The triaxial gyro stabilized platform is widely used in military fields such as airborne and shipborne, as well as civil fields such as public security and fire control. It has the function of ensuring the visual axis stability of photoelectric equipment on the moving carrier. This paper proposes a method to solve the problems of forward design shortage and algorithm verification difficulty of triaxial gyro stabilized platform, establish the state space equation through the analysis of the kinematics and dynamics equations of platform, modeling and simulation analysis are done using Simulink toolbox in MATLAB and S -Function for the stability loop, position loop, speed loop three-loop control structure used in the design, the system response of different input signals is simulated .The establishment of the control model and algorithm simulation verification provide reliable theoretical support and basis for algorithm research in practical engineering, and have a strong guiding role for system design.
This study aimed to compare the efficiencies of clustered regulatory interspaced short palindromic repeat (CRISPR)/Cas9-mediated gene knock-ins with zinc finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs) in bovine and dairy goat fetal fibroblasts. To test the knock-in efficiency, a set of ZFNs and CRISPR/Cas9 plasmids were designed to edit the bovine myostatin (MSTN) gene at exon 2, while a set of TALENs and CRISPR/Cas9 plasmids were designed for editing the dairy goat β-casein gene at exon 2. Donor plasmids utilizing the ZFNs, TALENs, and CRISPR/Cas9 cutting sites were constructed in the GFP-PGK-NeoR plasmid background, including a 5' and 3' homologous arm flanking the genes humanized Fat-1 (hFat-1) or enhanced green fluorescent protein (eGFP). Subsequently, the ZFNs, TALENs, or CRISPR/Cas9 and the hFat-1 or eGFP plasmids were co-transfected by electroporation into bovine and dairy goat fetal fibroblasts. After G418 (Geneticin) selection, single cells were obtained by mouth pipetting, flow cytometry or a cell shove. The gene knock-in events were screened by PCR across the homologous arms. The results showed that in bovine fetal fibrobalsts, the efficiencies of ZFNs-mediated eGFP and hFat-1 gene knock-ins were 13.68 and 0%, respectively. The efficiencies of CRISPR/Cas9-mediated eGFP and hFat-1 gene knock-ins were 77.02 and 79.01%, respectively. The eGFP gene knock-in efficiency using CRISPR/Cas9 was about 5.6 times higher than when using the ZFNs gene editing system. Additionally, the hFat-1 gene knock-in was only obtained when using the CRISPR/Cas9 system. The difference of knock-in efficiencies between the ZFNs and CRISPR/Cas9 systems were extremely significant (P<0.01). In the dairy goat fetal fibroblasts, the efficiencies of TALENs-mediated eGFP and hFat-1 gene knock-ins were 32.35 and 26.47%, respectively. The efficiencies of eGFP and hFat-1 gene knock-ins using CRISPR/Cas9 were 70.37 and 74.29%, respectively. The knock-in efficiencies difference between the TALENs and CRISPR/Cas9 systems were extremely significant (P<0.01). This study demonstrated that CRISPR/Cas9 was more efficient at gene knock-ins in domesticated animal cells than ZFNs and TALENs. The CRISPR/Cas9 technology offers a new era of precise gene editing in domesticated animal cell lines.
The Arbas cashmere goat is a unique biological resource that plays a vital role in livestock husbandry in China. LCDM is a medium with special small molecules (consisting of human LIF, CHIR99021, (S)-(+)-dimethindene maleate, and minocycline hydrochloride) for generation pluripotent stem cells (PSCs) with bidirectional developmental potential in mice, humans, pigs, and bovines. However, there is no report on whether LCDM can support for generation of PSCs with the same ability in Arbas cashmere goats. In this study, we applied LCDM to generation goat induced PSCs (giPSCs) from goat fetal fibroblasts (GFFs) by reprogramming. The derived giPSCs exhibited stem cell morphology, expressing pluripotent markers, and could differentiate into three germ layers. Moreover, the giPSCs differentiated into the trophectoderm lineage by spontaneous and directed differentiation in vitro. The giPSCs contributed to embryonic and extraembryonic tissue in preimplantation blastocysts and postimplantation chimeric embryos. RNA-sequencing analysis showed that the giPSCs were very close to goat embryos at the blastocyst stage and giPSCs have similar properties to typical extended PSCs (EPSCs). The establishment of giPSCs with LCDM provides a new way to generate high quality of PSCs from domestic animals and lays the foundation for basic and applied research in biology and agriculture.
