11beta-hydroxysteroid dehydrogenases (11beta-HSD) perform prereceptor metabolism of glucocorticoids through interconversion of the active glucocorticoid, cortisol, with inactive cortisone. Although the immunosuppressive and anti-inflammatory activities of glucocorticoids are well documented, the expression of 11beta-HSD enzymes in immune cells is not well understood. Here we demonstrate that 11beta-HSD1, which converts cortisone to cortisol, is expressed only upon differentiation of human monocytes to macrophages. 11beta-HSD1 expression is concomitant with the emergence of peroxisome proliferator activating receptor gamma, which was used as a surrogate marker of monocyte differentiation. The type 2 enzyme, 11beta-HSD2, which converts cortisol to cortisone, was not detectable in either monocytes or cultured macrophages. Incubation of monocytes with IL-4 or IL-13 induced 11beta-HSD1 activity by up to 10-fold. IFN-gamma, a known functional antagonist of IL-4 and IL-13, suppressed the induction of 11beta-HSD1 by these cytokines. THP-1 cells, a human macrophage-like cell line, expressed 11beta-HSD1 and low levels of 11beta-HSD2. The expression of 11beta-HSD1 in these cells is up-regulated 4-fold by LPS. In summary, we have shown strong expression of 11beta-HSD1 in cultured human macrophages and THP-1 cells. The presence of the enzyme in these cells suggests that it may play a role in regulating the immune function of these cells.
Coagulation Factor XII (FXII) is an attractive novel target for antithrombotic therapies as studies with FXIIa inhibitors and FXII knockout mouse suggest FXII is critically involved in pathological thrombus formation but is dispensable for hemostasis. To further assess the role of FXII in thrombosis and hemostasis, FXII knockout or knockdown models in rat were established and characterized. FXII knockout in rat was generated via the Zinc Finger nuclease (ZFN) technology and confirmed by lack of detectable zymogen in circulation. Titratable FXII knockdown in rat was achieved with a siRNA reagent that is potent on FXII mRNA in liver and selective against all other coagulation factors. FXII knockout in rats produced marked antithrombotic efficacy in both the arteriovenous shunt model (~100% clot weight reduction), and the 10% FeCl 3 -induced carotid artery thrombosis model (no reduction in blood flow post injury), without any increase in the cuticle bleeding time compared to the WT control rats. Ex vivo aPTT and ellagic acid-triggered thrombin generation assay (TGA) exhibited corresponding changes whereas ex vivo PT or TF (20 pM)-triggered TGA was indistinguishable from WT rats. Rats that received a single dose of FXII siRNA (at 0 (non-targeting siRNA control), or 0.01, or 0.03, or 0.1, or 0.3 mg/kg) exhibited dose-dependent knockdown in FXII mRNA in the liver and FXII zymogen in plasma (90% and 97%, respectively, for the 0.3 mg/kg dose) at day 7 post dosing. FXII knockdown was associated with dose-dependent antithrombotic efficacy (with the 0.3 mg/kg dose delivering near maximal efficacy in both models) and minimal increase in cuticle bleeding times (<50% across all doses). Ex vivo pharmacodynamic markers (aPTT and TGA) tracked with the knockdown levels and efficacy. In summary, our findings in both the knockout model and the knockdown model in rats confirmed and extended literature observations with regard to the highly desirable benefit-to-risk profile of targeting FXII in preclinical species; the siRNA tool will allow detailed studies on level of target engagement needed for translatable efficacy; the KO rat will be valuable for addressing any mechanism-based safety concerns as well as off-target effects of putative FXIIa inhibitors.
Hit-to-lead efforts resulted in the discovery of compound 19, a potent CYP11B2 inhibitor that displays high selectivity vs related CYPs, good pharmacokinetic properties in rat and rhesus, and lead-like physical properties. In a rhesus pharmacodynamic model, compound 19 displays robust, dose-dependent aldosterone lowering efficacy, with no apparent effect on cortisol levels.
