The TATA box element is not only important for establishing basal levels of transcription, but it can also be used to modulate cell type or stage specific gene activity. In the case of the human osteocalcin gene, which is transcriptionally repressed by glucocorticoids, a specific binding element for the glucocorticoid receptor (GR) overlaps a noncanonical TATA box. In the present study, the relevance and function of the TATA element in glucocorticoid-mediated repression of the human osteocalcin gene was characterized. Mutating this noncanonical TATA box into a consensus TATA box within the context of the osteocalcin promoter greatly decreased hormone-dependent transcriptional repression by GR. TATA-binding protein (TBP) bound this mutated element much more strongly suggesting a physiologically relevant role for the weak osteocalcin TATA element in the regulation of this bone specific gene. The optimization of the putative transcription factor IIB recognition site did not affect the level of GR-mediated repression. Our results support a model wherein competitive DNA binding of GR and TBP for their overlapping sites explains conditional repression of the osteocalcin gene by glucocorticoids. The TATA box element is not only important for establishing basal levels of transcription, but it can also be used to modulate cell type or stage specific gene activity. In the case of the human osteocalcin gene, which is transcriptionally repressed by glucocorticoids, a specific binding element for the glucocorticoid receptor (GR) overlaps a noncanonical TATA box. In the present study, the relevance and function of the TATA element in glucocorticoid-mediated repression of the human osteocalcin gene was characterized. Mutating this noncanonical TATA box into a consensus TATA box within the context of the osteocalcin promoter greatly decreased hormone-dependent transcriptional repression by GR. TATA-binding protein (TBP) bound this mutated element much more strongly suggesting a physiologically relevant role for the weak osteocalcin TATA element in the regulation of this bone specific gene. The optimization of the putative transcription factor IIB recognition site did not affect the level of GR-mediated repression. Our results support a model wherein competitive DNA binding of GR and TBP for their overlapping sites explains conditional repression of the osteocalcin gene by glucocorticoids. Transcription of RNA polymerase II-dependent genes requires, in addition to the enzyme itself, a number of general factors that form a specific multiprotein complex near the transcription start site by interacting with basal promoter elements. The most well studied core promoter element is the TATA box, which is typically located 25–30 base pairs upstream of the transcription start site of many eukaryotic genes (1Breathnach R. Chambon P. Annu. Rev. Biochem. 1981; 50: 349-383Crossref PubMed Scopus (3298) Google Scholar). The central step in formation of the preinitiation complex at TATA-containing promoters involves the binding of transcription factor IID (TFIID) 1The abbreviations used are: TFIID, transcription factor IID; dexamethasone, 9α-fluoro-16α-methyl-11β,17,21-trihydroxy-pregna-1,4-diene-3,20-dione; GR, glucocorticoid receptor; GRE, glucocorticoid response element; nGRE, negative GRE; NR, nuclear receptor protein; TBP, TATA-binding protein; TFIIB, transcription factor IIB; WT, wild type. to the TATA box (2Burley S.K. Roeder R.G. Annu. Rev. Biochem. 1996; 65: 769-799Crossref PubMed Scopus (628) Google Scholar). TFIID consists of the TATA-binding protein (TBP) and a fairly large number of associated factors (3Goodrich J.A. Cutler G. Tjian R. Cell. 1996; 84: 825-830Abstract Full Text Full Text PDF PubMed Scopus (185) Google Scholar). The affinity of the TBP/TATA box interaction has been proposed to contribute to promoter strengthin vivo and in vitro, and subsequent assembly of the other general transcription factors into a functional preinitiation complex is dependent upon this initial interaction at the TATA box (1Breathnach R. Chambon P. Annu. Rev. Biochem. 1981; 50: 349-383Crossref PubMed Scopus (3298) Google Scholar,4Colgan J. Manley J.L. Genes Dev. 1992; 6: 304-315Crossref PubMed Scopus (120) Google Scholar, 5Myers R.M. Tilly K. Maniatis T. Science. 1986; 232: 613-618Crossref PubMed Scopus (276) Google Scholar, 6Wobbe C.R. Struhl K. Mol. Cell. Biol. 1990; 10: 3859-3867Crossref PubMed Scopus (239) Google Scholar). In addition to its role as a nucleation point for preinitiation complex assembly, the TATA box can also have an important function with respect to cell type or stage specific modulation of gene activity. In several reported cases, minor deviations from the consensus TATA box DNA sequence (TATA(A/T)A(A/T)A) are thought to be critical for proper regulation. For example, in the case of the rabbit uteroglobin gene, two factors, one cell type specific and the other ubiquitously expressed, have been proposed to facilitate the interaction of TBP with the weak TATA box, TACAAA, by binding the TACA site (7Klug J. Knapp S. Castro I. Beato M. Mol. Cell. Biol. 1994; 14: 6208-6218Crossref PubMed Scopus (16) Google Scholar). Another example is the unusual inverted TTTATA sequence that is involved in the negative regulation of the bone sialoprotein gene (8Li J.J. Kim R.H. Sodek J. Biochem. J. 1995; 310: 33-40Crossref PubMed Scopus (54) Google Scholar). Several examples of repression of gene activity by competitive binding at the TATA box have also been postulated. In these cases, the overlap or close location of binding sites for other sequence specific transcription factors and the TATA box suggest that repression of gene expression is the result of a competition between TFIID and a sequence specific factor (9Chatterjee V.K. Lee J.K. Rentoumis A. Jameson J.L. Proc. Natl. Acad. Sci. U. S. A. 1989; 86: 9114-9118Crossref PubMed Scopus (179) Google Scholar, 10Ray A. LaForge K.S. Sehgal P.B. Mol. Cell. Biol. 1990; 10: 5736-5746Crossref PubMed Scopus (239) Google Scholar). Thus, when the sequence specific factor is bound, no preinitiation complex can form as TFIID cannot bind. Several cases of competitive binding with other transcription activators have been reported for gene regulation by nuclear hormone receptors (NRs), a family of ligand-dependent transcription factors that includes the receptors for steroid hormones. Upon ligand binding, NRs interact with genomic response elements and directly alter the transcription levels of linked genes. Modulation of gene activity by NRs through steric hindrance of TFIID at the TATA box has been proposed for thyroid hormone-dependent repression of the thyroid-stimulating hormone α-gene and for the bone sialoprotein, which is negatively regulated by vitamin D (9Chatterjee V.K. Lee J.K. Rentoumis A. Jameson J.L. Proc. Natl. Acad. Sci. U. S. A. 1989; 86: 9114-9118Crossref PubMed Scopus (179) Google Scholar, 11Karagianni N. Tsawdaroglou N. Oncogene. 1994; 9: 2327-2334PubMed Google Scholar). In the latter case, a vitamin D receptor element overlaps the TATA box. A further example of gene repression by glucocorticoids involving the promoter region around −30 is reported for the type 1 vasoactive intestinal polypeptide receptor gene (12Pei L. J. Biol. Chem. 1996; 271: 20879-20884Abstract Full Text Full Text PDF PubMed Scopus (99) Google Scholar). A DNA binding site recognized by the glucocorticoid receptor (GR) that partly overlaps the TATA box within the promoter region of the human osteocalcin gene has been identified spanning nucleotides −35/−14 relative to the transcription start site (Fig. 1) (13Strömstedt P.E. Poellinger L. Gustafsson J.-Å. Carlstedt-Duke J. Mol. Cell. Biol. 1991; 11: 3379-3383Crossref PubMed Scopus (140) Google Scholar). The strategic and central position of the GRE makes it likely that the negative glucocorticoid effect at this gene is mediated by inhibition of formation of a functional preinitiation complex by displacement of TFIID from the TATA box. In the present work we have analyzed the importance of the sequence of osteocalcin TATA box on glucocorticoid-mediated transcription repression of osteocalcin gene activity. We demonstrate that mutating the osteocalcin TATA box into a consensus TATA element greatly diminished repression by hormone-activated GR. The mutation does not influence the specific GR binding suggesting that the osteocalcin TATA box has an active function in the regulatory process. Finally, we present preliminary evidence that suggests that displacement of another polymerase II general transcription factor, TFIIB, is not important for regulation of the osteocalcin gene by mutating promoter positions reported to be responsible for efficient TFIIB function. Mutations were introduced into pOS-344Luc (14Meyer T. Gustafsson J.-Å. Carlstedt-Duke J. DNA Cell Biol. 1997; 16: 919-927Crossref PubMed Scopus (63) Google Scholar) within the promoter region of the human osteocalcin gene by standard protocols (15Kunkel T.A. Proc. Natl. Acad. Sci. U. S. A. 1985; 82: 488-492Crossref PubMed Scopus (4903) Google Scholar) using the following oligonucleotides: wild type,+9CTCAGCTGGCCAGCCCCGCCAGCCTCCAGCACTGTTTATACCCTCTGGGC−38;TATAAAA,+9CTCAGCTGGCCAGCCCCGCCAGCCTCCAGCACTTTTTATACCCTCTGGGC−38;TACAAAA,+9CTCAGCTGGCCAGCCCCGCCAGCCTCCAGCACTTTTTGTACCCTCTGGGC−38;TACAAAC,+9CTCAGCTGGCCAGCCCCGCCAGCCTCCAGCACTGTTTGTACCCTCTGGGC−38;TFIIB,+9CTCAGCTGGCCAGCCCCGCCAGCCTCCAGCACTGTTTATACCCTCCGGGC−38. An MscI site was introduced by mutating the A at −3 to T to simplify screening. This mutation was shown to have no effect on reporter expression levels (data not shown). COS-7 cells were cultured at 37 °C in a humidified atmosphere with 5% CO2 in Dulbecco's modified medium buffered with bicarbonate and supplemented with 5% fetal calf serum, penicillin (100 IU/ml) and streptomycin (0.1 mg/ml). Cells were seeded in 6-cm plates 24 h before a transfection experiment and transfected at a confluence of 40–50% using the calcium phosphate coprecipitation technique. The precipitate contained 5 μg of supercoiled luciferase reporter plasmid DNA and varying amounts (0–3 μg) of different expression plasmids. The overall amount of DNA was kept constant by the addition of parent expression vector. After 12–14 h of exposure to the calcium phosphate precipitate, medium was changed and the cells were treated for 24 h with 20 nmdexamethasone. Transfected cells were subsequently harvested for the luciferase assay by scraping the cells in 1 ml of phosphate-buffered saline, centrifuging for 10 min in a microcentrifuge and resuspending in 50 μl of lysis buffer (25 mm Tris-acetate, pH 7.8, 2 mm dithiothreitol, 1.5 mm EDTA, 10% glycerol, and 1% Triton X-100). All experiments were performed three times in triplicate. Luciferase activity was monitored according to GenGlow luciferase assay kit (Bio Orbit) using an anthos lucy 1 luminometer (Anthos Labtec Instuments GmbH, Salzburg, Austria). The results are expressed as light units measured. Human glucocorticoid receptor protein was expressed in Sf9 insect cells using a baculovirus expression system as described previously (16Srinivasan G. Mol. Endocrinol. 