Content-centric networking (CCN) is designed for efficient dissemination of information. Several architectures are proposed for CCN recently, but mobility issues are not considered sufficiently. We classify traffic types of CCN into real-time and non real-time. We examine mobility problems for each type, and suggest the possible hand-off schemes over CCN. Then, we analyze the delay performance in terms of simulation study. We believe that the proposed schemes can be merged as a part of the CCN easily, since they comply with the inherent nature and rules of the CCN.
Flap endonuclease 1 (FEN1) is the enzyme responsible for specifically removing the flap structure produced during DNA replication, repair, and recombination. Here we report that the human replication factor C (RFC) complex stimulates the nuclease activity of human FEN1 in an ATP-independent manner. Although proliferating cell nuclear antigen is also known to stimulate FEN1, less RFC was required for comparable FEN1 stimulation. Kinetic analyses indicate that the mechanism by which RFC stimulates FEN1 is distinct from that by proliferating cell nuclear antigen. Heat-denatured RFC or its subunit retained, fully or partially, the ability to stimulate FEN1. Via systematic deletion analyses, we have defined three specific regions of RFC4 capable of stimulating FEN1. The region of RFC4 with the highest activity spans amino acids 170–194 and contains RFC box VII. Four amino acid residues (i.e. Tyr-182, Glu-188, Pro-189, and Ser-192) are especially important for FEN1 stimulatory activity. Thus, RFC, via several stimulatory motifs per molecule, potently activates FEN1. This function makes RFC a critical partner with FEN1 for the processing of eukaryotic Okazaki fragments. Flap endonuclease 1 (FEN1) is the enzyme responsible for specifically removing the flap structure produced during DNA replication, repair, and recombination. Here we report that the human replication factor C (RFC) complex stimulates the nuclease activity of human FEN1 in an ATP-independent manner. Although proliferating cell nuclear antigen is also known to stimulate FEN1, less RFC was required for comparable FEN1 stimulation. Kinetic analyses indicate that the mechanism by which RFC stimulates FEN1 is distinct from that by proliferating cell nuclear antigen. Heat-denatured RFC or its subunit retained, fully or partially, the ability to stimulate FEN1. Via systematic deletion analyses, we have defined three specific regions of RFC4 capable of stimulating FEN1. The region of RFC4 with the highest activity spans amino acids 170–194 and contains RFC box VII. Four amino acid residues (i.e. Tyr-182, Glu-188, Pro-189, and Ser-192) are especially important for FEN1 stimulatory activity. Thus, RFC, via several stimulatory motifs per molecule, potently activates FEN1. This function makes RFC a critical partner with FEN1 for the processing of eukaryotic Okazaki fragments. Faithful genome maintenance is fundamental to the preservation of life. DNA replication, repair, and recombination function together to maintain genome integrity; they are interdependent and share many proteins that interplay in a well orchestrated manner (1Waga S. Stillman B. Annu. Rev. Biochem... 1998; 67: 721-751Google Scholar, 2Sancar A. Lindsey-Boltz L.A. Unsal-Kacmaz K. Linn S. Annu. Rev. Biochem... 2004; 73: 39-85Google Scholar-3Johnson A. O'Donnell M. Annu. Rev. Biochem... 2005; 74: 283-315Google Scholar). Flap endonuclease 1 (FEN1) 2The abbreviations used are: FEN1, Flap endonuclease 1; PCNA, proliferating cell nuclear antigen; RFC, replication-factor C; WRN, Werner syndrome protein; BLM, Bloom syndrome protein; nt, nucleotide; BSA, bovine serum albumin; Tricine, N-[2-hydroxy-1,1-bis(hydroxymethyl)ethyl]glycine; ssc, single-stranded circular; ATPγS, adenosine 5′-(γ-thiotriphosphate). is an enzyme that functions in all three processes in eukaryotes and contains structure-specific endonuclease activity that processes flap-structured DNA (4Harrington J.J. Lieber M.R. EMBO J... 1994; 13: 1235-1246Google Scholar, 5DeMott M.S. Shen B. Park M.S. Bambara R.A. Zigman S. J. Biol. Chem... 1996; 271: 30068-30076Google Scholar). Inactivation of the RAD27 gene, which encodes Rad27 (yeast FEN1), led to many anomalies in DNA metabolism. For example, deletion of RAD27 in Saccharomyces cerevisiae produces a temperature-sensitive growth phenotype with a variety of chromosomal instabilities (6Sommers C.H. Miller E.J. Dujon B. Prakash S. Prakash L. J. Biol. Chem... 1995; 270: 4193-4196Google Scholar, 7Greene A.L. Snipe J.R. Gordenin D.A. Resnick M.A. Hum. Mol. Genet... 