The contrasting trials of the growth period, the yield of fruit body and the morphological characteristics in the five introduced Pleurotus nebrodensis strains and the Pn622 strains isolated from primordiuna tissue growing on the PDA media were carried out.As a result,the growth period of the Pn622 strain was 11 days ahead of time and the yield of its fruitbody increased by 11.76 % compared with that of its parental strain Pn6,and 8.88 %-70.40 % compared with that of the other four strains.The result showed that the Pn622 strain was a good commercial culture strain.The six Pleurotus nebrodensis strains were grouped on fruitbodys morphological characteristics into two categories: the palmate type and the long-stipe-funnel type. Meanwhile,the ITS45 sequence of Pn622 strain was analyzed and the molecular marker of ITS sequence was established.
Trophoblast stem cells (TSCs), the precursors of placental cells, are effective for studying placental formation in vitro. Using a dual inhibition (2i) medium and mixed L-Wnt3a/mouse embryonic fibroblast feeder cells, we previously established the bovine trophoblast cell line BTS-1. In this study, we used bovine fetal fibroblasts and added Wnt3a to the 2i medium to establish another bovine TSC line (BTSW). BTSW cells expressed pluripotency markers, including NANOG, SOX2, OCT4, TRA-1-60, TRA-1-81, SSEA4, CDH1, and KRT18, and TSC markers CDX2, TEAD4, and ESRRB. Methylation sequencing of the promoter regions of NANOG, OCT4, and CDX2 revealed no significant differences between BTS-1 and BTSW cells. Removal of Wnt3a from the culture medium resulted in downregulation (p < 0.05) of NANOG, OCT4, CDX2, and TSC marker genes, and upregulation of TSC differentiation markers, including MASH2, GCM1, and PAG. Western blotting indicated activation of the WNT-YAP/TAZ signaling pathway in BTS-1 and BTSW cells, consequently activating TEAD4 transcription. However, this pathway was not activated in BCFF cells, an established bovine embryonic stem-like cell line that expresses OCT4, SOX2, and NANOG, but not CDX2. Thus, Wnt3a may play a critical role in bovine TSC maintenance by activating and regulating CDX2 expression through the WNT-YAP/TAZ signaling pathway.
The CRISPR/Cas9 mediates efficient gene editing but has off-target effects inconducive to animal breeding. In this study, the efficacy of CRISPR/Cas9 vectors containing different lengths of gRNA in reduction of the off-target phenomenon in the bovine MSTN gene knockout fibroblast cell lines was assessed, providing insight into improved methods for livestock breeding. A 20-bp gRNA was designed for the second exon of the bovine MSTN gene, and CRISPR/Cas9-B was constructed to guide the Cas9 protein to the AGAACCAGGAGAAGATGGACTGG site. The alternative CRISPR/Cas9-19, CRISPR/Cas9-18, CRISPR/Cas9-17 and CRISPR/Cas9-15 vectors were constructed using gRNAs truncated by 1, 2, 3 and 5 bp, respectively. These vectors were then introduced into bovine fetal fibroblasts by the electroporation method, and single cells were obtained by flow cytometry sorting. PCR was performed for each off-target site. All samples were sequenced and analyzed, and finally the efficiency of each vector in target and off-target sites was compared. The CRISPR/Cas9-B vector successfully knocked out the MSTN gene, but the off-target phenomenon was observed. The efficiencies of CRISPR/Cas-B, CRISPR/Cas9-19, CRISPR/Cas9-18, CRISPR/Cas9-17 and CRISPR/Cas9-15 in triggering gene mutations at MSTN targeting sites were 62.16, 17.39, 7.69, 74.29 and 3.85%, respectively; rates of each at the Off-MSTN-1 locus were 52.86, 0, 0, 8.82 and 0%, respectively; all were 0% at the Off-MSTN-2 locus; rates at the Off-MSTN-3 site were 44.87, 51.72, 86.36, 0 and 50%, respectively. The efficiency of the CRISPR/Cas9-17 plasmid in the MSTN site was higher than that in the CRISPR/Cas9-B plasmid, and the effect at the three off-target sites was significantly lower. This study demonstrated that the CRISPR/Cas9-17 plasmid constructed by truncating 3 bp gRNA can effectively reduce the off-target effect without reducing the efficiency of bovine MSTN gene targeting. This finding will provide more effective gene editing strategy for use of CRISPR/Cas9 technology.
