Corsi P. Cell. 2006; 125: 497-508Abstract Full Text Full Text PDF PubMed Scopus (665) Google Scholar) and is overexpressed in cisplatin-resistant cells (16Igarashi T. Izumi H. Uchiumi T. Nishio K. Arao T. Tanabe M. Uramoto H. Sugio K. Yasumoto K. Sasaguri Y. Wang K.W. Otsuji Y. Kohno K. Oncogene. 2007; 26: 4749-4760Crossref PubMed Scopus (117) Google Scholar). To determine whether overexpression of Clock and Tip60 leads to enhanced histone acetylation in cisplatin-resistant cells, we performed Western blotting using four acetylated histone-specific antibodies. Hyperacetylation of histones was clearly observed in cisplatin-resistant cells (Fig. 5). Both H3K14 and H4K16 were significantly hyperacetylated in cisplatin-resistant cells in comparison with parental cells. On the other hand, the acetylation of both H2AK5 and H3K9 did not alter between drug-sensitive and -resistant cells. Specificity of both Clock and Tip60 enzymatic activity was investigated by using specific siRNA for Clock and Tip60. Knockdown of Clock expression reduced the acetylation of H3K14 and H4K16, and knockdown of Tip60 expression reduced the acetylation of H4K16 in both cisplatin-sensitive and -resistant cells. The acetylation of both H2AK5 and H3K9 did not alter in cisplatin-sensitive and -resistant cells by using specific siRNA either for Clock or Tip60. Our results indicate that Clock acetylates H3K14 and Tip60 acetylates H4K16 in drug-sensitive and -resistant cells (Fig. 6).FIGURE 6Silencing Clock and Tip60 reduces histone acetylation. PC3 and PC/DP6 cells were transfected with control siRNA (100 pmol), Clock siRNA (100 pmol), and Tip60 siRNA (100 pmol). Whole-nuclear lysates (50 μg for Clock and Tip60) and whole-cell extracts (25 μg for H3K9 and H3K14 and 50 μg for H2AK5 and H4K16) were subjected to SDS-PAGE, and Western blotting was performed with the indicated antibodies. Relative intensity is shown under each blot. CBB, Coomassie Brilliant Blue.View Large Image Figure ViewerDownload Hi-res image Download (PPT) Clock and Acetylated Histone Interaction with the Tip60 Promoter—To determine whether the transactivation of Clock/Bmal1 on the Tip60 promoter was a result of direct recruitment of Clock/Bmal1 to the promoter, we carried out ChIP assays covering different segments of the promoter and 5′ end of the Tip60 gene. Initially, transient transfection of PC3 cells with a 3×FLAG-HA-tagged Clock expression plasmid was used. Forty-eight hours after transfection, a ChIP assay was done with an anti-FLAG antibody. As shown in Fig. 7A, we found that Clock was only present in one segment containing E-boxes. Fig. 7B shows that the endogenous nuclear Clock interaction with the Tip60 promoter element was verified using two selected primer pairs (Tip60 #1 and #3). Anti-Clock antibody specifically coprecipitated the Tip60 promoter fragment containing E-boxes from both PC3 and P/CDP6 cells (Fig. 7C, right panel). We have also investigated the status of H3K14 and H4K16 acetylation associated with the Tip60 promoter. Both PC3 and P/CDP6 cells were subjected to ChIPs with antibodies against acetylated H3K14 and H4K16. Interestingly, it was observed that acetylated H3K14 was markedly bound to the Tip60 promoter when both Tip60 #1 and #3 were used (Fig. 7B, lanes 5). On the other hand, H4K16 acetylation was less evident overall (Fig. 7B, lanes 7). Quantification of the band densities after normalization shows that drug resistant P/CDP6 cells have a significant increase in Clock and acetylated H3K14 binding to the Tip60 promoter compared with PC3 cells (Fig. 7C). Cellular Expression of Tip60 Correlates with Cisplatin Sensitivity—We examined the correlation between Tip60 expression and cisplatin sensitivity in 11 lung cancer cell lines (Fig. 8). Expression of β-actin was also examined as a control (Fig. 8A), because β-actin expression in cisplatin-resistant cells is almost similar to that in parental cells (Fig. 1). Tip60 expression significantly correlated with cisplatin sensitivity (Fig. 8B) and Clock expression (Fig. 8C). We have previously shown that Clock expression correlated with cisplatin sensitivity (16Igarashi T. Izumi H. Uchiumi T. Nishio K. Arao T. Tanabe M. Uramoto H. Sugio K. Yasumoto K. Sasaguri Y. Wang K.W. Otsuji Y. Kohno K. Oncogene. 