Background : SARS-CoV-2 infection is associated with risk of thrombosis however not all SARS-CoV-2 positive patients have equal risk of developing thrombi. Evidence of COVID-19 associated coagulation has not been demonstrated in children, whilst adults with a known vasculopathy, have been identified as high-risk. Currently the mechanism through which SARS-Cov-2 infection promotes thrombosis is unknown. Aims : We hypothesise that plasma factors interact with SARS-CoV-2 infected endothelium and play a significant role in this process. Methods : We developed a novel tool for modelling coagulation in vitro . Human Umbilical Vein Endothelial Cells (HUVECs) were infected with SARS-CoV-2;Uninfected cells and cells infected with Influenza A/Singapore/6/86 were used as controls. Wells were incubated with recalcified plasma from healthy children, healthy adults or vasculopathic adults (previous stroke) for 2 h. This experiment was repeated in the presence of anticoagulants: Bivalirudin (0.005 μg/μL), Defibrotide (0.02 μg/μL) and therapeutic and prophylactic doses of Low Molecular Weight Heparin (1 U/mL, 0.5 U/mL) and Unfractionated Heparin (0.7 U/mL, 0.4 U/mL). Fibrin clots were studied using scanning electron microscopy and fibrin characteristics were quantified manually using ImageJ software by two blinded reviewers. Results : Fibrin strands from child plasma had the largest thickness (0.32 μm), followed by adult plasma (0.30 μm) and finally vasculopath plasma (0.27 μm). Defibrotide and Bivalirudin had no effect, whilst Low Molecular Weight Heparin and Unfractionated Heparin completely eliminated clot formation at therapeutic and prophylactic doses. Conclusions : We demonstrate that SARS-CoV-2 infection of endothelial cells promotes thrombosis differently in plasma samples from children, adults and vasculopaths. Thinner fibrin strands in vasculopathy suggests formation of clots that are more resistant to lysis. Our results support that children are resistant to COVID-19 associated coagulation, and that adults with vasculopathies are an at-risk population. This novel cell-culture model for visualising coagulation is a valuable step towards incorporating the endothelium into haemostatic research.
Multiple coagulation factors in the intrinsic cascade are emerging targets for new anticoagulant therapies. Rat and rabbit are two commonly utilized preclinical species for studying thrombosis and hemostasis. The present study aimed at establishing feasibility of delivering short interfering RNA (siRNA) to target coagulation factors in rat and rabbit. Plasma kallikrein was selected for rat studies as plasma kallikrein knockout mouse had been described before in thrombosis and hemostasis models. Factor X (FX) was selected for rabbit studies as a rich dataset of FXa inhibitors in rabbits exists in literature. siRNAs that produced over 90% knockdown of rat plasma prekallikrein mRNA and rabbit FX mRNA in vitro were identified from cellular screens. An ionizable amino lipid based lipid nanoparticle (LNP) formulation for siRNA in vivo delivery was characterized as tolerable and exerting no appreciable effect on coagulability at day seven post dosing in both species. Both prekallikrein siRNA and FX siRNA resulted in dose-dependent and selective knockdown of target gene mRNA in the liver of respective species with maximum reduction of over 90% on day 7 following a single dose of the siRNA-LNP. Plasma prekallikrein siRNA at the highest dose (0.5 mg/kg) produced 92% knockdown on the circulating zymogen in the rats, associated with modest (~45%) clot weight reduction in the arteriovenous shunt thrombosis model and no increase in the cuticle bleeding time. These observations are consistent with the modest antithrombotic phenotype and absence of bleeding diathesis reported for the knockout mouse. FX siRNA at the highest dose (1.0 mg/kg) produced 98% knockdown on the circulating zymogen in the rabbits, accompanied with significant prolongation in ex vivo aPTT (103%) and PT (202%) measurements, consistent with the literature findings on pharmacodynamic effects of FXa inhibitors in rabbit. Results thus fit the expectations with both targets and demonstrate for the first time, the feasibility of targeting coagulation factors in rat and rabbit, via systemic delivery of siRNA. The titratable knockdown platform will not only strengthen target validation in thrombosis research but also facilitate studies on hemophilia diseases and hemostatic agents thereof.