1999; 8: 2263-2273Google Scholar, 8Wu X. Wang Z. Nucleic Acids Res... 1999; 27: 956-962Google Scholar, 9Xie Y. Liu Y. Argueso J.L. Henricksen L.A. Kao H.I. Bambara R.A. Alani E. Mol. Cell. Biol... 2001; 21: 4889-4899Google Scholar, 10Storici F. Henneke G. Ferrari E. Gordenin D.A. Hubscher U. Resnick M.A. EMBO J... 2002; 21: 5930-5942Google Scholar, 11Zheng L. Zhou M. Chai Q. Parrish J. Xue D. Patrick S.M. Turchi J.J. Yannone S.M. Chen D. Shen B. EMBO Rep... 2005; 6: 83-89Google Scholar-12Liu R. Qiu J. Finger L.D. Zheng L. Shen B. Nucleic Acids Res... 2006; 34: 1772-1784Google Scholar). Although homozygous FEN1 knock-out is embryonic lethal (13Larsen E. Gran C. Saether B.E. Seeberg E. Klungland A. Mol. Cell. Biol... 2003; 23: 5346-5353Google Scholar), heterozygotes are prone to develop tumors because of chromosomal instability caused by haplo-insufficiency of FEN1 (14Kucherlapati M. Yang K. Kuraguchi M. Zhao J. Lia M. Heyer J. Kane M.F. Fan K. Russell R. Brown A.M. Kneitz B. Edelmann W. Kolodner R.D. Lipkin M. Kucherlapati R. Proc. Natl. Acad. Sci. U. S. A... 2002; 99: 9924-9929Google Scholar). Genetic and biochemical studies from yeasts and mammals together confirmed that FEN1 has roles in virtually every aspect of major DNA transactions. For example, FEN1 participates in the maturation of Okazaki fragments by cleaving the flap structure generated by polymerase (pol) δ-catalyzed displacement of DNA synthesis (15Bae S.H. Bae K.H. Kim J.A. Seo Y.S. Nature.. 2001; 412: 456-461Google Scholar, 16Garg P. Stith C.M. Sabouri N. Johansson E. Burgers P.M. Genes Dev... 2004; 18: 2764-2773Google Scholar). FEN1 is also required for long-patch base excision and nucleotide excision repair because transient short flaps are generated during gap filling (17Reagan M.S. Pittenger C. Siede W. Friedberg E.C. J. Bacteriol... 1995; 177: 364-371Google Scholar, 18Kim K. Biade S. Matsumoto Y. J. Biol. Chem... 1998; 273: 8842-8848Google Scholar-19Prasad R. Dianov G.L. Bohr V.A. Wilson S.H. J. Biol. Chem... 2000; 275: 4460-4466Google Scholar). In nonhomologous end-joining, two single strand DNA ends from resected double strand breaks, upon annealing to each other using micro-homology, can generate 5′ flaps that can be removed by FEN1 (20Wu X. Wilson T.E. Lieber M.R. Proc. Natl. Acad. Sci. U. S. A... 1999; 96: 1303-1308Google Scholar). The preferred substrate for FEN1 is a double-flap structure containing a 1-nucleotide (nt) 3′ flap in addition to the 5′ flap that is cleaved (21Harrington J.J. Lieber M.R. J. Biol. Chem... 1995; 270: 4503-4508Google Scholar). This double-flap substrate is believed to be a physiological substrate (22Kao H.I. Henricksen L.A. Liu Y. Bambara R.A. J. Biol. Chem... 2002; 277: 14379-14389Google Scholar). Based upon its enzymatic properties in vitro, the primary role of FEN1 in vivo is likely the creation of ligatable nicks by removing flap structures generated in vivo. The failure to do so is likely to lead to chromosomal instability. Recently, it was reported that FEN1 had gap endonuclease (GEN) activity, which is implicated in restarting stalled replication forks and in apoptotic DNA fragmentation (11Zheng L. Zhou M. Chai Q. Parrish J. Xue D. Patrick S.M. Turchi J.J. Yannone S.M. Chen D. Shen B. EMBO Rep... 2005; 6: 83-89Google Scholar, 23Parrish J.Z. Yang C. Shen B. Xue D. EMBO J... 2003; 22: 3451-3460Google Scholar). FEN1 interacts with other proteins to achieve its function more effectively (24Liu Y. Kao H.I. Bambara R.A. Annu. Rev. Biochem... 2004; 73: 589-615Google Scholar, 25Shen B. Singh P. Liu R. Qiu J. Zheng L. Finger L.D. Alas S. BioEssays.. 