1992; 6: 857-860PubMed Google Scholar, 17Kallio P.J. Palvimo J.J. Mehto M. Xie Y.B. Sui Y.P. Janne O.A. Ann. N. Y. Acad. Sci. 1993; 684: 233-240Crossref PubMed Scopus (3) Google Scholar). The human TBP was produced in a vaccinia virus system (18De Vos P. Schmitt J. Verhoeven G. Stunnenberg H.G. Nucleic Acids Res. 1994; 22: 1161-1166Crossref PubMed Scopus (24) Google Scholar). Cytosolic extracts of infected cells were used in the DNA binding assays. As control extracts (C) we used either extracts of cells infected with WT baculovirus or WT vaccinia virus. GR and TBP DNA binding activity was monitored by an electrophoretic gel mobility shift assay. A32P-labeled double-stranded oligonucleotide spanning the GRE sequence and TATA box of the human osteocalcin promoter (−41/−9) or mutated versions of this DNA were used as specific probes (see Fig.1 C). Recombinant GR was incubated for 10 min on ice in a buffer containing 0.5 μg poly(dI·dC), 60 mm KCl, 10 mm Hepes pH 7.9, 0.1 mm EDTA, 10% glycerol, and 5 mm dithiothreitol. In reactions containing recombinant TBP, the poly(dI·dC) was replaced by poly(dG·dC). After addition of the specific DNA probe, the mixture was incubated for 20 min at room temperature. Protein-DNA complexes were resolved on 5% native polyacrylamide gels (5% polyacrylamide, 0.25 × TBE). Quantification of specific DNA binding was carried out by densitometric analysis of the autoradiograms for the bands corresponding to the specific complexes. One mechanism by which basal levels of transcription are established is through the binding of TFIID to the TATA box. However, in some cases it appears that the TATA box may also be involved in the regulation of gene expression by an occlusion mechanism analogous to that found in a number of prokaryotic systems. For example, in the case of the human osteocalcin gene, the TATA box overlaps a binding site for a ligand-activated transcriptional regulator, the GR (13Strömstedt P.E. Poellinger L. Gustafsson J.-Å. Carlstedt-Duke J. Mol. Cell. Biol. 1991; 11: 3379-3383Crossref PubMed Scopus (140) Google Scholar). Induction of this NR with glucocorticoids leads to a repression of osteocalcin gene activity to 40% of basal levels (19Morrison N.A. Shine J. Fragonas J.C. Verkest V. McMenemy M.L. Eisman J.A. Science. 1989; 246: 1158-1161Crossref PubMed Scopus (341) Google Scholar). Since we have defined the function of the glucocorticoid responsive element in previous studies (14Meyer T. Gustafsson J.-Å. Carlstedt-Duke J. DNA Cell Biol. 1997; 16: 919-927Crossref PubMed Scopus (63) Google Scholar), we were interested in studying the role of the sequence of the noncanonical osteocalcin TATA box in glucocorticoiddependent repression of osteocalcin levels. Consistent with several other genes regulated by events directly involving the TATA box, the osteocalcin gene contains a noncanonical TATA element (Fig. 1 B) (in this case, TATAAAC, in which the A at position 7 is replaced by a C). Previous reports suggest that TBP binds this sequence poorly and that it directs decreased basal levels of transcription (6Wobbe C.R. Struhl K. Mol. Cell. Biol. 1990; 10: 3859-3867Crossref PubMed Scopus (239) Google Scholar, 20Starr D.B. Hoopes B.C. Hawley D.K. J. Mol. Biol. 1995; 250: 434-446Crossref PubMed Scopus (158) Google Scholar, 21Singer V.L. Wobbe C.R. Struhl K. Genes Dev. 1990; 4: 636-645Crossref PubMed Scopus (154) Google Scholar). To determine if the weakness of the osteocalcin TATA box is important for glucocorticoid-mediated transcription repression, we mutated this element to a canonical TATA box, TATAAAA, and tested the effect of this mutation in cellular transfection experiments using an osteocalcin promoter construct driving the firefly luciferase gene as a reporter system. For these studies, the construct was transfected into COS7 cells where the endogenous GR is expressed at very low levels and is virtually undetectable by ligand binding or immunochemical assays (22Alksnis M. Barkhem T. Strömstedt P.E. Ahola H. Kutoh E. Gustafsson J.-Å. Poellinger L. Nilsson S. J. Biol. Chem. 1991; 266: 10078-10085Abstract Full Text PDF PubMed Google Scholar). As shown in Fig. 2, mutation of the TATA box to TATAAAA increased basal osteocalcin promoter activity 1.7-fold. In additional experiments, the cotransfected and ligand-activated GR efficiently repressed the WT osteocalcin promoter to a level between 30 and 40% in agreement with previously published results (Fig.3 A). Strikingly, equivalent amounts of GR failed to repress the osteocalcin promoter containing the consensus TATA box upon hormone induction (Fig. 3 B). Thus, the nonconsensus osteocalcin TATA sequence is crucial for proper osteocalcin regulation.Figure 3Glucocorticoid-dependent repression is reduced by a consensus TATA box. COS 7 cells were either transfected with a luciferase reporter gene driven by nucleotides −344/+34 of the human osteocalcin promoter (TATAAAC) (A) or a construct containing a canonical TATA box (TATAAAA) (B) together with an expression vector for GR. The cells were incubated with (▪) or without (□) 20 nmdexamethasone (Dex). Luciferase activity was assayed in cells from 6-cm plates and related to the activity in cells transfected with GR in the absence of dexamethasone. The figure shows the mean + S.D. of three experiments, each carried out with three independent triplicate analyses.View Large Image Figure ViewerDownload Hi-res image Download (PPT) Although the mutated residue of the TATA box should not compromise GR binding as it is located in the 3-base pair spacer region, we performedin vitro binding studies using either a WT or the TATAAAA mutated form of a DNA fragment containing the human osteocalcin promoter-spanning nucleotides −41/−9 (Fig. 1 C). In gel mobility shift assays using virally expressed GR, we showed that the receptor protein binds both fragments similarly (Fig.4 A, lanes 3 and4). Mutation of the nGRE sequence (Fig. 1 C; GREmut) eliminates the GR-specific complex, whereas nonspecific complexes were not affected (Fig. 4, A, lane 6,B, lane 5). Furthermore, this band was supershifted to a slower migrating species following incubation with antibodies against GR (data not shown). A mutation within the first putative GRE halfsite (TACAAAA), creating a binding site described for optimal GR function, enhanced GR-DNA interaction (compare Fig.4 B, lanes 3 and 4). Since we are proposing that a prerequisite for effective repression of the osteocalcin gene by glucocorticoids is a noncanonical TATA element that influences the TBP/TATA box interaction, we directly determined if TBP could distinguish between the WT and the A mutant by using virally expressed TBP in gel mobility shift assays. As shown in Fig.5, TBP induced a specific protein-DNA complex on a DNA fragment containing the WT osteocalcin promoter fragment −41/−9. However, under the same experimental conditions, TBP bound a fragment containing a consensus TATA box within the context of the osteocalcin promoter with apparently higher affinity (Fig. 5,lane 3). The specificity of this interaction was established by using a similar element containing a G in the second position of the TATA element (TGTAAAC; Fig. 5, lanes 4 and 8). This mutation completely abolished the TBP-DNA interaction as described previously (23Strubin M. Struhl K. Cell. 1992; 68: 721-730Abstract Full Text PDF PubMed Scopus (135) Google Scholar). The use of a synthetic DNA fragment containing an alternative mutation within the strong consensus TATA box element (TACAAAA) resulted in a TBP-induced complex formation comparable in intensity to the weak WT osteocalcin TATA box (Fig. 5, lanes 6 and 7). When we used our osteocalcin reporter construct containing TGTAAAC, TACAAAC, or TACAAAA as TATA element, the reporter gene activity was decreased to background levels (data not shown). This result suggests that the binding affinity of TBP to the osteocalcin TATA box is one of the major determinants for GR action at the osteocalcin promoter. The basis of our model for the glucocorticoid-dependent down-regulation of the osteocalcin gene is competitive binding between the basal transcription factor TFIID and a conditionally active transcription regulator, the glucocorticoid receptor, for overlapping binding sites. In this model, the relative affinity of each factor for its respective binding site is crucial for the proper regulation of the osteocalcin gene with neither factor binding too strongly. To more accurately assess the relative binding strengths of TBP and GR for the osteocalcin GRE/TATA box, we compared the binding affinities of TBP and GR to the osteocalcin GRE/TATA box to their respective consensus binding sites contained within the osteocalcin promoter background. In agreement with our proposed model, both TBP and GR bound the osteocalcin GRE/TATA box more weakly than they bound their consensus binding sites. As shown in Fig. 6, TBP binds the osteocalcin TATA box 5-fold less strongly than to the consensus TATA box, TATAAAA, over a wide range of protein concentrations (Fig. 6 A), and GR binds the osteocalcin GRE 5-fold less strongly than to the consensus GRE, GGTACA, over a wide range of protein concentrations (Fig. 6 B). If mutually exclusive binding of the two transcription factors is a prerequisite for the glucocorticoid-mediated transcription repression effect, then an increase in GR concentration should be sufficient to perturb the enhanced binding of TFIID to the consensus TATA box within the osteocalcin gene. We therefore tested whether increased amounts of GR expression vector would be capable of repressing the mutated osteocalcin reporter construct that contains the consensus TATA box in the above described cellular transfection system. The use of an excess of GR expression vector resulted in a concentration-dependent decrease of osteocalcin reporter gene activity comparable to the level of repression at the WT osteocalcin promoter construct. The use of 5–10-fold more expression vector resulted in a similar decrease in reporter gene activity (Fig.7). These results are indicative of equilibrium binding of GR and its competitive factor TFIID in the proposed mechanism and, furthermore, that the reduced affinity of TFIID for its DNA recognition site is critical for negative gene regulation of the human osteocalcin gene by glucocorticoids. During the formation of the preinitiation complex, several other basal factors stabilize the TFIID-DNA complex. Among them, TFIIB is essential for the formation of the polymerase II initiation complex as it interacts with the TBP-DNA complex and recruits the polymerase. TFIIB requires at least 7 base pairs of DNA on either side of the TATA box to form a stable TFIIB-TBP-DNA complex (24Lee S. Hahn S. Nature. 1995; 376: 609-612Crossref PubMed Scopus (79) Google Scholar, 25Nikolov D.B. Chen H. Halay E.D. Usheva A.A. Hisatake K. Lee D.K. Roeder R.G. Burley S.K. Nature. 1995; 377: 119-128Crossref PubMed Scopus (485) Google Scholar, 26Lagrange T. Kim T.K. Orphanides G. Ebright Y.W. Ebright R.H. Reinberg D. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 10620-10625Crossref PubMed Scopus (92) Google Scholar). Lagrange et al. 2T. Lagrange, A. Kapanidis, H. Tang, D. Reinberg, and R. H. Ebright, personal communication. have presented evidence for the importance of two G bases at positions −3 and −6 upstream of the TATA box (positions −36 and −33 in the human osteocalcin gene) (Fig. 8 A). In the case of the osteocalcin promoter, only the proximal G is conserved, which motivated us to study a possible stabilization effect of TFIIB on TFIID binding. We therefore introduced an additional mutation targeting the nonconserved A at position −6 with respect to the TATA box in the osteocalcin promoter fragment driving the luciferase reporter gene (−36 with regard to the human osteocalcin gene). In cellular transfection assays, cotransfection of GR and the mutated osteocalcin reporter construct containing the two described G residues resulted in repression of reporter gene activity upon hormone addition. Comparable to the WT promoter, the reporter gene activity was repressed to a level of 40% (Fig. 8 B). Even if this base change did not directly target the putative GRE, we showed that this mutation did not disturb the GR/DNA interaction using the above described DNA binding assay. As shown in Fig. 4 A, lane 5, no change in GR/DNA binding strength was detected when compared with the WT fragment. This observation strengthened the notion that only TBP binding to the osteocalcin TATA box has a central and dominant function in glucocorticoid mediated repression of osteocalcin expression level. The affinity of sequence specific transcription factors for their binding sites is a major determinant for their action. Consensus binding sites have been defined for most of the known DNA binding transcription factors with these sites yielding maximal effects on gene transcription. Additionally, many cases have been described where nonconsensus binding sites are important for the transmission of a specific regulatory effect. This is also true for the basal transcriptional element, the TATA box, where several sites have been described in which proper regulation requires sequences divergent from that of a consensus TATA box, TATAAAA (23Strubin M. Struhl K. Cell. 1992; 68: 721-730Abstract Full Text PDF PubMed Scopus (135) Google Scholar). For example, the rabbit uteroglobin gene depends upon a noncanonical TATA box for transmission of cell specific effects (7Klug J. Knapp S. Castro I. Beato M. Mol. Cell. Biol. 1994; 14: 6208-6218Crossref PubMed Scopus (16) Google Scholar) and in the bone sialoprotein promoter, a noncanonical TATA box, TTTATA, may be involved in vitamin D-dependent gene repression (8Li J.J. Kim R.H. Sodek J. Biochem. J. 1995; 310: 33-40Crossref PubMed Scopus (54) Google Scholar). Thus, at times a nonconsensus DNA sequence may be a prerequisite for proper gene regulation. Competitive binding of transcription factors to a common binding site has been proposed in many cases as a functional regulatory mechanism for gene transcription. Signal transduction by steroid hormones through NRs provides several well documented examples of this mode of gene regulation. For example, in the case of the c-fos gene, the GR competes for binding with the serum response factor for a common binding site, and in the case of the bovine prolactin gene, competition takes place between GR and a cell specific positive acting DNA binding factor (11Karagianni N. Tsawdaroglou N. Oncogene. 1994; 9: 2327-2334PubMed Google Scholar, 27Cairns C. Cairns W. Okret S. DNA Cell Biol. 1993; 12: 695-702Crossref PubMed Scopus (48) Google Scholar). Both of these examples are quite complex in that the fundamental mechanism of repression in which displacement of an activator with another activator (GR) results in repression remains unknown. However, in the example studied here, the mechanism by which GR binding represses transcription is much simpler to understand in that GR binding displaces the basal factor TFIID from the TATA box, thus disrupting the preinitiation complex that is required for transcription to occur. For competitive binding to be an effective mode of transcriptional regulation, the two factors must be able to displace one another. Thus, in theory, neither factor should bind its site too tightly (although regulatory schemes involving ligand-dependent transcriptional regulators, such as NRs, should be able to bypass this requirement for that particular factor). This is particularly true with schemes that involve TFIID as one of the members as it binds a consensus TATA box with an off-rate in excess of 2 h making displacement more difficult (28Hoopes B.C. LeBlanc J.F. Hawley D.K. J. Biol. Chem. 1992; 267: 11539-11547Abstract Full Text PDF PubMed Google Scholar). Consistent with this hypothesis, we show here that in the case of the human osteocalcin gene, a weaker nonconsensus TATA box is absolutely essential for glucocorticoid-mediated repression. We found that by altering the WT human osteocalcin TATA box, TATAAAC, to a consensus TATA box sequence, TATAAAA, the negative transcriptional effect of glucocorticoids on the osteocalcin transcription rate was decreased without affecting GR binding. Additionally, as predicted from previously published work (6Wobbe C.R. Struhl K. Mol. Cell. Biol. 1990; 10: 3859-3867Crossref PubMed Scopus (239) Google Scholar, 20Starr D.B. Hoopes B.C. Hawley D.K. J. Mol. Biol. 1995; 250: 434-446Crossref PubMed Scopus (158) Google Scholar), we show that the TBP binds the consensus TATA box much more strongly than the WT osteocalcin TATA box and that the WT nonconsensus TATA box supports lower levels of transcription. Thus, when taken together, these results are consistent with glucocorticoid-mediated repression occurring via a competitive binding mechanism between TFIID and GR at the human osteocalcin promoter. The findings we obtained with the different TATA box variants may represent two different prerequisites for gene regulation by an occlusion mechanism, the affinity of a transcription factor for its binding site and the availability of a site because of particular DNA architecture. Failure to repress at the WT TATAAAA sequence may occur because of one or both of these criteria. For example, GR may simply have more difficulty displacing TFIID from TATAAAA as TFIID binds this site too tightly. Alternatively, GR may have difficulty displacing TFIID from TATAAAA because the architecture of the DNA in these two TBP-TATA box complexes is predicted to be different. Several reports have suggested that TBP binding to the TATA box element induces a bend within the target site and that the degree and magnitude of this bend is directly correlated to the strength of TBP binding (29Kim Y. Geiger J.H. Hahn S. Sigler P.B. Nature. 1993; 365: 512-520Crossref PubMed Scopus (1016) Google Scholar, 30Kim J.L. Nikolov D.B. Burley S.K. Nature. 1993; 365: 520-527Crossref PubMed Scopus (972) Google Scholar, 31Horikoshi M. Bertuccioli C. Takada R. Wang J. Yamamoto T. Roeder R.G. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 1060-1064Crossref PubMed Scopus (111) Google Scholar). The bend angle for a consensus TATA box has been described to be 93 °C as compared with a TATAAAC element which bends the DNA 34 °C (20Starr D.B. Hoopes B.C. Hawley D.K. J. Mol. Biol. 1995; 250: 434-446Crossref PubMed Scopus (158) Google Scholar). The moderate distortion of the target DNA element observed with TATAAAC may increase the chance for a competitive factor to bind to an overlapping binding site. At this time there is no way to distinguish between these two models as no TATA box mutation has been reported that separates binding affinity from architecture. In fact, it may be that GR-mediated displacement of TFIID is hampered by both steric hinderance of the structure of the DNA as well as the off-rate of TFIID. The observation that an optimized TFIIB recognition site2obtained from studies with promoters containing a standard strong TATA element did not affect GR-mediated repression of the osteocalcin gene, supports our notion that TFIID binding has a central role in our defined model system. We conclude that the reduced binding affinity and/or DNA bend angle of the TFIID-TATA box complex at the osteocalcin promoter is a major precondition for GR-mediated repression at that promoter. This supports a model involving competitive DNA binding of GR and TFIID as an explanation for conditional repression of the osteocalcin gene by glucocorticoids.
The action of the glucocorticoid receptor (GR) on beta-casein gene transcription serves as a well-studied example of a case where the action of the GR is dependent on the activity of another transcription factor, STAT5. We have investigated the domain-requirement of the GR for this synergistic response in transfection experiments employing GR mutants and CV-1 or COS-7 cells. The results were influenced by the expression levels of the GR constructs. At low expression, STAT5-dependent transactivation by mutants of the GR DNA binding domain or N-terminal transactivation domain was impaired and the antiglucocorticoid RU486 exhibited a weak agonistic activity. When the N-terminal region of the GR was exchanged with the respective domain of the progesterone receptor, STAT5-dependent transactivation was reduced at low and high expression levels. Only at high expression levels did the GR exhibit the properties of a coactivator and enhanced STAT5 activity in the absence of a functional DNA binding domain and of GR binding sites in the proximal region of the beta-casein gene promoter. Furthermore, at high GR expression levels RU486 was nearly as efficient as dexamethasone in activating transcription via the STAT5 dependent beta-casein gene promoter. The results reconcile the controversial issue regarding the DNA binding-independent action of the GR together with STAT5 and provide evidence that the mode of action of the GR depends not only on the type of the particular promoter at which it acts but also on the concentration of the GR. GR DNA binding function appears to be mandatory for beta-casein gene expression in mammary epithelial cells, since the promoter function is completely dependent on the integrity of GR binding sites in the promoter.
The glucocorticoid receptor (GR) can both activate and repress transcription of target genes by interaction with specific genomic response elements, glucocorticoid response elements (GREs). Activation of transcription is usually the result of the direct interaction between GR and the GRE, whereas GR-mediated transcription repression is either the result of the indirect action of GR, mediated by a response element as a result of protein·protein interaction or by an occlusion mechanism in which GR displaces a general or regulatory transcription factor. A specific mutation of rat GR, K461A, has previously been described to transform the indirect protein·protein interaction-dependent transrepressive effect of GR into an activating function (Starr, D. B., Matsui, W., Thomas, J. R., and Yamamoto, K. R. (1996) Genes Dev. 10, 1271–1283). In HOS D4 and COS7 cells, this mutation was shown to transform the transrepressive effect of wild-type GR, acting on reporter constructs containing the composite GRE from the proliferin gene (plfG) or the negative tethering GRE from the collagenase A promoter (colA), into an activating function. In contrast, the K461A mutation had no effect on the transrepressive effect of GR on the human osteocalcin gene in which repression apparently occurs through the binding of GR to a negative GRE that overlaps the TATA box. The transrepressive function, typically 40% of the basal level in the absence of hormone, required only the isolated DNA-binding domain of wild type or mutant GR and was independent of the nature of transactivation domain. Thus, mutation of rat GR at position 461 differentiates between transrepressive functions of GR dependent on GR·DNA interaction (repression by occlusion) and GR·protein interaction (active repression). The glucocorticoid receptor (GR) can both activate and repress transcription of target genes by interaction with specific genomic response elements, glucocorticoid response elements (GREs). Activation of transcription is usually the result of the direct interaction between GR and the GRE, whereas GR-mediated transcription repression is either the result of the indirect action of GR, mediated by a response element as a result of