Idiopathic pulmonary fibrosis (IPF) is a chronic parenchymal lung disease characterized by repetitive alveolar cell injury, myofibroblast proliferation, and excessive extracellular matrix deposition for which unmet need persists for effective therapeutics. The bioactive eicosanoid, prostaglandin F2α, and its cognate receptor FPr (Ptgfr) are implicated as a TGF-β1-independent signaling hub for IPF. To assess this, we leveraged our published murine PF model (IER-SftpcI73T) expressing a disease-associated missense mutation in the surfactant protein C (Sftpc) gene. Tamoxifen-treated IER-SftpcI73T mice developed an early multiphasic alveolitis and transition to spontaneous fibrotic remodeling by 28 days. IER-SftpcI73T mice crossed to a Ptgfr-null (FPr-/-) line showed attenuated weight loss and gene dosage-dependent rescue of mortality compared with FPr+/+ cohorts. IER-SftpcI73T/FPr-/- mice also showed reductions in multiple fibrotic endpoints for which administration of nintedanib was not additive. Single-cell RNA-Seq, pseudotime analysis, and in vitro assays demonstrated Ptgfr expression predominantly within adventitial fibroblasts, which were reprogrammed to an "inflammatory/transitional" cell state in a PGF2α /FPr-dependent manner. Collectively, the findings provide evidence for a role for PGF2α signaling in IPF, mechanistically identify a susceptible fibroblast subpopulation, and establish a benchmark effect size for disruption of this pathway in mitigating fibrotic lung remodeling.
As a treatment for dyslipidemia, oral doses of 1–3 grams of nicotinic acid per day lower serum triglycerides, raise high density lipoprotein cholesterol, and reduce mortality from coronary heart disease (Tavintharan, S., and Kashyap, M. L. (2001) Curr. Atheroscler. Rep. 3, 74–82). These benefits likely result from the ability of nicotinic acid to inhibit lipolysis in adipocytes and thereby reduce serum non-esterified fatty acid levels (Carlson, L. A. (1963) Acta Med. Scand. 173, 719–722). In mice, nicotinic acid inhibits lipolysis via PUMA-G, a Gi/o-coupled seven-transmembrane receptor expressed in adipocytes and activated macrophages (Tunaru, S., Kero, J., Schaub, A., Wufka, C., Blaukat, A., Pfeffer, K., and Offermanns, S. (2003) Nat. Med. 9, 352–355). The human ortholog HM74a is also a nicotinic acid receptor and likely has a similar role in anti-lipolysis. Endogenous levels of nicotinic acid are too low to significantly impact receptor activity, hence the natural ligands(s) of HM74a/PUMA-G remain to be elucidated. Here we show that the fatty acid-derived ketone body (d)-β-hydroxybutyrate ((d)-β-OHB) specifically activates PUMA-G/HM74a at concentrations observed in serum during fasting. Like nicotinic acid, (d)-β-OHB inhibits mouse adipocyte lipolysis in a PUMA-G-dependent manner and is thus the first endogenous ligand described for this orphan receptor. These findings suggests a homeostatic mechanism for surviving starvation in which (d)-β-OHB negatively regulates its own production, thereby preventing ketoacidosis and promoting efficient use of fat stores. As a treatment for dyslipidemia, oral doses of 1–3 grams of nicotinic acid per day lower serum triglycerides, raise high density lipoprotein cholesterol, and reduce mortality from coronary heart disease (Tavintharan, S., and Kashyap, M. L. (2001) Curr. Atheroscler. Rep. 3, 74–82). These benefits likely result from the ability of nicotinic acid to inhibit lipolysis in adipocytes and thereby reduce serum non-esterified fatty acid levels (Carlson, L. A. (1963) Acta Med. Scand. 