2007; 26: 4749-4760Crossref PubMed Scopus (117) Google Scholar). Microarray Analysis of Tip60-regulated Genes—Because the available information regarding the Tip60 target genes is limited, we used microarray technology. To investigate the transcriptional changes by the Tip60 siRNA, DNA microarray study was carried out in PC3 cells treated with control or Tip60 siRNA. Data analysis identified 1091 genes, which were down-regulated more than 2-fold, and 1150 genes, which were up-regulated (data not shown). Among down-regulated genes, several genes involved in DNA repair was identified (Table 1). It was reported that ERCC1 was one of the key molecules to determine the cellular sensitivity of cisplatin (25Olaussen K.A. Dunant A. Fouret P. Brambilla E. Andre F. Haddad V. Taranchon E. Filipits M. Pirker R. Popper H.H. Stahel R. Sabatier L. Pignon J.P. Tursz T. Le Chevalier T. Soria J.C. N. Engl. J. Med. 2006; 355: 983-991Crossref PubMed Scopus (1570) Google Scholar, 26Takenaka T. Yoshino I. Kouso H. Ohba T. Yohena T. Osoegawa A. Shoji F. Maehara Y. Int. J. Cancer. 2007; 121: 895-900Crossref PubMed Scopus (101) Google Scholar). To evaluate the microarray study, we selected two genes and examine their expression by Western blot analysis. Both ERCC1 and APE1 (27Daniel R.M. David M.W. Mol. Cancer Res. 2007; 5: 61-70Crossref PubMed Scopus (76) Google Scholar) were significantly down-regulated by the Tip60 siRNA (Fig. 9A). Furthermore, the expression of these genes was significantly up-regulated in cisplatin-resistant cells (Fig. 9B).TABLE 1List of DNA repair genes regulated by Tip60 DNA microarray analysis of Tip60-regulated genes was investigated. Oligonucleotide microarray study was carried out in PC3 cells treated with Tip60 siRNA (100 pmol) or control siRNA (100 pmol). Data analysis identified 1091 genes, which were down-regulated more than 2.0-fold. The subset of DNA repair genes was further selected if fold change marked >2.0 between averaged Tip60 siRNA and control siRNA samples.Gene nameAccession number-Fold change of Tip60 siRNA compared with control siRNACommentALKBH7NM_032306–2.53AlkB, alkylation repair homolog 7 (Escherichia coli)APEX1NM_080649–2.52APEX nuclease (multifunctional DNA repair enzyme) 1 (APE1)MPGNM_002434–2.36N-Methylpurine-DNA glycosylasePNKPNM_007254–2.32Polynucleotide kinase 3′-phosphataseSMUG1NM_014311–3.93Single-strand-selective monofunctional uracil-DNA glycosylase 1DDB1NM_001923–2.10Damage-specific DNA-binding protein 1POLINM_007195–2.24DNA polymerases (catalytic subunits)HTATIPNM_006388–2.78Human immunodeficiency virus-1 tat-interacting protein (Tip60)N4BP2NM_018177–2.02Nedd4-binding protein 2ERCC1NM_001983–2.15Excision repair cross-complementing rodent repair deficiency, complementation group 1ERCC2NM_000400–2.59Excision repair cross-complementing rodent repair deficiency, complementation group 2ERCC5NM_000123–2.33Excision repair cross-complementing rodent repair deficiency, complementation group 5RAD54BAF007866–2.09RAD54 homolog B (Saccharomyces cerevisiae)TDGNM_003211–2.61Thymine-DNA glycosylase Open table in a new tab Alterations in transcription are thought to play a major role in tumorigenesis as well as in tumor response and resistance to anticancer agents (1Kohno K. Uchiumi T. Niina I. Wakasugi T. Igarashi T. Momii Y. Yoshida T. Matsuo K. Miyamoto N. Izumi H. Eur. J. Cancer. 