2005; 27: 717-729Google Scholar). For example, FEN1 is stimulated by proliferating cell nuclear antigen (PCNA) through protein-protein interaction (26Li X. Li J. Harrington J. Lieber M.R. Burgers P.M. J. Biol. Chem... 1995; 270: 22109-22112Google Scholar, 27Wu X. Li J. Li X. Hsieh C.L. Burgers P.M. Lieber M.R. Nucleic Acids Res... 1996; 24: 2036-2043Google Scholar, 28Gomes X.V. Burgers P.M. EMBO J... 2000; 19: 3811-3821Google Scholar, 29Tom S. Henricksen L.A. Bambara R.A. J. Biol. Chem... 2000; 275: 10498-10505Google Scholar-30Frank G. Qiu J. Zheng L. Shen B. J. Biol. Chem... 2001; 276: 36295-36302Google Scholar). A mutation in the PCNA interaction domain of Rad27 decreases stimulation by PCNA, resulting in replication and repair defects in vivo (28Gomes X.V. Burgers P.M. EMBO J... 2000; 19: 3811-3821Google Scholar). There are two Rad27-binding sites in PCNA that are differentially accessible to Rad27 for stimulation, depending upon the binding status of PCNA to substrate DNA. Both Werner syndrome protein (WRN) and Bloom syndrome protein (BLM), members of RecQ helicase family, stimulate FEN1 through physical interaction. The stimulation was independent of ATPase/helicase activity (12Liu R. Qiu J. Finger L.D. Zheng L. Shen B. Nucleic Acids Res... 2006; 34: 1772-1784Google Scholar, 31Brosh R.M. Jr., von Kobbe C. Sommers J.A. Karmakar P. Opresko P.L. Piotrowski J. Dianova I. Dianov G.L. Bohr V.A. EMBO J... 2001; 20: 5791-5801Google Scholar, 32Brosh Jr. R.M. Driscoll H.C. Dianov G.L. Sommers J.A. Biochemistry.. 2002; 41: 12204-12216Google Scholar, 33Sharma S. Otterlei M. Sommers J.A. Driscoll H.C. Dianov G.L. Kao H.I. Bambara R.A. Brosh Jr. R.M. Mol. Biol. Cell.. 2004; 15: 734-750Google Scholar, 34Sharma S. Sommers J.A. Brosh Jr. R.M. Hum. Mol. Genet... 2004; 13: 2247-2261Google Scholar, 35Sharma S. Sommers J.A. Wu L. Bohr V.A. Hickson I.D. Brosh Jr. R.M. J. Biol. Chem... 2004; 279: 9847-9856Google Scholar-36Wang W. Bambara R.A. J. Biol. Chem... 2005; 280: 5391-5399Google Scholar). A fragment WRN-(949–1092) (144 amino acids) was necessary and sufficient to interact and stimulate human FEN1 (31Brosh R.M. Jr., von Kobbe C. Sommers J.A. Karmakar P. Opresko P.L. Piotrowski J. Dianova I. Dianov G.L. Bohr V.A. EMBO J... 2001; 20: 5791-5801Google Scholar). Thus, WRN and BLM are likely to prevent genome instability by collaborating with FEN1. Recently, it was reported that the human Rad9-Rad1-Hus1 (9-1-1) checkpoint complex, which resembles PCNA in structure, interacted and stimulated FEN1 (37Wang W. Brandt P. Rossi M.L. Lindsey-Boltz L. Podust V. Fanning E. Sancar A. Bambara R.A. Proc. Natl. Acad. Sci. U. S. A... 2004; 101: 16762-16767Google Scholar). They proposed that the 9-1-1 complex serves as a binding platform for FEN1 in DNA repair. Our findings and the findings of others that several genetic suppressors, which rescued defects of dna2, stimulated FEN1 (34Sharma S. Sommers J.A. Brosh Jr. R.M. Hum. Mol. Genet... 2004; 13: 2247-2261Google Scholar, 38Imamura O. Campbell J.L. Proc. Natl. Acad. Sci. U. S. A... 2003; 100: 8193-8198Google Scholar, 39Kim J.H. Kang Y.H. Kang H.J. Kim D.H. Ryu G.H. Kang M.J. Seo Y.S. Nucleic Acids Res... 2005; 33: 6137-6150Google Scholar) prompted us to examine enzymes or proteins involved in lagging strand synthesis for their ability to stimulate FEN1 activity. For this purpose, we tested the influence of the human RFC complex on catalytic activity of human FEN1, and we found that it stimulated markedly FEN1 activity via multiple stimulatory motifs per molecule. RFC acts as a loading factor of PCNA and consists of five subunits as follows: RFC1 (140 kDa), RFC2 (40 kDa), RFC3 (38 kDa), RFC4 (37 kDa), and RFC5 (36 kDa). All its subunits share significant homology in seven regions referred to as RFC boxes (box II–VIII) (40Cullmann G. Fien K. Kobayashi R. Stillman B. Mol. Cell. Biol... 1995; 15: 4661-4671Google Scholar). ATP hydrolysis by RFC is required to load PCNA onto a primer-template junction (41Cai J. Yao N. Gibbs E. Finkelstein J. Phillips B. O'Donnell M. Hurwitz J. Proc. Natl. Acad. Sci. U. S. A... 1998; 95: 11607-11612Google Scholar, 42Gomes X.V. Burgers P.M. J. Biol. Chem... 2001; 276: 34768-34775Google Scholar, 43Gomes X.V. Schmidt S.L. Burgers P.M. J. Biol. Chem... 2001; 276: 34776-34783Google Scholar, 44Schmidt S.L. Gomes X.V. Burgers P.M. J. Biol. Chem... 2001; 276: 34784-34791Google Scholar-45Schmidt S.L. Pautz A.L. Burgers P.M. J. Biol. Chem... 2001; 276: 34792-34800Google Scholar). PCNA, once loaded, encircles the duplex DNA region in a primed template and tethers a DNA polymerase at the growing end of DNA so that the DNA polymerase can synthesize DNA in a processive manner (46Bowman G.D. O'Donnell M. Kuriyan J. Nature.. 