173, 719–722). In mice, nicotinic acid inhibits lipolysis via PUMA-G, a Gi/o-coupled seven-transmembrane receptor expressed in adipocytes and activated macrophages (Tunaru, S., Kero, J., Schaub, A., Wufka, C., Blaukat, A., Pfeffer, K., and Offermanns, S. (2003) Nat. Med. 9, 352–355). The human ortholog HM74a is also a nicotinic acid receptor and likely has a similar role in anti-lipolysis. Endogenous levels of nicotinic acid are too low to significantly impact receptor activity, hence the natural ligands(s) of HM74a/PUMA-G remain to be elucidated. Here we show that the fatty acid-derived ketone body (d)-β-hydroxybutyrate ((d)-β-OHB) specifically activates PUMA-G/HM74a at concentrations observed in serum during fasting. Like nicotinic acid, (d)-β-OHB inhibits mouse adipocyte lipolysis in a PUMA-G-dependent manner and is thus the first endogenous ligand described for this orphan receptor. These findings suggests a homeostatic mechanism for surviving starvation in which (d)-β-OHB negatively regulates its own production, thereby preventing ketoacidosis and promoting efficient use of fat stores. Ketone bodies (acetone, acetoacetate (AcAc), 1The abbreviations used are: AcAc, acetoacetate; (d)-β-OHB, (d)-β-hydroxybutyrate; NEFA, non-esterified fatty acid; GTPγS, guanosine 5′-O-(3-thiotriphosphate). 1The abbreviations used are: AcAc, acetoacetate; (d)-β-OHB, (d)-β-hydroxybutyrate; NEFA, non-esterified fatty acid; GTPγS, guanosine 5′-O-(3-thiotriphosphate).and (d)-β-OHB) are produced in the liver from acetyl-CoA derived from β-oxidation of fatty acids (7Laffel L. Diabetes/Metabolism Res. Rev. 1999; 15: 412-426Crossref PubMed Google Scholar). AcAc and (d)-β-OHB are small water-soluble carboxylic acids that are important energy sources for the brain and other tissues during prolonged fasting (10Cahill G.F. N. Engl. J. Med. 1970; 282: 668-675Crossref PubMed Google Scholar). In humans, the serum concentration of (d)-β-OHB is typically ∼50 μm after a meal, rises to ∼0.2–0.4 mm after an overnight fast, reaches ∼1–2 mm after 2–3 days of fasting, and plateaus at ∼6–8 mm upon prolonged starvation (7Laffel L. Diabetes/Metabolism Res. Rev. 1999; 15: 412-426Crossref PubMed Google Scholar, 8Fukao T. Lopaschuk G.D. Mitchell G.A. Prostaglandins Leukotrienes Essent. Fatty Acids. 2004; 70: 243-251Abstract Full Text Full Text PDF PubMed Scopus (254) Google Scholar, 9Senior B. Loridan L. Nature. 1968; 219: 83-84Crossref PubMed Scopus (55) Google Scholar, 11Owen O.E. Reichard Jr., G.A. Isr. J. Med. Sci. 1975; 11: 560-570PubMed Google Scholar). β-OHB infusion into rats (12Bates M.W. Linn L.C. Metabolism. 1976; 25: 685-695Abstract Full Text PDF PubMed Scopus (10) Google Scholar), pancreatomized dogs (13Bjorntorp P. Schersten T. Am. J. Physiol. 1967; 212: 683-687Crossref PubMed Scopus (32) Google Scholar), and humans (9Senior B. Loridan L. Nature. 1968; 219: 83-84Crossref PubMed Scopus (55) Google Scholar, 14Van Hove J.L. Grunewald S. Jaeken J. Demaerel P. Declercq P.E. Bourdoux P. Niezen-Koning K. Deanfeld J.E. Leonard J.V. Lancet. 2003; 361: 1433-1435Abstract Full Text Full Text PDF PubMed Scopus (82) Google Scholar) lowers serum NEFAs in vivo, and β-OHB inhibits lipolysis in primary rat (15Bjorntorp P. J. Lipid Res. 1966; 7: 621-626Abstract Full Text PDF PubMed Google Scholar, 16Bjorntorp P. Metabolism. 1966; 15: 191-193Abstract Full Text PDF PubMed Scopus (9) Google Scholar) or bovine (17Metz S.H. Lopes-Cardozo M. van den Bergh S.G. FEBS Lett. 1974; 47: 19-22Crossref PubMed Scopus (22) Google Scholar) adipocytes, whereas AcAc does not. The fact that these effects are similar to those of nicotinic acid and that both β-OHB and nicotinic acid are small carboxylic acids led us to investigate whether ketone bodies are HM74a agonists. Materials—With the exception of Acifran and lithium (dl)-β-OHB, all compounds tested were from Sigma. Acifran was synthesized by chemists at Arena Pharmaceuticals, and lithium (dl)-β-OHB was made by titrating free (dl)-β-OHB acid (Sigma) with LiOH by chemists at Merck. [35S]GTPγS (1160 Ci/mmol) was from Amersham Biosciences, and [5,6-3H]nicotinic acid (50 Ci/mmol) was from American Radiolabeled Chemical (St. Louis, MO). Molecular Cloning—HM74a and HM74 were cloned by PCR using human genomic DNA as a template and the following primers, GCTGGAGCATTCACTAGGCGAG (sense for HM74a), AGATCCTGGTTCTTGGTGACAATG (antisense for HM74a), GGAGAATTCACTAGGCGAGGCGCTCCATC (sense for