protein·protein interaction or by an occlusion mechanism in which GR displaces a general or regulatory transcription factor. A specific mutation of rat GR, K461A, has previously been described to transform the indirect protein·protein interaction-dependent transrepressive effect of GR into an activating function (Starr, D. B., Matsui, W., Thomas, J. R., and Yamamoto, K. R. (1996) Genes Dev. 10, 1271–1283). In HOS D4 and COS7 cells, this mutation was shown to transform the transrepressive effect of wild-type GR, acting on reporter constructs containing the composite GRE from the proliferin gene (plfG) or the negative tethering GRE from the collagenase A promoter (colA), into an activating function. In contrast, the K461A mutation had no effect on the transrepressive effect of GR on the human osteocalcin gene in which repression apparently occurs through the binding of GR to a negative GRE that overlaps the TATA box. The transrepressive function, typically 40% of the basal level in the absence of hormone, required only the isolated DNA-binding domain of wild type or mutant GR and was independent of the nature of transactivation domain. Thus, mutation of rat GR at position 461 differentiates between transrepressive functions of GR dependent on GR·DNA interaction (repression by occlusion) and GR·protein interaction (active repression). Negative regulation of gene transcription by glucocorticoids and other ligands for nuclear receptor proteins appears to be carried out either by mechanisms involving interference with the DNA binding of upstream or general transcription factors or, alternatively, by repression mechanisms independent of DNA binding. In the first case, transcription repression involves a competition between transcriptionally active and inactive proteins for common or overlapping DNA-binding sites. Thus, transcription repression is achieved when the inactive factor displaces the more active one. For the latter mode, transcriptional repression is achieved by an as yet unidentified mechanism that is postulated to involve a physical interaction between the two proteins in a DNA-independent manner and, presumably, the formation of a transcriptionally inactive complex. The signal transduction pathway of glucocorticoid hormones provides a number of well described examples for which possible mechanisms involved in negative gene regulation have been postulated. Signal transduction is mediated by an intracellular receptor protein, that, like many other members of the steroid receptor superfamily, functions as a ligand-activated nuclear transcriptional regulator (1Mangelsdorf D.J. Thummel C. Beato M. Herrlich P. Schütz G. Umesono K. Blumberg B. Kastner P. Mark M. Chambon P. Evans R.M. Cell. 1995; 83: 835-839Abstract Full Text PDF PubMed Scopus (6043) Google Scholar, 2Tsai M.J. O'Malley B.W. Annu. Rev. Biochem. 1994; 63: 451-486Crossref PubMed Scopus (2682) Google Scholar). The classical mode of gene regulation by glucocorticoids, which accounts for most cases of positive gene regulation, is known to be mediated by interaction of the ligand-activated GR 1The abbreviations and trivial names used are: GR, glucocorticoid receptor; GRE, glucocorticoid response element; nGRE, negative glucocorticoid response element; DBD, DNA-binding domain; dexamethasone, 9α-fluoro-16α-methyl-11β,17,21-trihydroxy-pregna-1,4-diene-3,20-dione; TBP, TATA-binding protein; wt, wild type; bp, base pair(s).1The abbreviations and trivial names used are: GR, glucocorticoid receptor; GRE, glucocorticoid response element; nGRE, negative glucocorticoid response element; DBD, DNA-binding domain; dexamethasone, 9α-fluoro-16α-methyl-11β,17,21-trihydroxy-pregna-1,4-diene-3,20-dione; TBP, TATA-binding protein; wt, wild type; bp, base pair(s). with positive control elements (glucocorticoid response elements; GREs) which are present in single or multiple copies upstream of or within target genes (3Truss M. Beato M. Endocr. Rev. 1993; 14: 459-479Crossref PubMed Scopus (588) Google Scholar). Although not completely understood, the mechanism by which GR activates transcription in response to glucocorticoids is fairly simple in comparison to the variety of mechanisms employed by nuclear receptor proteins for the negative modulation of gene transcription (4Birnberg N.C. Lissitzky J.C. Hinman M. Herbert E. Proc. Natl. Acad. Sci. U. S. A. 1983; 80: 6982-6986Crossref PubMed Scopus (188) Google Scholar, 5Akerblom I.E. Slater E.P. Beato M. Baxter J.D. Mellon P.L. Science. 1988; 241: 350-353Crossref PubMed Scopus (340) Google Scholar, 6Weiner F.R. Czaja M.J. Jefferson D.M. Giambrone M.-A. Tur-Kaspa R. Reid L.M. Zern M.A. J. Biol. Chem. 1987; 262: 6955-6958Abstract Full Text PDF PubMed Google Scholar). Despite recent advances, it has not been possible to formulate a simple, all inclusive model accounting for negative gene regulation mediated by GR (7Saatcioglu F. Claret F.X. Karin M. Semin. Cancer Biol. 1994; 5: 347-359PubMed Google Scholar, 8Karin M. Yang-Yen H.F. Chambard J.C. Deng T. Saatcioglu F. Eur. J. Clin. Pharmacol. 1993; 45: S43-S44Crossref Scopus (41) Google Scholar), although several physiologically relevant models have been suggested for the small number of genes studied mechanistically in a detailed manner. It has become apparent that simple DNA binding by the receptor may not be sufficient or, in some cases, even required for ligand-dependent repression for the majority of examples described for glucocorticoid-mediated transcription repression, which are related to their anti-inflammatory effects (9Caldenhoven E. Lidén J. Wissink S. Van de Stolpe A. Raaijmakers J. Koenderman L. Okret S. Gustafsson J.-Å. Van der Saag P.T. Mol. Endocrinol. 1995; 9: 401-412Crossref PubMed Google Scholar, 10Auphan N. DiDonato J.A. Rosette C. Helmberg A. Karin M. Science. 1995; 270: 286-290Crossref PubMed Scopus (2147) Google Scholar, 11Scheinman R.I. Gualberto A. Jewell C.M. Cidlowski J.A. Baldwin Jr., A.S. Mol. Cell. Biol. 1995; 15: 943-953Crossref PubMed Google Scholar). One of the best characterized examples of this mode of repression is the interaction between the transcriptional activator AP1 and the activated GR. Under certain conditions, interference between the GR and the AP1 signal transduction pathways appears to occur on composite response elements that have the potential to bind both the receptor and the AP1 complex, whereas in other cases, the repression mechanism requires only an AP1·DNA interaction (18König H. Ponta H. Rahmsdorf H.J. Herrlich P. EMBO J. 1992; 11: 2241-2246Crossref PubMed Scopus (233) Google Scholar, 19Diamond M.I. Miner J.N. Yoshinaga S.K. Yamamoto K.R. Science. 1990; 249: 1266-1272Crossref PubMed Scopus (1067) Google Scholar). An example of the first case is seen within the promoter region of the proliferin gene. A 25-bp composite GRE, termed plfG, is responsible for mediating the negative GR effect. GR binds to plfG in the absence of AP1, but regulates transcription only in the presence of AP1, activating if AP1 consists of c-Jun homodimers, and repressing if AP1 is comprised of c-Jun·c-Fos heterodimers (19Diamond M.I. Miner J.N. Yoshinaga S.K. Yamamoto K.R. Science. 1990; 249: 1266-1272Crossref PubMed Scopus (1067) Google Scholar, 20Pearce D. Yamamoto K.R. Science. 1993; 259: 1161-1165Crossref PubMed Scopus (397) Google Scholar). An example of the alternative AP1-dependent mechanism is the glucocorticoid-dependent repression of the collagenase gene. This effect requires AP1 binding to its specific recognition element in the upstream promoter region of the collagenase gene, whereas direct GR·DNA contact does not seem to be a prerequisite for efficient ligand-dependent repression of the activated gene expression level. Although the GR does not bind to the AP1 site, a functional GR DBD is required for repression of AP1 activity. A direct protein·protein interaction between GR and AP1 has been demonstrated (18König H. Ponta H. Rahmsdorf H.J. Herrlich P. EMBO J. 1992; 11: 2241-2246Crossref PubMed Scopus (233) Google Scholar, 21Heck S. Kullmann M. Gast A. Ponta H. Rahmsdorf H.J. Herrlich P. Cato A.C. EMBO J. 1994; 13: 4087-4095Crossref PubMed Scopus (464) Google Scholar). There are some cases, however, where DNA binding by GR is both necessary and sufficient for transcription repression. For example, at the pro-opiomelanocortin gene, repression occurs without assistance or interference from other sequence-specific transcription factors (12Drouin J. Sun Y.L. Chamberland M. Gauthier Y. De Lean A. Nemer M. Schmidt T.J. EMBO J. 1993; 12: 145-156Crossref PubMed Scopus (269) Google Scholar,13Riegel A.T. Lu Y. Remenick J. Wolford R.G. Berard D.S. Hager G.L. Mol. Endocrinol. 1991; 5: 1973-1982Crossref PubMed Scopus (35) Google Scholar). Detailed analysis of the interaction between GR and the GRE indicated that three moieties of the receptor molecule form a unique complex with the pro-opiomelanocortin GRE, in contrast to a positive regulated GRE which interacts with the receptor protein as a homodimer (14Dahlman-Wright K. Wright A. Gustafsson J.-Å. Carlstedt-Duke J. J. Biol. Chem. 1991; 266: 3107-3112Abstract Full Text PDF PubMed Google Scholar). Examples of repression due to transcriptional interference with other regulatory proteins at a response element have been postulated in several cases including the bovine prolactin and the c-fosgenes (15Cairns C. Cairns W. Okret S. DNA Cell Biol. 1993; 12: 695-702Crossref PubMed Scopus (48) Google Scholar, 16Karagianni N. Tsawdaroglou N. Oncogene. 1994; 9: 2327-2334PubMed Google Scholar, 17Sakai D.D. Helms S. Carlstedt-Duke J. Gustafsson J.-Å. Rottman F.M. Yamamoto K.R. Genes Dev. 1988; 2: 1144-1154Crossref PubMed Scopus (332) Google Scholar). A final example of a gene negatively regulated by glucocorticoids through an interference mechanism is the human bone-specific gene osteocalcin (22Celeste A.J. Rosen V. Buecker J.L. Kriz R. Wang E.A. Wozney J.M. EMBO J. 1986; 5: 1885-1890Crossref PubMed Scopus (353) Google Scholar, 23Morrison N.A. Shine J. Fragonas J.C. Verkest V. McMenemy M.L. Eisman J.A. Science. 1989; 246: 1158-1161Crossref PubMed Scopus (337) Google Scholar, 24Hauschka P.V. Lian J.B. Cole D.E. Gundberg C.M. Physiol. Rev. 1989; 69: 990-1047Crossref PubMed Scopus (1032) Google Scholar). The overlap of a competitive nGRE with the basal TATA box element suggested that the hormone-activated GR can function as a negative regulator on osteocalcin gene activity by competing with a specific TFIID-induced complex at the DNA binding level and that this binding is mutually exclusive (25Meyer, T., Gustafsson, J.-Å., and Carlstedt-Duke, J. (1997) DNA Cell Biol. , 16, in press.Google Scholar, 26Strömstedt P.E. Poellinger L. Gustafsson J.