2004; 429: 724-730Google Scholar, 47Miyata T. Oyama T. Mayanagi K. Ishino S. Ishino Y. Morikawa K. Nat. Struct. Mol. Biol... 2004; 11: 632-636Google Scholar-48Indiani C. O'Donnell M. Nat. Rev. Mol. Cell Biol... 2006; 7: 751-761Google Scholar). Our findings that RFC has several stimulatory motifs and strongly activates FEN1 indicate that RFC is a critical partner for FEN1 to remove flap structures arising from DNA metabolism, including processing of eukaryotic Okazaki fragments. Enzymes and Nucleotides—The oligonucleotides used in this study were commercially synthesized from Genotech (Daejeon, Korea), and their sequences are listed in Table 1. [γ-32P]ATP (3,000 Ci/mmol) was purchased from Amersham Biosciences and Izotop (Budapest, Hungary). Restriction enzymes and T4 polynucleotide kinase were purchased from PerkinElmer Life Sciences and Enzynomics™ (Daejeon, Korea). Adenosine triphosphate and ATPγS were obtained from Roche Applied Science. Rad27, yeast FEN1, was purified as described previously (15Bae S.H. Bae K.H. Kim J.A. Seo Y.S. Nature.. 2001; 412: 456-461Google Scholar). Human replication protein A and PCNA were purified from Escherichia coli BL21 (DE3) CodonPlus-RIL (Stratagene) as described (49Henricksen L.A. Umbricht C.B. Wold M.S. J. Biol. Chem... 1994; 269: 11121-11132Google Scholar, 50Ayyagari R. Impellizzeri K.J. Yoder B.L. Gary S.L. Burgers P.M. Mol. Cell. Biol... 1995; 15: 4420-4429Google Scholar)Table 1Oligonucleotides used to construct DNA substrates in this study No. Nucleotide sequences (length in nucleotides) 1. GAAAACATTATTAATGGCGTCGAGCTAGGCACAAGGCGAACTGCTAACGG (50) 2. CGAACAATTCAGCGGCTTTAACCGGACGCTCGACGCCATTAATAATGTTTTC (52) 3. TGCTCGACGCCATTAATAATGTTTTC (26) 4. TTTTTTTTTTTTTGCTCGACGCCATTAATAATGTTTTC (38) 5. TTTTTTTTTTTTTTTTTTTTTTTTTTTGCTCGACGCCATTAATAATGTTTTC (52) 6. TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGCTCGACGCCATTAATAATGTTTTC (79) 7. CCGTTAGCAGTTCGCCTTGTGCCTAG (26) 8. CCGTTAGCAGTTCGCCTTGTGCCTA (25) 9. GCTCGACGCCATTAATAATGTTTTC (25) 10. GACGTGCCCATGCGTCTGCGGGCAAGAGAACGCCTTTCGTACGGATCGTTAGTAGACCACTAGTGGAGGTCGCAGCTGGTGCACTCGGGT (90) 11. CTGCACGGGTACGCAGACGCCCGTTCTCTTGCGGAAAGCATGCCTAG (47) 12. TCTCTTGCGGAAAGCATGCCTAGCAATCATCTGGTGATCACCTCCAGCGTCGACCACGTGAGCCCA (60) Open table in a new tab Preparation of Substrates—The oligonucleotide-based partial duplex substrates were prepared essentially as described previously (15Bae S.H. Bae K.H. Kim J.A. Seo Y.S. Nature.. 2001; 412: 456-461Google Scholar) using the synthetic oligonucleotides listed in Table 1. Oligonucleotides used as substrates, the position of radioisotopic label in the substrates, and substrate structures are indicated in each figure. Briefly, an oligonucleotide was first labeled at its 5′-end by incorporating [γ-32P]ATP with T4 polynucleotide kinase and was followed by annealing with upstream and template oligonucleotides in a molar ratio of 1:4:2 (5′-labeled downstream/upstream/template oligonucleotides, respectively). The annealing reaction was performed by using PCR machine (95 °C, 5 min; 65 °C, 30 min; –1 °C/min). An equilibrating flap substrate was prepared as described previously (22Kao H.I. Henricksen L.A. Liu Y. Bambara R.A. J. Biol. Chem... 2002; 277: 14379-14389Google Scholar) with the following modifications. A downstream oligonucleotide was first labeled at its 5′-end with [γ-32P]ATP by T4 polynucleotide kinase, and the labeled oligonucleotide was then annealed to a template oligonucleotide along with an upstream oligonucleotide in a molar ratio of 1:3:10, respectively, as described above. The resulting equilibrating flap substrate was gel-purified prior to use. Purification of FEN1 and RFC—The pET-23d(+)-FEN1 plasmid was constructed as described previously (10Storici F. Henneke G. Ferrari E. Gordenin D.A. Hubscher U. Resnick M.A. EMBO J... 2002; 21: 5930-5942Google Scholar, 51Stucki M. Jonsson Z.O. Hubscher U. J. Biol. Chem... 2001; 276: 7843-7849Google Scholar). FEN1 expressed from this vector contained a C-terminally tagged hexahistidine. The plasmid was transformed into E. coli BL21 (DE3) CodonPlus-RIL (Stratagene), and expression of proteins was induced at A600 = 0.4 with isopropyl β-d-thiogalactopyranoside (final concentration, 0.4 mm) at 30 °C for 3 h. FEN1 was purified using the same procedure as described (10Storici F. Henneke G. Ferrari E. Gordenin D.A. Hubscher U. Resnick M.A. EMBO J... 2002; 21: 5930-5942Google Scholar). Peak fractions from Mono S column chromatography were subjected to glycerol gradient sedimentation as described (52Bae S.H. Seo Y.S. J. Biol. Chem... 2000; 275: 38022-38031Google Scholar). Active peak fractions from the glycerol gradient were pooled, aliquoted, and stored at –80 °C until use. The plasmid expressing FEN1-(ΔC337–380), a C-terminal 44 amino acid deletion mutant of FEN1, was constructed with pET-23d(+)-FEN1 as template according to the manufacturer's instruction using EZchange® mutagenesis kit (Enzynomics™, Korea). The FEN1-(ΔC337–380) mutant enzyme was expressed and purified essentially as the same procedure used for wild type FEN1 described above. Recombinant human RFC complex containing a truncated version of p140 lacking the N-terminal 555 amino acid residues was purified from baculovirus-infected Sf9 insect cells as described previously (53Cai J. Uhlmann F. Gibbs E. Flores-Rozas H. Lee C.G. Phillips B. Finkelstein J. Yao N. O'Donnell M. Hurwitz J. Proc. Natl. Acad. Sci. U. S. A... 1996; 93: 12896-12901Google Scholar, 54Uhlmann F. Cai J. Gibbs E. O'Donnell M. Hurwitz J. J. Biol. Chem... 1997; 272: 10058-10064Google Scholar) and is referred to as RFC in this study. Preparation of RFC4 and Its Derivatives—DNA sequences encoding full-length RFC4 and its truncated derivatives (see Fig. 7A) were amplified by PCR and inserted into BamHI/NotI sites of pET28a(+) (Novagen), resulting in pET28a(+)-RFC4x-y (x and y indicate the position of amino acid at its beginning and end, respectively). All polypeptides expressed from this construct contained a His6 tag and 24-amino acid linker fused to RFC4 and its derivatives to facilitate purification. The expression vectors constructed were introduced into E. coli BL21(DE3) CodonPlus-RIL (Stratagene), and expression of proteins was induced at A600 = 0.5 with isopropyl β-d-thiogalactopyranoside (final concentration, 0.5 mm) at 30 °C for 3 h. Cells from a 0.2-liter culture were collected by centrifugation, resuspended in 15 ml of buffer N300 (50 mm NaH2PO4, pH 8.0, 300 mm NaCl, 10% glycerol, 0.2% Nonidet P-40, 5 mm imidazole, 1 mm phenylmethylsulfonyl fluoride, 0.1 mm benzamidine, 1.0 μg/ml leupeptin, and 1.0 μg/ml pepstatin A), and sonicated (three cycles of 60 s with a 3-min cooling interval). The subscript in buffer N300 denotes NaCl in mm. Extracts were centrifuged at 13,000 × g for 40 min at 4 °C, and the cleared lysate was loaded onto a Ni2+-nitrilotriacetic acid column (300 μl, Qiagen), pre-equilibrated with buffer N300. The column was successively washed with 10-column volumes of buffer N300 and with buffer N300 plus 25 mm imidazole. Proteins were eluted stepwise with buffer N300 plus 50, 100, 200, and 300 mm imidazole. Fractions containing most pure proteins were collected and used to test whether it possessed FEN1 stimulation activity. Protein concentrations were measured using Bradford solution with BSA standard. To measure concentrations of small proteins (with <100 amino acid residues), purified aliquots of the fractions were subjected to 16% Tricine/SDS-PAGE (55Schagger H. Nat. Protoc... 2006; 1: 16-22Google Scholar), and the gel was run until the dye front reached the bottom of the gel. The concentrations of small proteins were measured by comparing intensities of Coomassie-stained bands with those of BSA control. For single amino acid substitution in RFC4-(170–194), pET-28a(+)-RFC4-(170–194) prepared as described above was used as template, and alanine substitution was performed using the EZchange® mutagenesis kit (Enzynomics™, Korea). All oligonucleotides used for construction of expression plasmids or site-directed mutagenesis are available upon request. Standard Endonuclease Assays—Standard endonuclease assays were performed in reaction mixtures (20 μl) containing 50 mm Tris-Cl, pH 8.0, 4 mm MgCl2, 1 mm dithiothreitol, 0.25 mg/ml BSA, and 15 fmol of the standard double-flap substrate (see Fig. 1B). Reactions were incubated for 15 min at 37 °C, followed by the addition of 4 μl of 6× stop solution (40% sucrose, 60 mm EDTA, 1.2% SDS, 0.05% bromphenol blue, and 0.05% xylene cyanol). The cleavage products were separated on a 10% polyacrylamide gel (plus 0.1% SDS) for 