HM74), and GGAGGATCCAGGAAACCTTAGGCCGAGTCC (antisense for HM74). PUMA-G was cloned using mouse genomic DNA as template, the sense primer AGATCCACTCATGAGCAAGTCAGACC, and the antisense primer CCTTCTTGTCATAGTAACTTAACGAG. For the generation of stable cell lines, 5 × 106 CHO-K1 cells were transfected with 12 μg of plasmid DNA (pCDNA3.1, Invitrogen) containing either HM74a, HM74, or PUMA-G expressed from the cytomegalovirus promoter. Two days after transfection, the growth medium was supplemented with 400 μg/ml G418 to select for antibiotic-resistant cells. Clonal CHO-K1 cell lines that stably express HM74, HM74a, or PUMA-G were selected based on the ability of nicotinic acid (HM74a and PUMA-G) or S711589 (an Arena HM74-specific agonist; data not shown) to inhibit forskolin-induced cAMP production. Calcium Mobilization—CHO-K1 cells expressing an NFAT-β-lactamase reporter and the promiscuous Gα subunit Gqi5 (kind gift of K. Sullivan, Merck Research Laboratories) were stably transfected with either empty vector (pCDNA3.1, Invitrogen) or vector expressing PUMA-G, HM74a, or HM74. Cells were seeded at 10,000 cells/well in 384-well culture plates and grown overnight at 37 °C, 5% CO2 in Dulbecco's modified Eagle's medium containing 10% fetal bovine serum, 2 mm l-glutamine, 10 mm HEPES, pH 7.4, 0.1 mm MEM non-essential amino acids solution, 1 mm sodium pyruvate, 0.6 mg/ml hygromycin B, 0.5 mg/ml zeocin, and 1 mg/ml geneticin (BD Biosciences). Cells were washed four times with Hanks' balanced salt solution containing 10 mm HEPES, pH 7.4, and loaded with calcium-sensitive dye by incubating with an equal volume of Molecular Devices calcium assay kit loading buffer at 37 °C for 1 h. Calcium response in the fluorometric imaging plate reader assay was measured according to the directions from Molecular Devices. [35S]GTPγS Binding Assay—Membranes from untransfected CHO-K1 cells or cells stably expressing PUMA-G, HM74a, or HM74 (20 μg/assay) were diluted in assay buffer (20 mm HEPES, pH 7.4, 100 mm NaCl, 10 mm MgCl2) in Wallac Scintistrip plates and preincubated with test compounds diluted in assay buffer containing 40 μm GDP (final [GDP] was 10 μm) for ∼10 min before addition of [35S]GTPγS to 0.3 nm. To measure the agonist activity of free acids, rather than sodium salts (Table I), the HEPES concentration was increased to 60 mm; this increase had no effect on the EC50 of nicotinic acid (data not shown). Binding was allowed to proceed for 1 h before centrifuging the plates at 4000 rpm for 15 min at room temperature and subsequent counting in a Packard TopCount scintillation counter. Non-linear regression analysis of the binding curves was performed in GraphPad Prism version 4.Table ILigand-induced [35S]GTPγS binding to membranes from CHO cells expressing PUMA-G, HM74α, or HM74CompoundEC50PUMA-GHM74aHM74μmNicotinic acid0.04 ± 0.0030.10 ± 0.005>100aSome compounds displayed activity at the highest concentration tested but not over a full dose response from which an EC50 could be determined. Therefore, the EC50 for these compounds is denoted as greater than the highest concentration tested.Acifran0.36 ± 0.031.13 ± 0.067.04 ± 0.6Lithium (dl)-β-hydroxybutyrate727 ± 40793 ± 60>25,000Sodium (d)-β-hydroxybutyrate318 ± 37767 ± 57>25,000Sodium (l)-β-hydroxybutyrate684 ± 1191662 ± 382>25,000Lithium acetoacetate>25,000>25,000>25,000AcetoneInactiveInactiveInactiveSodium (dl)-α-hydroxybutyrate>10,000Inactive>10,000Sodium lactate>10,000InactiveInactiveSodium acetate (C2)>10,000>10,000InactiveSodium propionate (C3)>10,000>10,000InactiveSodium butyrate (C4)702 ± 1081590 ± 211InactivePentanoic acid (C5)166 ± 33402 ± 51>10,000Sodium hexanoate (C6)133 ± 15451 ± 91995 ± 246Heptanoic acid (C7)730 ± 1322066 ± 300120 ± 23Sodium octanoate (C8)288 ± 40755 ± 8273 ± 12Sodium decanoate (C10)>10,000>10,000>10,000Oleic acid (C18:1)InactivebFatty acids with >10 carbons were tested at 10 μm only.InactiveInactiveLinoleic acid (C18:2)InactiveInactiveInactiveLinolenic acid (C18:3)InactiveInactiveInactiveArachidonic acid (C20:4)InactiveInactiveInactiveEicosapentaenoic acid (C20:5)InactiveInactiveInactiveDocosahexanoic acid (C22:6)InactiveInactiveInactivea