-Å. Carlstedt-Duke J. Mol. Cell. Biol. 1991; 11: 3379-3383Crossref PubMed Scopus (139) Google Scholar). GR action is strongly determined by its context within the unique architecture and requirements of each gene promoter (27Miner J.N. Yamamoto K.R. Trends Biochem. Sci. 1991; 16: 423-426Abstract Full Text PDF PubMed Scopus (195) Google Scholar, 28Lefstin J.A. Thomas J.R. Yamamoto K.R. Genes Dev. 1994; 8: 2842-2856Crossref PubMed Scopus (112) Google Scholar). As demonstrated by the above described examples of glucocorticoid-dependent transcriptional regulation, GREs can be classified into at least three independent subclasses: simple GREs capable of interacting with the hormone-induced receptor without the assistance of other sequence-specific regulators, resulting in transactivation or, in more specialized cases, repression; composite GREs having the ability to interact with the receptor protein and additional factors resulting in either transactivation or transrepression; and cases in which direct GR·DNA interaction is not required for GR-mediated gene regulation, called tethering GREs (18König H. Ponta H. Rahmsdorf H.J. Herrlich P. EMBO J. 1992; 11: 2241-2246Crossref PubMed Scopus (233) Google Scholar,21Heck S. Kullmann M. Gast A. Ponta H. Rahmsdorf H.J. Herrlich P. Cato A.C. EMBO J. 1994; 13: 4087-4095Crossref PubMed Scopus (464) Google Scholar). Starr et al. (29Starr D.B. Matsui W. Thomas J.R. Yamamoto K.R. Genes Dev. 1996; 10: 1271-1283Crossref PubMed Scopus (109) Google Scholar) defined a single amino acid change (K461A) within the rat GR capable of distinguishing between simple GREs and composite and tethering GREs. The receptor, containing a mutation within the DBD at position 461 (human GR 442), provides a powerful tool for comparing and defining mechanisms involved in transmission of negative regulation by GR. To further characterize the mechanism proposed for the repression of the human osteocalcin gene by glucocorticoids, we compared the action of this specific mutated receptor, chimeric proteins containing the GR DBD as well as the isolated GR DBD on both the osteocalcin promoter and the two well defined AP1-dependent systems described above, colA and plfG. In this report we present evidence that the mechanism involved in the negative transcriptional effect mediated by glucocorticoids on the human osteocalcin promoter is strictly dependent on binding of GR to a composite functional GRE (competitive nGRE). DNA binding and cotransfection experiments suggest that the hormone activated GR and the specific GR mutant K461A repress osteocalcin gene activity in a similar fashion, primarily mediated by competitive binding to a dual binding site that disrupts an alternative protein·DNA contact. The plasmid pOSCAT containing the promoter region of the target gene was cut withSacI and XhoI to obtain a fragment spanning nucleotides −344/+31 of the osteocalcin promoter (23Morrison N.A. Shine J. Fragonas J.C. Verkest V. McMenemy M.L. Eisman J.A. Science. 1989; 246: 1158-1161Crossref PubMed Scopus (337) Google Scholar). The fragment was ligated into the corresponding restriction sites of pGL2 Enh (Promega) to drive the firefly luciferase gene (pOS-344Luc). The constructs colA-Luc and plfG3-Luc are as described previously (29Starr D.B. Matsui W. Thomas J.R. Yamamoto K.R. Genes Dev. 1996; 10: 1271-1283Crossref PubMed Scopus (109) Google Scholar). The rat GR expression vector 6RGR, 6RGR-K461A, 6RGR(407–525), and 6RGR-K461A(407–525) are as described elsewhere (29Starr D.B. Matsui W. Thomas J.R. Yamamoto K.R. Genes Dev. 1996; 10: 1271-1283Crossref PubMed Scopus (109) Google Scholar). The expression plasmids for 407–556-VP16 and 407–556(K461A)-VP16 were constructed as follows. The HindIII-XbaI fragment from pG1-X556-VP16 (kindly provided by J. A. Lefstin) was cloned into the HindIII-SpeI sites of KS + GR(407–523) (29Starr D.B. Matsui W. Thomas J.R. Yamamoto K.R. Genes Dev. 1996; 10: 1271-1283Crossref PubMed Scopus (109) Google Scholar). The resulting plasmid was cut with KpnI andPvuII, and the fragment containing the GR sequence was cloned into the KpnI-EcoRV sites of pS6R (30Miner J.N. Diamond M.I. Yamamoto K.R. Cell Growth Differ. 1991; 2: 525-530PubMed Google Scholar), yielding 6R-407–556-VP16. The 6R-407–556(K461A)-VP16 construct was made by ligating the KpnI-BstBI fragment from KS + GR-K461A(407–523) into the KpnI-BstBI sites of 6R-407–525-VP16. These plasmids were verified by sequencing the relevant parts of the resulting constructs. HOS D4 osteosarcoma cells were cultured at 37 °C in a humidified atmosphere with 5% CO2 in Eagle's medium buffered with bicarbonate and supplemented with 5% fetal calf serum, penicillin (100 IU/ml), and streptomycin (0.1 mg/ml). COS7 cells were cultured in Dulbecco's modified Eagle's medium supplemented as described above. Cells were seeded in 6-cm plates 24 h before a transfection experiment and transfected at 50–60% confluence using the calcium phosphate coprecipitation technique. The precipitate contained 5 μg of supercoiled luciferase reporter plasmid DNA and varying amounts (0–2 μg) of different expression plasmids. The overall amount of DNA was kept constant by the addition of parent expression vector. After 12–14-h exposure to the calcium phosphate precipitate, medium was refreshed and cells treated for 24 h with 20 nmdexamethasone. Transfected cells were subsequently harvested for luciferase assay by scraping the cells into 1 ml of phosphate-buffered saline, cenrtrifuging for 10 min in a microcentrifuge, and resuspending in 50 μl of lysis buffer (25 mm Tris acetate, pH 7.8, 2 mm dithiothreitol, 1.5 mm EDTA, 10% glycerol, and 1% Triton X-100). Luciferase activity was monitored according to the GenGlow luciferase assay kit (Bio Orbit) using an Anthos Lucy 1 luminometer. The results are expressed as light units measured. All experiments were performed in triplicate on three separate occasions. Extracts from COS7 cells, transiently transfected with 15 μg of GR expression vector/15-cm cell culture plate, were prepared by homogenizing the cell pellets with a Dounce homogenizer in 500 μl of 10 mm sodium phosphate, pH 7.4, 1 mm EDTA, 0.5 mm dithiothreitol, 10% glycerol, 400 mm KCl, and centrifugation at 100,000 ×g for 1 h. The supernatant was aliqoted and stored at −70 °C. GR binding activity was monitored by an electrophoretic gel mobility shift assay. A 32P-labeled, double-stranded oligonucleotide spanning the GRE sequence and TATA box of the human osteocalcin promoter (−41/−9) or mutated versions of this DNA stretch were used as specific probe (wt: AGCCCAGAGGGTATAAACAGTGCTGGAGG, mutant: AGCCCAGAGGGTgTAAACAGTGCTGGAGG). The recombinant GR was incubated for 10 min on ice in a buffer containing 0.5 μg of poly(dI·dC), 60 mm KCl, 10 mm Hepes, pH 7.9, 0.1 mm EDTA, 10% glycerol, 5 mm dithiothreitol. Competing oligonucleotides were incubated with the binding reactions for 10 min prior to addition of the 32P-labeled probe. After adding the specific DNA probe the mixture was incubated for 20 min at room temperature. The protein-DNA complexes were resolved on 5% native polyacrylamide gels. GR can antagonize the function of c-Jun and c-Fos, which are both components of the phorbol ester-activated transcription factor AP1 (8Karin M. Yang-Yen H.F. Chambard J.C. Deng T. Saatcioglu F. Eur. J. Clin. Pharmacol. 1993; 45: S43-S44Crossref Scopus (41) Google Scholar). We employed two well defined examples for repression of AP1-activated gene activity by GR to further characterize the mechanism of glucocorticoid mediated repression of the human osteocalcin gene in comparison. In all three examples of gene promoter regions used in this study, the negative modulation of target gene activity seems to be mediated by interference of hormone activated GR protein with positive acting sequence-specific transcription factors. The experimental basis for this comparative study was based on a recently published GR mutant having the ability to activate genes independent of the class of GRE used (29Starr D.B. Matsui W. Thomas J.R. Yamamoto K.R. Genes Dev. 1996; 10: 1271-1283Crossref PubMed Scopus (109) Google Scholar). In this mutant, an amino acid change from Lys to Ala at position 461 within the DBD of the rat GR resulted in a phenotype characterized by hormone-dependent transactivation at simple GREs as well as at composite and tethering GREs. As reference systems in the present study, we used either a promoter construct containing three copies of a 25-bp DNA sequence (composite GRE) from the proliferin promoter (plfG) (19Diamond M.I. Miner J.N. Yoshinaga S.K. Yamamoto K.R. Science. 1990; 249: 1266-1272Crossref PubMed Scopus (1067) Google Scholar) known to mediate a negative GR effect or an nGRE (tethering GRE) from the the collagenase promoter here denoted as colA (31Jonat C. Rahmsdorf H.J. Park K.K. Cato A.C. Gebel S. Ponta H. Herrlich P. Cell. 1990; 62: 1189-1204Abstract Full Text PDF PubMed Scopus (1367) Google Scholar). In contrast to the wt GR, which represses transcription from these two reporters, the GR mutant K461A activates transcription (25Meyer, T., Gustafsson, J.-Å., and Carlstedt-Duke, J. (1997) DNA Cell Biol. , 16, in press.Google Scholar, 26Strömstedt P.E. Poellinger L. Gustafsson J.-Å. Carlstedt-Duke J. Mol. Cell. Biol. 1991; 11: 3379-3383Crossref PubMed Scopus (139) Google Scholar, 29Starr D.B. Matsui W. Thomas J.R. Yamamoto K.R. Genes Dev. 1996; 10: 1271-1283Crossref PubMed Scopus (109) Google Scholar). We were interested in studying the effect of this constitutively positive acting receptor variant on the osteocalcin promoter-controlled transcription rate where the interdigitation of a GR binding site and the TATA box suggest that repression of osteocalcin gene expression is mediated by interference of the GR with the basal transcription machinery. To this end, we constructed a reporter plasmid containing a fragment of the human osteocalcin promoter spanning nucleotides −344/+31 driving the firefly luciferase gene. This reporter construct was introduced into the human osteosarcoma cell line HOS D4 or, alternatively, into COS7 cells. The endogenous GR in these cell lines are expressed at very low levels and are hardly detectable by ligand binding or immunochemical assays (32Alksnis M. Barkhem T. Strömstedt P.-E. Ahola H. Kutoh E. Gustafsson J.-Å. Poellinger L. Nilsson S. J. Biol. Chem. 1991; 266: 10078-10085Abstract Full Text PDF PubMed Google Scholar). Strikingly, the cotransfection of HOS D4 cells with either wt GR or the mutated receptor (K461A) together with the above described osteocalcin reporter construct resulted, after induction with the synthetic glucocorticoid dexamethasone, in a clear repression of the luciferase activity to 50% (Fig. 1 A). To exclude the influence of possible cell-specific effects on GR function, we repeated the experiments in the non-bone cell line COS7 and found again that the receptor variant K461A behaved in a similar fashion as the wt GR. Both hormone-activated GR variants had the capacity to repress basal osteocalcin gene activity (Fig. 1 B). The original characterization of the K461A mutant and its transformation from transrepression to transactivation of composite and tethering GREs was carried out in F9 mouse embryonic carcinoma cells and CV-1 cells (29Starr D.B. Matsui W. Thomas J.R. Yamamoto K.R. Genes Dev. 1996; 10: 1271-1283Crossref PubMed Scopus (109) Google Scholar). To exclude cell-specific differences in the function of the K461A mutant, the function of the composite plfG GRE and the tethering colA GRE was tested in COS7 cells. In contrast to the results obtained with the osteocalcin gene, the expression of the K461A GR mutant activated the gene activity in both reference promoters in COS7 cells (Fig. 2). In the presence of dexamethasone, wt GR repressed luciferase activity to 60% from a plfG GRE, whereas the K461A mutant induced luciferase activity about 25-fold (Fig. 2 A). The effect on the tethering colA element was similar but to a much lesser degree (Fig. 2 B) with dexamethasonedependent repression of luciferase activity to about 60% with wt GR and dexamethasone-dependent stimulation of luciferase activity to about 160% with the K461A mutant. We have previously shown that GR binds specifically to the negative response element thought to be responsible for the transrepressive effect on the human osteocalcin promoter (25Meyer, T., Gustafsson, J.