40 min at 140 Vin1× TBE (89 mm Tris base, 89 mm boric acid, and 2 mm EDTA). The gels were dried on DEAE-cellulose paper (DE81, Whatman) and autoradiographed. Labeled DNA products were quantified with the use of a PhosphorImager (GE Healthcare). Determination of Kinetic Parameters—To measure kinetic parameters, kinetic analyses were repeated in triplicate using increasing amounts (0, 20, 40, and 80 fmol) of a double-flap substrate; the substrate was prepared with oligonucleotides 1, 7, and 5 (upstream primer, template, and labeled downstream primer, respectively; refer to Fig. 5 for its structure) as described above. Reactions were carried out with 1 fmol of FEN1 and saturating levels (40 fmol) of RFC per reaction, and under these reaction conditions we were able to obtain reliable amounts of products at the early time point of incubation. Reaction mixtures (120 μl) were assembled on ice, followed by preincubation at 37 °C for 5 min, and initiated by the addition of 4 mm MgCl2. Aliquots (20 μl) were withdrawn at 1, 2, 4, and 8 min after incubation and transferred to a tube containing 4 μl of 6× stop buffer. The amounts of products were analyzed as described above. Kinetic parameters were obtained based on the Michaelis-Menten equation. V = dt[P]/dt, where [P] is the amount of products in nm. The concentration of [P] was calculated using the equation, [P] = Icleaved/(Iuncleaved + Icleaved) × [S], where [S] is concentration of substrate used, and Icleaved and Iuncleaved are band intensities of products and substrate left, respectively. The initial velocity was plotted against [S], and the values Km and Vmax were calculated by nonlinear regression using SigmaPlot (Systat Software Inc.) to avoid distortion of the experimental errors, which can occur during reciprocal transformation of the data. Human RFC Stimulates Human FEN1 on Double-flap Substrate—To test the influence of the human RFC complex on catalytic activity of human FEN1, we purified both enzymes to near homogeneity as shown in Fig. 1A. The RFC complex purified contained the N-terminally deleted version of RFC1, which supported DNA pol δ in vitro as efficiently as wild type (42Gomes X.V. Burgers P.M. J. Biol. Chem... 2001; 276: 34768-34775Google Scholar, 54Uhlmann F. Cai J. Gibbs E. O'Donnell M. Hurwitz J. J. Biol. Chem... 1997; 272: 10058-10064Google Scholar). We found that the RFC complex markedly stimulated FEN1 activity (Fig. 1B) with a double-flap DNA substrate containing a 5′ 27-nt and a 3′ 1-nt flap, a physiological form of substrate (22Kao H.I. Henricksen L.A. Liu Y. Bambara R.A. J. Biol. Chem... 2002; 277: 14379-14389Google Scholar). We refer to this double-flap substrate as standard substrate in this study. Unless otherwise stated, this double-flap substrate was used to measure FEN1 endonuclease activity. Additions of 5 or 20 fmol (Fig. 1B, lanes 8–13 and 14–19, respectively) of RFC to reaction mixtures containing 1 fmol of FEN1 resulted in a significant (5–10-fold) stimulation of FEN1-catalyzed cleavage of the 5′ flap in response to concentrations of Mg2+ used (Fig. 1B). Increase in Mg2+ concentrations resulted in a linear increase in cleavage of flap DNA by FEN1 in the absence of RFC (Fig. 1, B, lanes 2–7, and C, gray circles). The addition of RFC (5 fmol) increased FEN1-catalyzed cleavage of flap dramatically at all Mg2+ concentrations tested (Fig. 1B, compare lanes 2–7 with lanes 8–13), reaching a plateau at 4 mm of Mg2+ (Fig. 1C, open circles). The addition of more (20 fmol) RFC did not further increase the stimulation (Fig. 1B, compare lanes 8–13 with 14–19). Thus, increases in Mg2+ concentrations not only enhance FEN1 activity but also increase the extent of FEN1 stimulation by RFC. With RFC (20 fmol) alone, no cleavage products were detected (Fig. 1B, lane 20). We next decided to determine optimal concentration of Mg2+ for stimulation of FEN1 by RFC. For this purpose, we tested effects of increasing concentrations (2, 5, 10, 15, and 20 mm) of Mg2+ on FEN1 activity in the presence of increasing levels (0, 5, and 20 fmol) of RFC (Fig. 1D). In this experiment, we reduced the amount of FEN1 to 0.5 fmol. We found that higher concentrations (>10 mm) of Mg2+ were inhibitory to FEN1 activity. In addition, lower levels (5 fmol) of RFC stimulated FEN1 activity, most effectively