2005; 41: 2577-2586Abstract Full Text Full Text PDF PubMed Scopus (70) Google Scholar, 2Torigoe T. Izumi H. Ishiguchi H. Yoshida Y. Tanabe M. Yoshida T. Igarashi T. Niina I. Wakasugi T. Imaizumi T. Momii Y. Kuwano M. Kohno K. Curr. Med. Chem. Anti-Canc. Agents. 2005; 5: 15-27Crossref PubMed Scopus (105) Google Scholar). Our objective was to identify transcription-related factors whose expression was up-regulated and involved in cisplatin resistance (1Kohno K. Uchiumi T. Niina I. Wakasugi T. Igarashi T. Momii Y. Yoshida T. Matsuo K. Miyamoto N. Izumi H. Eur. J. Cancer. 2005; 41: 2577-2586Abstract Full Text Full Text PDF PubMed Scopus (70) Google Scholar, 2Torigoe T. Izumi H. Ishiguchi H. Yoshida Y. Tanabe M. Yoshida T. Igarashi T. Niina I. Wakasugi T. Imaizumi T. Momii Y. Kuwano M. Kohno K. Curr. Med. Chem. Anti-Canc. Agents. 2005; 5: 15-27Crossref PubMed Scopus (105) Google Scholar, 13Murakami T. Shibuya I. Ise T. Chen Z.S. Akiyama S. Nakagawa M. Izumi H. Nakamura T. Matsuo K. Yamada Y. Kohno K. Int. J. Cancer. 2001; 93: 869-874Crossref PubMed Scopus (127) Google Scholar). Recently, we have reported that the circadian transcription factor Clock is overexpressed in cisplatin-resistant cells (16Igarashi T. Izumi H. Uchiumi T. Nishio K. Arao T. Tanabe M. Uramoto H. Sugio K. Yasumoto K. Sasaguri Y. Wang K.W. Otsuji Y. Kohno K. Oncogene. 2007; 26: 4749-4760Crossref PubMed Scopus (117) Google Scholar). Clock has recently been found to have intrinsic HAT activity (18Doi M. Hirayama J. Sassone-Corsi P. Cell. 2006; 125: 497-508Abstract Full Text Full Text PDF PubMed Scopus (665) Google Scholar). The HAT activity is required to activate Clock/Bmal1-dependent transcription. Thus, Clock may promote Clock/Bmal1-dependent transcription by forming active chromatin and increasing the accessibility of transcriptional cofactors to the promoter region. Tip60 was originally identified as a cellular acetyltransferase that interacts with human immunodeficiency virus-1 Tat protein (28Kamine J. Elangovan B. Subramanian T. Coleman D. Chinnadurai G. Virology. 1996; 216: 357-366Crossref PubMed Scopus (242) Google Scholar). Furthermore, Tip60 exists as a multimeric protein complex on chromatin and has been shown to be involved in DNA damage response and repair (20Bird A.W. Yu D.Y. Pray-Grant M.G. Qiu Q. Harmon K.E. Megee P.C. Grant P.A. Smith M.M. Christman M.F. Nature. 2002; 419: 411-415Crossref PubMed Scopus (468) Google Scholar, 29Squatrito M. Gorrini C. Amati B. Trends Cell Biol. 2006; 16: 433-442Abstract Full Text Full Text PDF PubMed Scopus (244) Google Scholar). These findings prompted us to test the hypothesis that HAT gene expression might affect cellular sensitivity to DNA-damaging agents including cisplatin. In the present study we investigated which HATs are involved in modifying cellular sensitivity to anticancer agents and drug resistance. We found that Tip60 was overexpressed in cisplatin-resistant cells, but MYST1 and HAT1 were not (Fig. 1). We have previously shown that down-regulation of the cellular expression of the Clock protein conferred cisplatin and etoposide sensitivity to human lung cancer cell lines (16Igarashi T. Izumi H. Uchiumi T. Nishio K. Arao T. Tanabe M. Uramoto H. Sugio K. Yasumoto K. Sasaguri Y. Wang K.W. Otsuji Y. Kohno K. Oncogene. 