Objective To observe the efficacy of anti-Helicobacter pylori in treating chronic gastritis with iron deficiency anemia. Methods One hundred and thirty-six patients with chronic gastritis with iron deficiency anemia were divided into observation group and control group. Sixty-nine cases in observation group were treated with anti-Helicobacter pylori plus chalybeate, while sixty-seven cases in control group were treated with chalybeate only. The two groups all were treated for two weeks. Hemoglobin was rechecked every two weeks after treatment,serum iron and serum ferritin were rechecked in the eighth week and twelfth week after treatment. Then the curative effect was compared between two groups. Results After 8 and 12 weeks for treatment,hemoglobin,serum iron and serum ferritin increased significantly in the two groups compared with before treatment( P 0. 05) ,and the three indexes in observation group were higher than those in control group( P 0. 05) . The total effective rate of the observation group was 82. 6% which was higher than that in the control group( 53. 7% ) ( P 0. 05) . Conclusion Eradication of Helicobacter pylori infection can increase inventory of iron and it can cure chronic gastritis with iron deficiency anemia efficiently.
The trophoblast (TR) is the first to differentiate during mammalian embryogenesis and play a pivotal role in the development of the placenta. We used a dual inhibitor system (PD0325901 and CHIR99021) with mixed feeders to successfully obtain bovine trophoblast stem-like (bTS) cells, which were similar in phenotype to mouse trophoblast stem cells (TSCs). The bTS cells that were generated using this system continually proliferated, displayed a normal diploid karyotype, and had no signs of altered morphology or differentiation even after 150 passages. These cells exhibited alkaline phosphatase (AP) activity and expressed pluripotency markers, such as OCT4, NANOG, SOX2, SSEA-1, SSEA-4, TRA-1-60, and TRA-1-81, and TR lineage markers such as CDX2, as determined by both immunofluorescence and reverse transcription-polymerase chain reaction (RT-PCR). Additionally, these cells generated dome-like structures, formed teratomas when injected into NOD-SCID mice, and differentiated into placenta TR cells in vitro. The microarray analysis of bTS cells showed high expression levels of many TR markers, such as TEAD4, EOMES, GATA3, ETS2, TFAP2A, ELF5, SMARCA4 (BRG1), CDH3, MASH2, HSD17B1, CYP11A1, PPARG, ID2, GCM1, HAND1, TDK, PAG, IFN-τ, and THAP11. The expression of many pluripotency markers, such as OCT4, SOX2, NANOG, and GDF3, was lower in bTS cells compared with in vitro-produced blastocysts; however, compared with bovine fetal fibroblasts, the expression of these pluripotency markers was elevated in bTS cells. The DNA methylation status of the promoter regions of OCT4, NANOG, and SOX2 was investigated, which were significantly higher in bTS cells (OCT4 23.90%, NANOG 74.40%, and SOX2 8.50%) compared with blastocysts (OCT4 8.90%, NANOG 34.4%, and SOX2 3.80%). In contrast, two promoter regions of CDX2 were hypomethylated in bTS cells (13.80% and 3.90%) compared with blastocysts (18.80% and 9.10%). The TSC lines that were established in this study may be used either for basic research that is focused on peri-implantation and placenta development or as donor cells for transgenic animal production.
'/%3e%3cuse xlink:href='%23a' transform='rotate(23.036 .093 25.536)'/%3e%3cuse xlink:href='%23a' transform='rotate(45.87 1.273 16.18)'/%3e%3cuse xlink:href='%23a' transform='rotate(69.945 .996 12.078)'/%3e%3cuse xlink:href='%23a' transform='rotate(20.66 -19.689 31.932)'/%3e%3c/svg%3e)
'/%3e%3c/defs%3e%3cpath fill='%23012169' d='M0 0h10080v5040H0z'/%3e%3cpath stroke='%23fff' stroke-width='.6' d='m0 0 6 3m0-3L0 3' clip-path='url(%23b)' transform='scale(840)'/%3e%3cpath stroke='%23e4002b' stroke-width='.4' d='m0 0 6 3m0-3L0 3' clip-path='url(%23c)' transform='scale(840)'/%3e%3cpath stroke='%23fff' stroke-width='840' d='M2520 0v2520M0 1260h5040'/%3e%3cpath stroke='%23e4002b' stroke-width='504' d='M2520 0v2520M0 1260h5040'/%3e%3cg fill='%23fff'%3e%3cuse xlink:href='%23d' x='2520' y='3780'/%3e%3cuse xlink:href='%23a' x='7560' y='4200'/%3e%3cuse xlink:href='%23a' x='6300' y='2205'/%3e%3cuse xlink:href='%23a' x='7560' y='840'/%3e%3cuse xlink:href='%23a' x='8680' y='1869'/%3e%3cuse xlink:href='%23e' x='8064' y='2730'/%3e%3c/g%3e%3c/svg%3e)