-Å., and Carlstedt-Duke, J. (1997) DNA Cell Biol. , 16, in press.Google Scholar, 26Strömstedt P.E. Poellinger L. Gustafsson J.-Å. Carlstedt-Duke J. Mol. Cell. Biol. 1991; 11: 3379-3383Crossref PubMed Scopus (139) Google Scholar). The K461A mutant binds to the −41/−9 fragment of the human osteocalcin promoter, containing the nGRE, in a manner similar to that of wt GR (Fig. 3 A, lanes 3 and4). The GR-specific band with wt GR is competed for specifically by an unlabeled oligonucleotide containing a standard GRE sequence (tyrosine aminotransferase GRE; TAT) (Fig. 3 A,lanes 5 and 6). The use of a vitamin D-responsive element did not affect GR binding (Fig. 3 A, lane 7). Mutation of the nGRE sequence diminishes the GR-specific complex (Fig. 3 A, lane 10). Competitive DNA binding was estimated by titrating increasing amounts of the unlabeled probe into the binding reactions containing either wt GR or the K461A mutant. Measurement of the relative binding of the radiolabeled probe showed that there was no major difference in DNA-binding affinity between wt GR and the K461A mutant (Fig. 3 B). To further support the hypothesis that competitive GR binding is responsible for repression of the osteocalcin gene, we compared the effect of a GR chimera, containing the GR DBD K461A fused to the activation domain of the viral transcriptional activator VP16, on osteocalcin, pflG and colA controlled reporter gene activity. As shown in Fig. 4, expression of the GR-VP16 chimera containing the mutant K461A DBD increased the luciferase activity measured in the case of both reference promoters used in this study (Fig. 4, B and C). However, the repression mediated by this constitutively active chimeric transcription factor on osteocalcin gene transcription was still comparable to the repressive effect mediated by the wt GR-VP16 protein (Fig. 4 A). The magnitude of transactivation/transrepression with the GR K461A-VP16 chimera (Fig. 4 A) was identical to the dexamethasone-dependent activity of the full-length GR variants on osteocalcin promoter activity (Fig. 1). Thus, the repression of the osteocalcin promoter by GR is dependent on the DNA binding function and is independent of the transactivation domain associated. Finally, the function of the isolated DBD of the two GR variants was tested with regard to their transrepressive effect. Expression of the isolated DBD of either wt GR or the mutant K461A repressed the osteocalcin promoter to an equal degree, with virtually identical activity to the full-length variants (Fig. 5 A). In contrast, the isolated wt DBD had no effect on the plfG reporter activity (Fig. 5 B). The isolated DBD of the K461A GR mutant demonstrated a weak stimulatory activity on the plfG element (Fig. 5 B). However, this was considerably reduced compared with the dexamethasone-dependent activity of the full-length K461A mutant (Fig. 2 A). The repression of gene transcription is of particular interest since the mechanism underlying these repressive effects are less well understood than those governing activation. It has previously been shown that administration of glucocorticoids leads to a transcriptional repression of several target genes. These transrepressive effects of glucocorticoids are related to their clinically important anti-inflammatory effects (e.g. repression of collagenase A) or relevant side effects of pharmacological usage of glucocorticoids such as steroid-dependent osteoporosis (e.g.repression of osteocalcin) (23Morrison N.A. Shine J. Fragonas J.C. Verkest V. McMenemy M.L. Eisman J.A. Science. 1989; 246: 1158-1161Crossref PubMed Scopus (337) Google Scholar, 31Jonat C. Rahmsdorf H.J. Park K.K. Cato A.C. Gebel S. Ponta H. Herrlich P. Cell. 1990; 62: 1189-1204Abstract Full Text PDF PubMed Scopus (1367) Google Scholar, 33Heinrichs A.A. Bortell R. Rahman S. Stein J.L. Alnemri E.S. Litwack G. Lian J.B. Stein G.S. Biochemistry. 1993; 32: 11436-11444Crossref PubMed Scopus (41) Google Scholar). In contrast to the unifying model proposed for gene activation by GR, a simple unique model has not been formulated to account for receptor-dependent gene repression. In the present study we further characterized the mechanism underlying the negative glucocorticoid-dependent regulation of the human osteocalcin gene in comparison with two well described reference systems for repression committed by GR on phorbol ester-activated gene transcription, the mouse proliferin gene, and the collagenase A gene. We took advantage of a recently described rat GR variant, GR K461A, that is able to distinguish between at least three functional subclasses of glucocorticoid responsive elements: simple GREs binding the activated GR molecule in a homodimeric fashion,composite GREs in which the exertion of receptor action requires the binding of additional sequence specific transcription factors to a common binding site, and tethering GREs in which GR mediates the transcriptional rate of target genes by interfering with stimulatory transcriptional activators already bound to DNA (Fig. 6) (27Miner J.N. Yamamoto K.R. Trends Biochem. Sci. 1991; 16: 423-426Abstract Full Text PDF PubMed Scopus (195) Google Scholar). The K461A mutation results in a reduced transactivating activity on simple GREs that corresponds to a reduced binding affinity for the GRE sequence (29Starr D.B. Matsui W. Thomas J.R. Yamamoto K.R. Genes Dev. 1996; 10: 1271-1283Crossref PubMed Scopus (109) Google Scholar). On tethering or composite GREs, the K461A mutation results in a switch from glucocorticoid-dependent transrepression, in the presence of both c-Jun and c-Fos, to transactivation. Identical results were obtained in this study, using COS7 cells or HOS D4 osteosarcoma cells. Thus, the effect of the K461A mutation on AP1-dependent GR transrepression is not cell-specific. However, the magnitude of AP1-dependent GR-dependent transactivation of the colA element induced by the K461A mutation was considerably decreased as compared with that obtained previously with either F9 or CV-1 cells. The magnitude of induction induced by K461A on the plfG element was considerably larger and of the same order of magnitude seen previously in F9 and CV-1 cells. The osteocalcin gene is an osteoblast-specific gene expressed in late stages of differentiation (34Stein G.S. Lian J.B. Stein J.L. Van Wijnen A.J. Montecino M. Physiol. Rev. 1996; 76: 593-629Crossref PubMed Scopus (398) Google Scholar). Although the exact function of osteocalcin remains unclear, osteocalcin production is related to bone density and increased osteoblast activity (35Ducy P. Desbois C. Boyce B. Pinero G. Story B. Dunstan C. Smith E. Bonadio J. Goldstein S. Gundberg C. Bradley A. Karsenty G. Nature. 1996; 382: 448-452Crossref PubMed Scopus (1370) Google Scholar). Exposure to glucocorticoids results in the reduction of osteocalcin mRNA to about 50%. Analysis of the promoter region of the human osteocalcin gene identified one specific binding site for GR which completely overlapped the TATA box (26Strömstedt P.E. Poellinger L. Gustafsson J.-Å. Carlstedt-Duke J. Mol. Cell. Biol. 1991; 11: 3379-3383Crossref PubMed Scopus (139) Google Scholar). Transient expression of reporter genes driven by constructs containing the minimal osteocalcin promoter resulted in a glucocorticoid-dependent reduction in reporter gene activity to 50% or less (23Morrison N.A. Shine J. Fragonas J.C. Verkest V. McMenemy M.L. Eisman J.A. Science. 1989; 246: 1158-1161Crossref PubMed Scopus (337) Google Scholar, 25Meyer, T., Gustafsson, J.-Å., and Carlstedt-Duke, J. (1997) DNA Cell Biol. , 16, in press.Google Scholar). Mutations of the promoter that eliminated GR binding obliterated the glucocorticoid-dependent repression of reporter gene activity. GR homodimer and TBP bind competitively for overlapping DNA elements in vitro (25Meyer, T., Gustafsson, J.-Å., and Carlstedt-Duke, J. (1997) DNA Cell Biol. , 16, in press.Google Scholar). Based on these results we proposed a mechanism for glucocorticoid-dependent repression of the osteocalcin gene in which binding of GR to a negative GRE (competitive nGRE, Fig. 6) reduces the availability of the promoter for the basal transcriptional complex. Glucocorticoid-dependent transrepression of target genes by competitive binding of GR and transcriptional activators to overlapping DNA elements has been proposed for the regulation of the type 1 vasoactive intestinal polypeptide receptor gene as well as for the prolactin gene (15Cairns C. Cairns W. Okret S. DNA Cell Biol. 1993; 12: 695-702Crossref PubMed Scopus (48) Google Scholar, 17Sakai D.D. Helms S. Carlstedt-Duke J. Gustafsson J.-Å. Rottman F.M. Yamamoto K.R. Genes Dev. 1988; 2: 1144-1154Crossref PubMed Scopus (332) Google Scholar, 36Pei L. J. Biol. Chem. 1996; 271: 20879-20884Abstract Full Text Full Text PDF PubMed Scopus (99) Google Scholar). In contrast to the switch of AP1-dependent GR transrepression to transactivation by the K461A mutation, no effect at all was seen on the GR-dependent transrepression of the osteocalcin promoter. Both wt GR and the K461A mutant induced repression of the osteocalcin promoter to about 40% of basal activity. Both GR variants bound equally well to the osteocalcin nGRE (Fig. 3 B). This is in contrast to the decreased binding and function on a simple positive GRE and transactivation with the mutant as described previously (29Starr D.B. Matsui W. Thomas J.R. Yamamoto K.R. Genes Dev. 1996; 10: 1271-1283Crossref PubMed Scopus (109) Google Scholar). These results confirm the dependence of osteocalcin repression by glucocorticoids on GR·DNA interaction rather than by protein·protein interaction. Detailed molecular studies have demonstrated the functional requirement of the GR DBD in the modulation of gene expression by GR. The DBD has been shown to be necessary for both the transactivation and the transrepression functions of the receptor (20Pearce D. Yamamoto K.R. Science. 1993; 259: 1161-1165Crossref PubMed Scopus (397) Google Scholar, 28Lefstin J.A. Thomas J.R. Yamamoto K.R. Genes Dev. 1994; 8: 2842-2856Crossref PubMed Scopus (112) Google Scholar). The isolated DBD, either wt or the K461A mutant, were sufficient to induce transrepression of the osteocalcin promoter, which further strengthens the hypothesis of a direct competition in binding to overlapping DNA sequences between GR and TBP. In contrast, the isolated DBD was virtually inactive on the plfG element, even with the K461A mutation. Fusion of the DBD K461A to a heterologous transactivation domain from VP16 restored the function of the protein on the AP1-dependent elements, plfG and colA, resulting in constitutive transactivation with the K461A mutation. In contrast, the transrepression of the osteocalcin promoter remained unchanged, indicating that the glucocorticoid-dependent repression of the osteocalcin promoter is independent of the transactivation domain associated. In conclusion, mutation of a single amino acid located at the DNA-binding surface of rat GR, K461A, results in a receptor variant that can differentiate between two different mechanisms of glucocorticoid-dependent transrepression. The mutation switches AP1-dependent transrepression, involving protein·protein interaction, to transactivation, whereas DNA-dependent transrepression is unaffected. In the crystal structure of the rat GR DBD bound to a simple positive GRE (37Luisi B.F. Xu W.X. Otwinowski Z. Freedman L.P. Yamamoto K.R. Sigler P.B. Nature. 1991; 352: 497-505Crossref PubMed Scopus (1223) Google Scholar, 38Härd T. Kellenbach E. Boelens R. Maler B.A. Dahlman K. Freedman L.P. Carlstedt-Duke J. Yamamoto K.R. Gustafsson J.-Å. Kaptein R. Science. 1990; 249: 157-160Crossref PubMed Scopus (451) Google Scholar), the lysine side chain at position 461 makes a specific base contact with the DNA sequence. Loss of this contact following the mutation K461A would be expected to result in decreased affinity for the GRE and thereby decreased transactivation, which is what was previously reported for this mutation. However, the exact contacts between GR and the osteocalcin nGRE have not been demonstrated. The K461A mutation does not result in any loss in transrepression function, which would indicate that this residue does not play as active a role in binding to the osteocalcin nGRE as it does in binding to a classical positive GRE. Another explanation may be that Lys-461 plays an active role in DNA sequence-dependent conformational change of GR required for transactivation. In the osteocalcin nGRE, GR appears to exert its role by competing away TBP from the promoter, thereby reducing the transcriptional rate of the gene. Thus no further change or subsequent step in GR action would be required for the regulation of this gene. We thank Tony Wright for the careful reading of the manuscript and Jeff Lefstin for providing the pG1-X556-VP16 plasmid.