in Mg2+ concentrations less than 10 mm (Fig. 1D). The addition of 20 fmol of RFC resulted in robust stimulation of FEN1 in Mg2+ concentrations at 10 mm or above, indicating that RFC allows FEN1 to overcome the inhibitory effect of high concentrations of Mg2+ (Fig. 1D). Based upon these findings, we decided to use 4 mm of Mg2+ in all subsequent reactions. RFC Accelerates FEN1 Activity in an ATP-independent Manner—Next, we examined whether RFC could stimulate FEN1 in its low concentrations. To this end, we used a very low level (0.1 fmol) of FEN1 and excess RFC (20 fmol). As shown in Fig. 2A, the amounts of products formed were barely detectable (∼0.3 fmol) after 30 min of incubation in the absence of RFC. In the presence of RFC, however, the amounts of products formed were 9.3 fmol (∼30-fold more than in its absence) after 30 min of incubation (Fig. 2, A and B). We also investigated the influence of RFC concentration on FEN1 activity in a time course experiment, and we found that increasing concentrations (0, 1, 2.5, 5, 20 fmol) of RFC increased the rate of FEN1-catalyzed cleavage (Fig. 2C). This kinetic analysis revealed that the increase in RFC concentrations enhanced markedly (>5-fold) the rate of substrate cleavage by FEN1 (Fig. 2C). In the absence of RFC, the FEN1-alone reaction continued to accumulate cleavage products up to 1 h at 37 °C, indicating that FEN1 was not inactivated during the incubation period (Fig. 2C). However, the substrate cleavage rate increased proportionally to the amount of RFC added (Fig. 2C). Thus, we concluded that RFC accelerates the FEN1-catalyzed cleavage reaction. These results indicate that the increase in FEN1 activity is because of RFC stimulation of FEN1, not because of stabilization of the FEN1 protein. Because RFC is a weak DNA-dependent ATPase (53Cai J. Uhlmann F. Gibbs E. Flores-Rozas H. Lee C.G. Phillips B. Finkelstein J. Yao N. O'Donnell M. Hurwitz J. Proc. Natl. Acad. Sci. U. S. A... 1996; 93: 12896-12901Google Scholar), we examined whether ATP binding or ATP hydrolysis could alter the ability of RFC to stimulate FEN1. Neither ATP nor its nonhydrolyzable analog, ATPγS (1 mm, each), affected the stimulation of FEN1 activity by RFC (Fig. 2D), indicating that FEN1 stimulation by RFC requires neither ATP binding nor hydrolysis. RFC Stimulates FEN1 Activity in a Manner Distinct from PCNA—Because FEN1 and RFC interact with PCNA, we performed mixing experiments to determine whether stimulation of FEN1 by RFC and PCNA is mutually exclusive (Fig. 3). First, we used the same concentrations (0–20 fmol; 0–1 nm) of RFC and PCNA in the presence of a fixed amount (0.5 fmol) of FEN1 as shown in Fig. 3A. The addition of increasing concentrations of RFC (Fig. 3, A, lanes 3–7, and B, closed circles) resulted in significant stimulation, whereas the addition of PCNA equivalent to RFC failed to give rise to any detectable stimulation (Fig. 3, A, lanes 9–13, and B, gray circles). We then determined concentrations of PCNA required to stimulate FEN1 activity to that comparable with RFC (data not shown), and we found that ∼200-fold more PCNA was required than RFC to obtain comparable stimulation (Fig. 3C, compare lanes 3–7 with 9–13, and D, closed and gray circles). Amounts of products formed in the presence of both RFC and PCNA (Fig. 3C, lanes 15–19) were close to the combined amounts of products formed in the presence of PCNA or RFC alone (Fig. 3D). Our results suggest that the mechanisms by which FEN1 is stimulated by RFC and PCNA are different. We also investigated whether ATP could affect stimulation of FEN1 by RFC in the presence of PCNA, but we found that it did not affect the stimulation extent (data not shown). This result indicates that stimulation of FEN1 by RFC occurs independently of the RFC loading function of PCNA. Effect of RFC on the Kinetic Parameters for FEN1 Cleavage—We next determined the reaction kinetic parameters, Km and Vmax, as described under "Materials and Methods." The addition of RFC results in significant increase (>4-fold) in Vmax (and thus Kcat), although hardly affecting Km (Table 2). This result indicates that the addition of RFC increases Kcat/Km, the catalytic efficiency of FEN1 ∼4.8-fold (Table 2). The results of our kinetic analysis indicate that RFC increases catalytic power by increasing the turnover rate of FEN1. The two kinetic parameters also support the idea that the mechanism by which RFC stimulates FEN1 is distinct from that of PCNA, which increased Vmax 2-fold, but decreased Km ∼12-fold (29Tom S. Henricksen L.A. Bambara R.A. J. Biol. Che