Some compounds displayed activity at the highest concentration tested but not over a full dose response from which an EC50 could be determined. Therefore, the EC50 for these compounds is denoted as greater than the highest concentration tested.b Fatty acids with >10 carbons were tested at 10 μm only. Open table in a new tab [3H]Nicotinic Acid Binding Competition Assay—Assays were performed with the same preparations of membrane used for the [35S]GTPγS assay. Equilibrium binding of [3H]nicotinic acid was done with membranes (30 μg/assay) and test compounds diluted in assay buffer (20 mm HEPES, pH 7.4, 1 mm MgCl2, and 0.01% CHAPS) in a total volume of 200 μl. After 4 h at room temperature, reactions were filtered through Packard Unifilter GF/C plates using a Packard Harvester and washed eight times with 200 μl of ice-cold binding buffer. Nonspecific binding was determined in the presence of 250 μm unlabeled nicotinic acid. Competitive binding assays were performed in the presence of 50 nm [3H]nicotinic acid. In Vitro Lipolysis—Isolation of mouse primary epididymal adipocytes and in vitro determination of NEFA release was performed according to the method of Rodbell as adapted by Tunaru et al. (3Tunaru S. Kero J. Schaub A. Wufka C. Blaukat A. Pfeffer K. Offermanns S. Nat. Med. 2003; 9: 352-355Crossref PubMed Scopus (657) Google Scholar, 23Rodbell M. J. Biol. Chem. 1964; 239: 375-380Abstract Full Text PDF PubMed Google Scholar). To ask whether β-OHB is a ligand for HM74a, we used Chinese hamster ovary (CHO) cells that stably express the chimeric G-protein α subunit Gqi5 (18Conklin B.R. Farfel Z. Lustig K.D. Julius D. Bourne H.R. Nature. 1993; 363: 274-276Crossref PubMed Scopus (606) Google Scholar) and harbor either a control vector or vectors that expresses either HM74a or its paralog HM74, which is 95% identical at the amino acid level to HM74a but has ∼1000-fold less affinity for nicotinic acid (4Wise A. Foord S.M. Fraser N.J. Barnes A.A. Elshourbagy N. Eilert M. Ignar D.M. Murdock P.R. Steplewski K. Green A. Brown A.J. Dowell S.J. Szekeres P.G. Hassall D.G. Marshall F.H. Wilson S. Pike N.B. J. Biol. Chem. 2003; 278: 9869-9874Abstract Full Text Full Text PDF PubMed Scopus (460) Google Scholar, 5Soga T. Kamohara M. Takasaki J. Matsumoto S. Saito T. Ohishi T. Hiyama H. Matsuo A. Matsushime H. Furuichi K. Biochem. Biophys. Res. Commun. 2003; 303: 364-369Crossref PubMed Scopus (285) Google Scholar). Use of Gqi5 allows the normally Gi/o-coupled HM74 and HM74a to signal via the Gq pathway leading to Ca+2 mobilization. Nicotinic acid elicited Ca+2 mobilization only in cells expressing HM74a (Fig. 1A). In contrast, Acifran, an agonist on both HM74 and HM74a (4Wise A. Foord S.M. Fraser N.J. Barnes A.A. Elshourbagy N. Eilert M. Ignar D.M. Murdock P.R. Steplewski K. Green A. Brown A.J. Dowell S.J. Szekeres P.G. Hassall D.G. Marshall F.H. Wilson S. Pike N.B. J. Biol. Chem. 2003; 278: 9869-9874Abstract Full Text Full Text PDF PubMed Scopus (460) Google Scholar), elicited a response from both receptors demonstrating that HM74 was functional and could be used as a specificity control in this assay. Given that ketone bodies can reach millimolar concentrations in serum, we tested these compounds at 15 mm. Both (d)- and (l)-β-OHB, but not acetoacetate or free acetone, elicited a Ca+2 response in cells expressing HM74a but not HM74. Whereas the d-isomer of β-OHB is the sole form encountered in high concentrations physiologically (7Laffel L. Diabetes/Metabolism Res. Rev. 1999; 15: 412-426Crossref PubMed Google Scholar), both d- and l-isomers have been shown to inhibit lipolysis in vitro (17Metz S.H. Lopes-Cardozo M. van den Bergh S.G. FEBS Lett. 1974; 47: 19-22Crossref PubMed Scopus (22) Google Scholar), consistent with the results shown here. Similar results were observed for cells expressing murine PUMA-G (data not shown). Next, we determined the half-maximal concentration (EC50) of β-OHB required to stimulate receptor-mediated guanine nucleotide exchange on Gα using a [35S]GTPγS binding assay with membranes prepared from untransfected CHO cells or CHO cells stably expressing either mouse