The glucocorticoid receptor (GR) activates transcription in certain glucocorticoid response element (GRE) contexts, and represses or displays no activity in others. We isolated point mutations in one GRE, plfG, at which GR activated transcription under conditions in which the wild-type element was inactive or conferred repression, implying that GREs may carry signals that are interpreted by bound receptors. Consistent with this notion, we identified a mutant rat GR, K461A, which activated transcription in all GRE contexts tested, implying that this residue is important in interpretation of GRE signals. In a yeast screen of 60,000 GR mutants for strong activation from plfG, all 13 mutants isolated contained substitutions at K461. This lysine residue is highly conserved in the zinc-binding region (ZBR) of the intracellular receptor (IR) superfamily; when it was mutated in MR and RARbeta, the resulting receptors similarly activated transcription at response elements that their wild-type counterparts repressed or were inactive. We suggest that IR response elements serve in part as signaling components, and that a critical lysine residue serves as an allosteric "lock" that restricts IRs to inactive or repressing configurations except in response element contexts that signal their conversion to transcriptional activators. Therefore, mutation of this residue produces altered receptors that activate in many or all response element contexts.
O1 The metabolomics approach to autism: identification of biomarkers for early detection of autism spectrum disorder A. K. Srivastava, Y. Wang, R. Huang, C. Skinner, T. Thompson, L. Pollard, T. Wood, F. Luo, R. Stevenson O2 Phenome-wide association study for smoking- and drinking-associated genes in 26,394 American women with African, Asian, European, and Hispanic descents R. Polimanti, J. Gelernter O3 Effects of prenatal environment, genotype and DNA methylation on birth weight and subsequent postnatal outcomes: findings from GUSTO, an Asian birth cohort X. Lin, I. Y. Lim, Y. Wu, A. L. Teh, L. Chen, I. M. Aris, S. E. Soh, M. T. Tint, J. L. MacIsaac, F. Yap, K. Kwek, S. M. Saw, M. S. Kobor, M. J. Meaney, K. M. Godfrey, Y. S. Chong, J. D. Holbrook, Y. S. Lee, P. D. Gluckman, N. Karnani, GUSTO study group O4 High-throughput identification of specific qt interval modulating enhancers at the SCN5A locus A. Kapoor, D. Lee, A. Chakravarti O5 Identification of extracellular matrix components inducing cancer cell migration in the supernatant of cultivated mesenchymal stem cells C. Maercker, F. Graf, M. Boutros O6 Single cell allele specific expression (ASE) IN T21 and common trisomies: a novel approach to understand DOWN syndrome and other aneuploidies G. Stamoulis, F. Santoni, P. Makrythanasis, A. Letourneau, M. Guipponi, N. Panousis, M. Garieri, P. Ribaux, E. Falconnet, C. Borel, S. E. Antonarakis O7 Role of microRNA in LCL to IPSC reprogramming S. Kumar, J. Curran, J. Blangero O8 Multiple enhancer variants disrupt gene regulatory network in Hirschsprung disease S. Chatterjee, A. Kapoor, J. Akiyama, D. Auer, C. Berrios, L. Pennacchio, A. Chakravarti O9 Metabolomic profiling for the diagnosis of neurometabolic disorders T. R. Donti, G. Cappuccio, M. Miller, P. Atwal, A. Kennedy, A. Cardon, C. Bacino, L. Emrick, J. Hertecant, F. Baumer, B. Porter, M. Bainbridge, P. Bonnen, B. Graham, R. Sutton, Q. Sun, S. Elsea O10 A novel causal methylation network approach to Alzheimer's disease Z. Hu, P. Wang, Y. Zhu, J. Zhao, M. Xiong, David A Bennett O11 A microRNA signature identifies subtypes of triple-negative breast cancer and reveals MIR-342-3P as regulator of a lactate metabolic pathway A. Hidalgo-Miranda, S. Romero-Cordoba, S. Rodriguez-Cuevas, R. Rebollar-Vega, E. Tagliabue, M. Iorio, E. D'Ippolito, S. Baroni O12 Transcriptome analysis identifies genes, enhancer RNAs and repetitive elements that are recurrently deregulated across multiple cancer types B. Kaczkowski, Y. Tanaka, H. Kawaji, A. Sandelin, R. Andersson, M. Itoh, T. Lassmann, the FANTOM5 consortium, Y. Hayashizaki, P. Carninci, A. R. R. Forrest O13 Elevated mutation and widespread loss of constraint at regulatory and architectural binding sites across 11 tumour types C. A. Semple O14 Exome sequencing provides evidence of pathogenicity for genes implicated in colorectal cancer E. A. Rosenthal, B. Shirts, L. Amendola, C. Gallego, M. Horike-Pyne, A. Burt, P. Robertson, P. Beyers, C. Nefcy, D. Veenstra, F. Hisama, R. Bennett, M. Dorschner, D. Nickerson, J. Smith, K. Patterson, D. Crosslin, R. Nassir, N. Zubair, T. Harrison, U. Peters, G. Jarvik, NHLBI GO Exome Sequencing Project O15 The tandem duplicator phenotype as a distinct genomic configuration in cancer F. Menghi, K. Inaki, X. Woo, P. Kumar, K. Grzeda, A. Malhotra, H. Kim, D. Ucar, P. Shreckengast, K. Karuturi, J. Keck, J. Chuang, E. T. Liu O16 Modeling genetic interactions associated with molecular subtypes of breast cancer B. Ji, A. Tyler, G. Ananda, G. Carter O17 Recurrent somatic mutation in the MYC associated factor X in brain tumors H. Nikbakht, M. Montagne, M. Zeinieh, A. Harutyunyan, M. Mcconechy, N. Jabado, P. Lavigne, J. Majewski O18 Predictive biomarkers to metastatic pancreatic cancer treatment J. B. Goldstein, M. Overman, G. Varadhachary, R. Shroff, R. Wolff, M. Javle, A. Futreal, D. Fogelman O19 DDIT4 gene expression as a prognostic marker in several malignant tumors L. Bravo, W. Fajardo, H. Gomez, C. Castaneda, C. Rolfo, J. A. Pinto O20 Spatial organization of the genome and genomic alterations in human cancers K. C. Akdemir, L. Chin, A. Futreal, ICGC PCAWG Structural Alterations Group O21 Landscape of targeted therapies in solid tumors S. Patterson, C. Statz, S. Mockus O22 Genomic analysis reveals novel drivers and progression pathways in skin basal cell carcinoma S. N. Nikolaev, X. I. Bonilla, L. Parmentier, B. King, F. Bezrukov, G. Kaya, V. Zoete, V. Seplyarskiy, H. Sharpe, T. McKee, A. Letourneau, P. Ribaux, K. Popadin, N. Basset-Seguin, R. Ben Chaabene, F. Santoni, M. Andrianova, M. Guipponi, M. Garieri, C. Verdan, K. Grosdemange, O. Sumara, M. Eilers, I. Aifantis, O. Michielin, F. de Sauvage, S. Antonarakis O23 Identification of differential biomarkers of hepatocellular carcinoma and cholangiocarcinoma via transcriptome microarray meta-analysis S. Likhitrattanapisal O24 Clinical validity and actionability of multigene tests for hereditary cancers in a large multi-center study S. Lincoln, A. Kurian, A. Desmond, S. Yang, Y. Kobayashi, J. Ford, L. Ellisen O25 Correlation with tumor ploidy status is essential for correct determination of genome-wide copy number changes by SNP array T. L. Peters, K. R. Alvarez, E. F. Hollingsworth, D. H. Lopez-Terrada O26 Nanochannel based next-generation mapping for interrogation of clinically relevant structural variation A. Hastie, Z. Dzakula, A. W. Pang, E. T. Lam, T. Anantharaman, M. Saghbini, H. Cao, BioNano Genomics O27 Mutation spectrum in a pulmonary arterial hypertension (PAH) cohort and identification of associated truncating mutations in TBX4 C. Gonzaga-Jauregui, L. Ma, A. King, E. Berman Rosenzweig, U. Krishnan, J. G. Reid, J. D. Overton, F. Dewey, W. K. Chung O28 NORTH CAROLINA macular dystrophy (MCDR1): mutations found affecting PRDM13 K. Small, A. DeLuca, F. Cremers, R. A. Lewis, V. Puech, B. Bakall, R. Silva-Garcia, K. Rohrschneider, M. Leys, F. S. Shaya, E. Stone O29 PhenoDB and genematcher, solving unsolved whole exome sequencing data N. L. Sobreira, F. Schiettecatte, H. Ling, E. Pugh, D. Witmer, K. Hetrick, P. Zhang, K. Doheny, D. Valle, A. Hamosh O30 Baylor-Johns Hopkins Center for Mendelian genomics: a four year review S. N. Jhangiani, Z. Coban Akdemir, M. N. Bainbridge, W. Charng, W. Wiszniewski, T. Gambin, E. Karaca, Y. Bayram, M. K. Eldomery, J. Posey, H. Doddapaneni, J. Hu, V. R. Sutton, D. M. Muzny, E. A. Boerwinkle, D. Valle, J. R. Lupski, R. A. Gibbs O31 Using read overlap assembly to accurately identify structural genetic differences in an ashkenazi jewish trio S. Shekar, W. Salerno, A. English, A. Mangubat, J. Bruestle O32 Legal interoperability: a sine qua non for international data sharing A. Thorogood, B. M. Knoppers, Global Alliance for Genomics and Health - Regulatory and Ethics Working Group O33 High throughput screening platform of competent sineups: that can enhance translation activities of therapeutic target H. Takahashi, K. R. Nitta, A. Kozhuharova, A. M. Suzuki, H. Sharma, D. Cotella, C. Santoro, S. Zucchelli, S. Gustincich, P. Carninci O34 The undiagnosed diseases network international (UDNI): clinical and laboratory research to meet patient needs J. J. Mulvihill, G. Baynam, W. Gahl, S. C. Groft, K. Kosaki, P. Lasko, B. Melegh, D. Taruscio O36 Performance of computational algorithms in pathogenicity predictions for activating variants in oncogenes versus loss of function mutations in tumor suppressor genes R. Ghosh, S. Plon O37 Identification and electronic health record incorporation of clinically actionable pharmacogenomic variants using prospective targeted sequencing S. Scherer, X. Qin, R. Sanghvi, K. Walker, T. Chiang, D. Muzny, L. Wang, J. Black, E. Boerwinkle, R. Weinshilboum, R. Gibbs O38 Melanoma reprogramming state correlates with response to CTLA-4 blockade in metastatic melanoma T. Karpinets, T. Calderone, K. Wani, X. Yu, C. Creasy, C. Haymaker, M. Forget, V. Nanda, J. Roszik, J. Wargo, L. Haydu, X. Song, A. Lazar, J. Gershenwald, M. Davies, C. Bernatchez, J. Zhang, A. Futreal, S. Woodman O39 Data-driven refinement of complex disease classification from integration of heterogeneous functional genomics data in GeneWeaver E. J. Chesler, T. Reynolds, J. A. Bubier, C. Phillips, M. A. Langston, E. J. Baker O40 A general statistic framework for genome-based disease risk prediction M. Xiong, L. Ma, N. Lin, C. Amos O41 Integrative large-scale causal network analysis of imaging and genomic data and its application in schizophrenia studies N. Lin, P. Wang, Y. Zhu, J. Zhao, V. Calhoun, M. Xiong O42 Big data and NGS data analysis: the cloud to the rescue O. Dobretsberger, M. Egger, F. Leimgruber O43 Cpipe: a convergent clinical exome pipeline specialised for targeted sequencing S. Sadedin, A. Oshlack, Melbourne Genomics Health Alliance O44 A Bayesian classification of biomedical images using feature extraction from deep neural networks implemented on lung cancer data V. A. A. Antonio, N. Ono, Clark Kendrick C. Go O45 MAV-SEQ: an interactive platform for the Management, Analysis, and Visualization of sequence data Z. Ahmed, M. Bolisetty, S. Zeeshan, E. Anguiano, D. Ucar O47 Allele specific enhancer in EPAS1 intronic regions may contribute to high altitude adaptation of Tibetans C. Zeng, J. Shao O48 Nanochannel based next-generation mapping for structural variation detection and comparison in trios and populations H. Cao, A. Hastie, A. W. Pang, E. T. Lam, T. Liang, K. Pham, M. Saghbini, Z. Dzakula O49 Archaic introgression in indigenous populations of Malaysia revealed by whole genome sequencing Y. Chee-Wei, L. Dongsheng, W. Lai-Ping, D. Lian, R. O. Twee Hee, Y. Yunus, F. Aghakhanian, S. S. Mokhtar, C. V. Lok-Yung, J. Bhak, M. Phipps, X. Shuhua, T. Yik-Ying, V. Kumar, H. Boon-Peng O50 Breast and ovarian cancer prevention: is it time for population-based mutation screening of high risk genes? I. Campbell, M.