Due to advantages such as quick connection establishment and multiple streaming over a single connection, QUIC was included in the new standard of HTTP 3.0 as an alternative transport layer protocol. Since QUIC operates on UDP, however, QUIC flows can be blocked by existing countermeasures against UDP flooding attacks, even if transmission rates are fairly controlled by congestion control algorithms, such as TCP. In this paper, we confirm that such a problem arises in real-world Internet environment and design effective approaches to avoid it. In the first approach, the gateway router dynamically sets the rate limit for the QUIC flow, based on the expected next CWND size estimated by the receiver using a built-in congestion control algorithm. The second approach leverages the proactive dropping of packets (or ECN marking) to distinguish whether the flow is a self-regulated QUIC flow or an unresponsive UDP attack/selfish flow. Simulation studies using the ns-3 simulator confirm that the proposed approaches can selectively allow QUIC flows regardless of their short-term transmission rates while preserving the effectiveness of existing countermeasures against UDP flooding attacks.
Although Java has many useful programming language features for developing consumer multimedia applications, it is not widely used for multimedia application development. One of the main reasons for the lack of Java usage in consumer multimedia application development is a concern for the execution speed of Java-based applications. In this paper, we investigate the feasibility of using Java as a language for multimedia applications. As a specific multimedia application example, we have developed a Java-based MPEG-1 video decoder. We describe the design and implementation of the MPEG-1 video decoder and report our experience in optimizing the decoding performance. Based on the performance analysis results from a Java performance profiler, we have applied both general and Java-specific optimization techniques. The final implementation could decode about 28.67 frames per second on a Pentium-II 300 MHz computer for a 240/spl times/170 MPEG-1 video bitstream, a speed-up of 2.8 times over the initial implementation. Our experience strongly suggests that the pure Java-based media processing is a feasible solution.
We examine the fast crystallization kinetics of the stoichiometric Ge–Sb–Te alloy film by using a modified Johnson–Mehl–Avrami (JMA) equation and additive reaction for nonisothermal transformation. It is expected that utilization of the fast crystallization kinetics of the recording medium occurring at the first stage of cascaded crystallization will significantly reduce the erase time at elevated temperatures. We also show an ellipsometric configuration which enables one to confirm the fast crystallization kinetics in nanosecond time resolution.
Broadcasting/multicasting offers a potential benefit for delay-sensitive applications in vehicular networks, since information could be delivered to multiple receivers simultaneously by a single transmission. However, conventional broadcasting schemes suffer from a problem of reliability, since they cannot go along with ACK and RTS/CTS mechanism at the MAC layer. In this paper, we design a novel receiver-driven semi-broadcast scheme for vehicular applications, where receivers request broadcasting to their neighbors and data is broadcasted as a response. Via the simulation study, it is shown that the proposed scheme allows to 1) receive data without contention, 2) control contention, and 3) mitigate hidden node effects.
'%3e%3cg id='b'%3e%3cpath id='a' stroke='%23000' stroke-width='2' d='M-6-25H6m-12 3H6m-12 3H6'/%3e%3cuse xlink:href='%23a' y='44'/%3e%3c/g%3e%3cpath stroke='%23fff' d='M0 17v10'/%3e%3ccircle r='12' fill='%23cd2e3a'/%3e%3cpath fill='%230047a0' d='M0-12A6 6 0 0 0 0 0a6 6 0 0 1 0 12 12 12 0 0 1 0-24z'/%3e%3c/g%3e%3cg transform='rotate(-123.69)'%3e%3cuse xlink:href='%23b'/%3e%3cpath stroke='%23fff' d='M0-23.5v3M0 17v3.5m0 3v3'/%3e%3c/g%3e%3c/svg%3e)