2007; 26: 4749-4760Crossref PubMed Scopus (117) Google Scholar). Here, we also found that Tip60 expression correlated well with cisplatin sensitivity (Fig. 8B). However, down-regulation of Tip60 expression conferred only cisplatin sensitivity (Fig. 2B), which suggests a different mechanism through which either Clock or Tip60 modifies drug sensitivity. Several mechanisms are involved in the acquisition of cisplatin resistance including decreased cisplatin accumulation, increased levels of cellular glutathione, and increased DNA repair activity. These supported that the knockdown of Tip60 expression by Tip60 siRNA showed only a small effect on the cellular sensitivity of cisplatin (Fig. 2, B and C). We have previously shown that ATF4 is a target of Clock, and the Clock and ATF4 transcription system plays an important role in multidrug resistance through a glutathione-dependent redox system (16Igarashi T. Izumi H. Uchiumi T. Nishio K. Arao T. Tanabe M. Uramoto H. Sugio K. Yasumoto K. Sasaguri Y. Wang K.W. Otsuji Y. Kohno K. Oncogene. 2007; 26: 4749-4760Crossref PubMed Scopus (117) Google Scholar). The knockdown of Tip60 expression also showed a similar effect on the cellular sensitivity in drug-sensitive cell. DNA microarray analysis showed several DNA repair genes are regulated by the Tip60 expression (Table 1). As shown in Fig. 8, both ERCC1 and APE1 gene are regulated by Tip60. To investigate the molecular mechanism of the enhanced expression of Tip60 in cisplatin-resistant cells, we surveyed the transcription factor binding sites in the promoter region using the human genome data base. There are two proximal E-boxes in the core promoter region of the Tip60 gene (Fig. 4A). We found that the Tip60 gene is a target of Clock but not of the other E-box binding factors, such as Twist, c-Myc, and USF1 (Fig. 3B). The ChIP assay also supports these results (Fig. 7). Our results indicate that Tip60 might also be involved in rhythmic histone acetylation. Histone acetylation in cisplatin-resistant cells is supposed to be regulated by Clock and Tip60. We found that both H3K14 and H4K16 were highly acetylated in cisplatin-resistant cells (Fig. 5). It has been shown that Clock can acetylate H3K14 well (19Nakahata Y. Grimaldi B. Sahar S. Hirayama J. Sassone-Corsi P. Curr. Opin. Cell Biol. 2007; 19: 230-237Crossref PubMed Scopus (75) Google Scholar) and that Tip60 acetylates H2A and H4 (23Lee K.K. Workman J.L. Nat. Rev. Mol. Cell Biol. 2007; 8: 284-295Crossref PubMed Scopus (803) Google Scholar, 29Squatrito M. Gorrini C. Amati B. Trends Cell Biol. 2006; 16: 433-442Abstract Full Text Full Text PDF PubMed Scopus (244) Google Scholar), which indicates that H4K16 may be catalyzed by Tip60. Our results using siRNA for Clock and Tip60 are consistent with those in previous studies (Fig. 6). The acetylation of H3K14 has been shown to be involved in transcriptional activation (19Nakahata Y. Grimaldi B. Sahar S. Hirayama J. Sassone-Corsi P. Curr. Opin. Cell Biol. 2007; 19: 230-237Crossref PubMed Scopus (75) Google Scholar). It has been shown that the acetylation of H4K16 may contribute to the decondensation of chromatin (30Shogren-Knaak M. Ishii H. Sun J.M. Pazin M.J. Davie J.R. Peterson C.L. Science. 2006; 311: 844-847Crossref PubMed Scopus (1406) Google Scholar). As shown in Fig. 7, the ChIP assays demonstrate evidence of high Clock binding and H3K9 acetylation at the Tip60 promoter in drug-resistant cells, implicating a more open state of chromatin primed for transcription. Based on these data, Clock overexpression might be involved in maintaining transcription-permissive chromatin structure through H3K14 acetylation, and Tip60 might be involved in establishing DNA-repair-permissive chromatin structure in cisplatin-resistant cells. Thus, our results stress the positive role that the HAT function of both Clock and Tip60 contribute to drug resistance. In conclusion, we established that both Clock and Tip60 are required for cisplatin resistance. Our data also suggest that Tip60 may play a role in circadian clock function. Our study begins to offer molecular insight into the circadian regulation of genomic response against anticancer agents and drug sensitivity through histone acetylation. We thank Satoko Takazaki and Yukiko Yoshiura for technical assistance.