-A. Young, P. James, Lifepool O53 Comprehensive coverage from low DNA input using novel NGS library preparation methods for WGS and WGBS C. Schumacher, S. Sandhu, T. Harkins, V. Makarov O54 Methods for large scale construction of robust PCR-free libraries for sequencing on Illumina HiSeqX platform H. DoddapaneniR. Glenn, Z. Momin, B. Dilrukshi, H. Chao, Q. Meng, B. Gudenkauf, R. Kshitij, J. Jayaseelan, C. Nessner, S. Lee, K. Blankenberg, L. Lewis, J. Hu, Y. Han, H. Dinh, S. Jireh, K. Walker, E. Boerwinkle, D. Muzny, R. Gibbs O55 Rapid capture methods for clinical sequencing J. Hu, K. Walker, C. Buhay, X. Liu, Q. Wang, R. Sanghvi, H. Doddapaneni, Y. Ding, N. Veeraraghavan, Y. Yang, E. Boerwinkle, A. L. Beaudet, C. M. Eng, D. M. Muzny, R. A. Gibbs O56 A diploid personal human genome model for better genomes from diverse sequence data K. C. C. Worley, Y. Liu, D. S. T. Hughes, S. C. Murali, R. A. Harris, A. C. English, X. Qin, O. A. Hampton, P. Larsen, C. Beck, Y. Han, M. Wang, H. Doddapaneni, C. L. Kovar, W. J. Salerno, A. Yoder, S. Richards, J. Rogers, J. R. Lupski, D. M. Muzny, R. A. Gibbs O57 Development of PacBio long range capture for detection of pathogenic structural variants Q. Meng, M. Bainbridge, M. Wang, H. Doddapaneni, Y. Han, D. Muzny, R. Gibbs O58 Rhesus macaques exhibit more non-synonymous variation but greater impact of purifying selection than humans R. A. Harris, M. Raveenedran, C. Xue, M. Dahdouli, L. Cox, G. Fan, B. Ferguson, J. Hovarth, Z. Johnson, S. Kanthaswamy, M. Kubisch, M. Platt, D. Smith, E. Vallender, R. Wiseman, X. Liu, J. Below, D. Muzny, R. Gibbs, F. Yu, J. Rogers O59 Assessing RNA structure disruption induced by single-nucleotide variation J. Lin, Y. Zhang, Z. Ouyang P1 A meta-analysis of genome-wide association studies of mitochondrial dna copy number A. Moore, Z. Wang, J. Hofmann, M. Purdue, R. Stolzenberg-Solomon, S. Weinstein, D. Albanes, C.-S. Liu, W.-L. Cheng, T.-T. Lin, Q. Lan, N. Rothman, S. Berndt P2 Missense polymorphic genetic combinations underlying down syndrome susceptibility E. S. Chen P4 The evaluation of alteration of ELAM-1 expression in the endometriosis patients H. Bahrami, A. Khoshzaban, S. Heidari Keshal P5 Obesity and the incidence of apolipoprotein E polymorphisms in an assorted population from Saudi Arabia population K. K. R. Alharbi P6 Genome-associated personalized antithrombotical therapy for patients with high risk of thrombosis and bleeding M. Zhalbinova, A. Akilzhanova, S. Rakhimova, M. Bekbosynova, S. Myrzakhmetova P7 Frequency of Xmn1 polymorphism among sickle cell carrier cases in UAE population M. Matar P8 Differentiating inflammatory bowel diseases by using genomic data: dimension of the problem and network organization N. Mili, R. Molinari, Y. Ma, S. Guerrier P9 Vulnerability of genetic variants to the risk of autism among Saudi children N. Elhawary, M. Tayeb, N. Bogari, N. Qotb P10 Chromatin profiles from ex vivo purified dopaminergic neurons establish a promising model to support studies of neurological function and dysfunction S. A. McClymont, P. W. Hook, L. A. Goff, A. McCallion P11 Utilization of a sensitized chemical mutagenesis screen to identify genetic modifiers of retinal dysplasia in homozygous Nr2e3rd7 mice Y. Kong, J. R. Charette, W. L. Hicks, J. K. Naggert, L. Zhao, P. M. Nishina P12 Ion torrent next generation sequencing of recessive polycystic kidney disease in Saudi patients B. M. Edrees, M. Athar, F. A. Al-Allaf, M. M. Taher, W. Khan, A. Bouazzaoui, N. A. Harbi, R. Safar, H. Al-Edressi, A. Anazi, N. Altayeb, M. A. Ahmed, K. Alansary, Z. Abduljaleel P13 Digital expression profiling of Purkinje neurons and dendrites in different subcellular compartments A. Kratz, P. Beguin, S. Poulain, M. Kaneko, C. Takahiko, A. Matsunaga, S. Kato, A. M. Suzuki, N. Bertin, T. Lassmann, R. Vigot, P. Carninci, C. Plessy, T. Launey P14 The evolution of imperfection and imperfection of evolution: the functional and functionless fractions of the human genome D. Graur P16 Species-independent identification of known and novel recurrent genomic entities in multiple cancer patients J. Friis-Nielsen, J. M. Izarzugaza, S. Brunak P18 Discovery of active gene modules which are densely conserved across multiple cancer types reveal their prognostic power and mutually exclusive mutation patterns B. S. Soibam P19 Whole exome sequencing of dysplastic leukoplakia tissue indicates sequential accumulation of somatic mutations from oral precancer to cancer D. Das, N. Biswas, S. Das, S. Sarkar, A. Maitra, C. Panda, P. Majumder P21 Epigenetic mechanisms of carcinogensis by hereditary breast cancer genes J. J. Gruber, N. Jaeger, M. Snyder P22 RNA direct: a novel RNA enrichment strategy applied to transcripts associated with solid tumors K. Patel, S. Bowman, T. Davis, D. Kraushaar, A. Emerman, S. Russello, N. Henig, C. Hendrickson P23 RNA sequencing identifies gene mutations for neuroblastoma K. Zhang P24 Participation of SFRP1 in the modulation of TMPRSS2-ERG fusion gene in prostate cancer cell lines M. Rodriguez-Dorantes, C. D. Cruz-Hernandez, C. D. P. Garcia-Tobilla, S. Solorzano-Rosales P25 Targeted Methylation Sequencing of Prostate Cancer N. Jäger, J. Chen, R. Haile, M. Hitchins, J. D. Brooks, M. Snyder P26 Mutant TPMT alleles in children with acute lymphoblastic leukemia from México City and Yucatán, Mexico S. Jiménez-Morales, M. Ramírez, J. Nuñez, V. Bekker, Y. Leal, E. Jiménez, A. Medina, A. Hidalgo, J. Mejía P28 Genetic modifiers of Alström syndrome J. Naggert, G. B. Collin, K. DeMauro, R. Hanusek, P. M. Nishina P31 Association of genomic variants with the occurrence of angiotensin-converting-enzyme inhibitor (ACEI)-induced coughing among Filipinos E. M. Cutiongco De La Paz, R. Sy, J. Nevado, P. Reganit, L. Santos, J. D. Magno, F. E. Punzalan , D. Ona , E. Llanes, R. L. Santos-Cortes , R. Tiongco, J. Aherrera, L. Abrahan, P. Pagauitan-Alan; Philippine Cardiogenomics Study Group P32 The use of "humanized" mouse models to validate disease association of a de novo GARS variant and to test a novel gene therapy strategy for Charcot-Marie-Tooth disease type 2D K. H. Morelli, J. S. Domire, N. Pyne, S. Harper, R. Burgess P34 Molecular regulation of chondrogenic human induced pluripotent stem cells M. A. Gari, A. Dallol, H. Alsehli, A. Gari, M. Gari, A. Abuzenadah P35 Molecular profiling of hematologic malignancies: implementation of a variant assessment algorithm for next generation sequencing data analysis and clinical reporting M. Thomas, M. Sukhai, S. Garg, M. Misyura, T. Zhang, A. Schuh, T. Stockley, S. Kamel-Reid P36 Accessing genomic evidence for clinical variants at NCBI S. Sherry, C. Xiao, D. Slotta, K. Rodarmer, M. Feolo, M. Kimelman, G. Godynskiy, C. O'Sullivan, E. Yaschenko P37 NGS-SWIFT: a cloud-based variant analysis framework using control-accessed sequencing data from DBGAP/SRA C. Xiao, E. Yaschenko, S. Sherry P38 Computational assessment of drug induced hepatotoxicity through gene expression profiling C. Rangel-Escareño, H. Rueda-Zarate P40 Flowr: robust and efficient pipelines using a simple language-agnostic approach;ultraseq; fast modular pipeline for somatic variation calling using flowr S. Seth, S. Amin, X. Song, X. Mao, H. Sun, R. G. Verhaak, A. Futreal, J. Zhang P41 Applying "Big data" technologies to the rapid analysis of heterogenous large cohort data S. J. Whiite, T. Chiang, A. English, J. Farek, Z. Kahn, W. Salerno, N. Veeraraghavan, E. Boerwinkle, R. Gibbs P42 FANTOM5 web resource for the large-scale genome-wide transcription start site activity profiles of wide-range of mammalian cells T. Kasukawa, M. Lizio, J. Harshbarger, S. Hisashi, J. Severin, A. Imad, S. Sahin, T. C. Freeman, K. Baillie, A. Sandelin, P. Carninci, A. R. R. Forrest, H. Kawaji, The FANTOM Consortium P43 Rapid and scalable typing of structural variants for disease cohorts W. Salerno, A. English, S. N. Shekar, A. Mangubat, J. Bruestle, E. Boerwinkle, R. A. Gibbs P44 Polymorphism of glutathione S-transferases and sulphotransferases genes in an Arab population A. H. Salem, M. Ali, A. Ibrahim, M. Ibrahim P46 Genetic divergence of CYP3A5*3 pharmacogenomic marker for native and admixed Mexican populations J. C. Fernandez-Lopez, V. Bonifaz-Peña, C. Rangel-Escareño, A. Hidalgo-Miranda, A. V. Contreras P47 Whole exome sequence meta-analysis of 13 white blood cell, red blood cell, and platelet traits L. Polfus, CHARGE and NHLBI Exome Sequence Project Working Groups P48 Association of adipoq gene with type 2 diabetes and related phenotypes in african american men and women: The jackson heart study S. Davis, R. Xu, S. Gebeab, P Riestra, A Gaye, R. Khan, J. Wilson, A. Bidulescu P49 Common variants in casr gene are associated with serum calcium levels in koreans S. H. Jung, N. Vinayagamoorthy, S. H. Yim, Y. J. Chung P50 Inference of multiple-wave population admixture by modeling decay of linkage disequilibrium with multiple exponential functions Y. Zhou, S. Xu P51 A Bayesian framework for generalized linear mixed models in genome-wide association studies X. Wang, V. Philip, G. Carter P52 Targeted sequencing approach for the identification of the genetic causes of hereditary hearing impairment A. A. Abuzenadah, M. Gari, R. Turki, A. Dallol P53 Identification of enhancer sequences by ATAC-seq open chromatin profiling A. Uyar, A. Kaygun, S. Zaman, E. Marquez, J. George, D. Ucar P54 Direct enrichment for the rapid preparation of targeted NGS libraries C. L. Hendrickson, A. Emerman, D. Kraushaar, S. Bowman, N. Henig, T. Davis, S. Russello, K. Patel P56 Performance of the Agilent D5000 and High Sensitivity D5000 ScreenTape assays for the Agilent 4200 Tapestation System R. Nitsche, L. Prieto-Lafuente P57 ClinVar: a multi-source archive for variant interpretation M. Landrum, J. Lee, W. Rubinstein, D. Maglott P59 Association of functional variants and protein physical interactions of human MUTY homolog linked with familial adenomatous polyposis and colorectal cancer syndrome Z. Abduljaleel, W. Khan, F. A. Al-Allaf, M. Athar , M. M. Taher, N. Shahzad P60 Modification of the microbiom constitution in the gut using chicken IgY antibodies resulted in a reduction of acute graft-versus-host disease after experimental bone marrow transplantation A. Bouazzaoui, E. Huber, A. Dan, F. A. Al-Allaf, W. Herr, G. Sprotte, J. Köstler, A. Hiergeist, A. Gessner, R. Andreesen, E. Holler P61 Compound heterozygous mutation in the LDLR gene in Saudi patients suffering severe hypercholesterolemia F. Al-Allaf, A. Alashwal, Z. Abduljaleel, M. Taher, A. Bouazzaoui, H. Abalkhail, A. Al-Allaf, R. Bamardadh, M. Athar