Circadian clocks impact vital cardiac parameters such as blood pressure and heart rate, and adverse cardiac events such as myocardial infarction and sudden cardiac death. In mammals, the central circadian pacemaker, located in the suprachiasmatic nucleus of the hypothalamus, synchronizes cellular circadian clocks in the heart and many other tissues throughout the body. Cardiac ventricle explants maintain autonomous contractions and robust circadian oscillations of clock gene expression in culture. In the present study, we examined the relationship between intrinsic myocardial function and circadian rhythms in cultures from mouse heart. We cultured ventricular explants or dispersed cardiomyocytes from neonatal mice expressing a PER2::LUC bioluminescent reporter of circadian clock gene expression. We found that isoproterenol, a β-adrenoceptor agonist known to increase heart rate and contractility, also amplifies PER2 circadian rhythms in ventricular explants. We found robust, cell-autonomous PER2 circadian rhythms in dispersed cardiomyocytes. Single-cell rhythms were initially synchronized in ventricular explants but desynchronized in dispersed cells. In addition, we developed a method for long-term, simultaneous monitoring of clock gene expression, contraction rate, and basal intracellular Ca2+ level in cardiomyocytes using PER2::LUC in combination with GCaMP3, a genetically encoded fluorescent Ca2+ reporter. In contrast to robust PER2 circadian rhythms in cardiomyocytes, we detected no rhythms in contraction rate and only weak rhythms in basal Ca2+ level. In summary, we found that PER2 circadian rhythms of cardiomyocytes are cell-autonomous, amplified by adrenergic signaling, and synchronized by intercellular communication in ventricle explants, but we detected no robust circadian rhythms in contraction rate or basal Ca2+.
In mammals, circadian rhythms are driven by a pacemaker located in the suprachiasmatic nucleus (SCN) of the hypothalamus. We measured the rhythm of arginine vasopressin release in rat organotypic SCN slices following application of tetrodotoxin (TTX) or N-methyl-D-aspartate (NMDA) at various times throughout the circadian cycle. TTX resets the clock in a manner similar to dark pulses. A 4-h application of TTX starting in mid subjective day, at around circadian time (CT) 7.0, induced phase advances, while TTX treatment started in early subjective morning, at about CT 2.0, induced phase delays. On the other hand, NMDA resets the clock in a manner similar to a light pulse; that is, NMDA treatment in the early evening induced phase delays while treatment in the late night induced phase advances. The data indicate that deprivation of neuronal firing changes the circadian rhythm.
Fibroblast growth factor 10 (FGF10) is involved in eye, meibomian, and lacrimal gland (LG) development, but its function in adult eye structures remains unknown. This study aimed to characterize the role of FGF10 in homeostasis and regeneration of adult LG and corneal epithelium proliferation.Quantitative reverse transcription PCR was used for analysis of FGF10 expression in both early postnatal and adult mouse LG, and RNA sequencing was used to analyze gene expression during LG inflammation. FGF10 was injected into the LG of two mouse models of Sjögren's syndrome and healthy controls. Flow cytometry, BrdU cell proliferation assay, immunostaining, and hematoxylin and eosin staining were used to evaluate the effects of FGF10 injection on inflammation and cell proliferation in vivo. Mouse and human epithelial cell cultures were treated with FGF10 in vitro, and cell viability was assessed using WST-8 and adenosine triphosphate (ATP) quantification assays.The level of Fgf10 mRNA expression was lower in adult LG compared to early postnatal LG and was downregulated in chronic inflammation. FGF10 injection into diseased LGs significantly increased cell proliferation and decreased the number of B cells. Mouse and human corneal epithelial cell cultures treated with FGF10 showed significantly higher cell viability and greater cell proliferation.FGF10 appears to promote regeneration in damaged adult LGs. These findings have therapeutic potential for developing new treatments for dry eye disease targeting the ability of the cornea and LG to regenerate.
Tryptophan 5-hydroxylase was partially purified from rat small intestine and characterized. The enzyme activity was mainly localized in the distal one-fourth of the small intestine. The enzyme required Fe(2+), 2-amino-4-hydroxy-6,7-dimethyl-5,6,7,8-tetrahydropteridine and oxygen for full activity. The pH optimum of the reaction was 8.0. The hydroxylation rate of d-tryptophan by the enzyme was one-third that of l-tryptophan. l-Phenylalanine and l-tyrosine could not serve as substrates. The physiological significance of the enzyme is discussed.