PUMA-G, human HM74a, or HM74 (Fig. 1B and Table I). Nicotinic acid stimulated [35S]GTPγS binding only in membranes from cells expressing HM74a (EC50 104 ± 5 nm) or the mouse ortholog PUMA-G (EC50 = 43 ± 3 nm), whereas Acifran was active on all three receptors (EC50 = 1127 ± 59 nm for HM74a, 358 ± 30 nm for PUMA-G, and 7039 ± 598 nm for HM74). Racemic (dl)-β-OHB also showed some degree of activity on all receptors; however, it was more potent on HM74a (EC50 = 0.8 ± 0.06 mm) and its ortholog PUMA-G (EC50 = 0.7 ± 0.04 mm) than on HM74. The EC50 for the l-enantiomer was ∼2-fold higher than that of the physiologically relevant d-enantiomer (Table I). Both the sodium and lithium salts of β-OHB were active, indicating that the anion is the active component. Moreover, sodium salts of other small monocarboxylic acids with similar pKa values to β-OHB (α-hydroxybutyrate and lactate) were not significantly active in this assay (Table I). At high concentrations, lithium acetoacetate, but not acetone or lithium chloride, elicited [35S]GTPγS binding to all three receptors but not to membranes from untransfected cells, suggesting that acetoacetate is a weak agonist of these receptors. Short-chain fatty acids were recently identified as ligands for the G-protein-coupled receptor GPR41, which is, like HM74a/PUMA-G, expressed in adipocytes (19Le Poul E. Loison C. Struyf S. Springael J.Y. Lannoy V. Decobecq M.E. Brezillon S. Dupriez V. Vassart G. Van Damme J. Parmentier M. Detheux M. J. Biol. Chem. 2003; 278: 25481-25489Abstract Full Text Full Text PDF PubMed Scopus (1100) Google Scholar, 20Xiong Y. Miyamoto N. Shibata K. Valasek M.A. Motoike T. Kedzierski R.M. Yanagisawa M. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 1045-1050Crossref PubMed Scopus (526) Google Scholar, 21Brown A.J. Goldsworthy S.M. Barnes A.A. Eilert M.M. Tcheang L. Daniels D. Muir A.I. Wigglesworth M.J. Kinghorn I. Fraser N.J. Pike N.B. Strum J.C. Steplewski K.M. Murdock P.R. Holder J.C. Marshall F.H. Szekeres P.G. Wilson S. Ignar D.M. Foord S.M. Wise A. Dowell S.J. J. Biol. Chem. 2003; 278: 11312-11319Abstract Full Text Full Text PDF PubMed Scopus (1579) Google Scholar). Given their similarity to β-OHB, we determined whether small fatty acids are ligands for HM74a/PUMA-G. Indeed, a structure-activity relationship was observed for fatty acids of varying chain length (Table I), with pentanoic (C5) and hexanoic (C6) acids being the most active on HM74a (C5, EC50 = 402 ± 51 μm; C6, EC50 = 451 ± 91 μm) and PUMA-G (C5, EC50 = 166 ± 33 μm; C6, EC50 = 133 ± 15 μm). HM74 has affinity for slightly longer chain length fatty acids, with a peak of activity centered on octanoic acid (C8, EC50 = 73 ± 12 μm; Table I). However, it is unlikely that these small fatty acids reach sufficient concentrations in serum to activate these receptors (19Le Poul E. Loison C. Struyf S. Springael J.Y. Lannoy V. Decobecq M.E. Brezillon S. Dupriez V. Vassart G. Van Damme J. Parmentier M. Detheux M. J. Biol. Chem. 2003; 278: 25481-25489Abstract Full Text Full Text PDF PubMed Scopus (1100) Google Scholar), and so their low affinity for PUMA-G/HM74a and HM74 is probably not physiologically relevant. Consistent with this, while both HM74a/PUMA-G and GPR41 have similar chain length preferences, the latter receptor has at least 10-fold higher affinity for these acids (Table I and Ref. 20Xiong Y. Miyamoto N. Shibata K. Valasek M.A. Motoike T. Kedzierski R.M. Yanagisawa M. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 1045-1050Crossref PubMed Scopus (526) Google Scholar). We note as well that in another study racemic (dl)-β-OHB was not a GPR41 agonist at concentrations up to 10 mm (20Xiong Y. Miyamoto N. Shibata K. Valasek M.A. Motoike T. Kedzierski R.M. Yanagisawa M. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 1045-1050Crossref PubMed Scopus (526) Google Scholar). Similarly, another study found “l-OH-butyrate” (the exact molecular structure of which was not described) to be only a very weak (EC50 ∼5 mm) ligand of human GPR41 and GPR43, another receptor for short-chain fatty acids expressed predominantly in leukocytes (19Le Poul E. Loison C. Struyf S. Springael J.Y. Lannoy V. Decobecq M.E. Brezillon S. Dupriez V. Vassart G. Van Damme J. Parmentier M. Detheux M. J. Biol. Chem. 2003; 278: 25481-25489Abstract Full Text Full Text PDF PubMed Scopus (1100) Google Scholar). Finally, β-OHB was not an agonist of GPR81 (22Lee D.K. Nguyen T. Lynch K.R. Cheng R. Vanti W.B. Arkhitko O. Lewis T. Evans J.F. George S.R. O'Dowd B.F. Gene (Amst.). 2001; 275: 83-91Crossref PubMed Scopus (165) Google Scholar), the next most phylogenetically related receptor to HM74a/PUMA-G (data not shown). We employed an equilibrium [3H]nicotinic acid binding competition assay to ask whether nicotinic acid and β-OHB compete for the same binding site on the receptor. [3H]Nicotinic acid bound specifically and saturably to membranes from cells expressing HM74a, but not HM74 (data not shown), with a calculated Kd of 105 ± 9 nm (data not shown), a value in good agreement with published results (3Tunaru S. Kero J. Schaub A. Wufka C. Blaukat A. Pfeffer K. Offermanns S. Nat. Med. 2003; 9: 352-355Crossref PubMed Scopus (657) Google Scholar, 4Wise A. Foord S.M. Fraser N.J. Barnes A.A. Elshourbagy N. Eilert M. Ignar D.M. Murdock P.R. Steplewski K. Green A. Brown A.J. Dowell S.J. Szekeres P.G. Hassall D.G. Marshall F.H. Wilson S. Pike N.B. J. Biol. Chem. 2003; 278: 9869-9874Abstract Full Text Full Text PDF PubMed Scopus (460) Google Scholar). Homologous competition with unlabeled nicotinic acid yielded a Ki of 130 ± 14 nm, similar to the observed Kd (Fig. 1C). As in the [35S]GTPγS binding assay, AcAc displayed low apparent affinity for HM74a, but (dl)-β-OHB bound the receptor with physiologically relevant affinity (Ki = 0.7 ± 0.06 mm; Fig. 1C). Similar results were observed for PUMA-G (Ki = 0.7 mm ± 0.1 mm; data not shown). Taken together, these data show that (d)-β-OHB is a HM74a/PUMA-G agonist and that the serum concentrations of this ketone body observed as early as 2–3 days into a fast in humans (7Laffel L. Diabetes/Metabolism Res. Rev. 1999; 15: 412-426Crossref PubMed Google Scholar, 8Fukao T. Lopaschuk G.D. Mitchell G.A. Prostaglandins Leukotrienes Essent. Fatty Acids. 2004; 70: 243-251Abstract Full Text Full Text PDF PubMed Scopus (254) Google Scholar) will result in significant receptor occupancy and activity. Previous studies with isolated adipocytes from knock-out mice demonstrated that PUMA-G mediates the anti-lipolytic effect of nicotinic acid (3Tunaru S. Kero J. Schaub A. Wufka C. Blaukat A. Pfeffer K. Offermanns S. Nat. Med. 2003; 9: 352-355Crossref PubMed Scopus (657) Google Scholar); we performed analogous experiments with (d)-β-OHB. Both nicotinic acid and sodium (d)-β-OHB suppressed free fatty acid efflux from isoproterenol-stimulated primary adipocytes from wild-type mice, the latter at concentrations consistent with the affinity determined previously (approximate EC50 for (d)-β-OHB-mediated lipolysis inhibition ∼2 mm, Fig. 2A). This suppression was PUMA-G-mediated, as nicotinic acid and (d)-β-OHB were without significant effect in adipocytes from PUMA-G knock-out mice (Fig. 2B). Adipocytes from PUMA-G knock-out mice were not merely refractory to lipolysis inhibition per se, as ADP inhibited fatty acid efflux equally well in wild-type and knock-out cells (Fig. 2B). The adenosine analogue phenylisopropyladenosine also inhibited lipolysis equally well in wild-type and knock-out cells (data not shown). We note that the rate of both basal and isoproterenol-stimulated lipolysis was routinely lower in adipocytes from knock-out mice compared with those from wild-type animals (Fig. 2B; compare “No stimulation” and “Iso”). It is unlikely that this difference is due to a deficiency of lipid in the knockout adipocytes, as wild-type and knock-out cells had approximately the same overall size as determined by microscopy (data not shown), and wild-type and knock-out mice had the same overall fat mass as determined by NMR spectroscopy. 2D. Marsh, unpublished observations. In this work we have shown that the ketone body (d)-β-OHB specifically binds to and activates the adipocyte-expressed GPCRs HM74a/PUMA-G with an affinity that is well within the range of serum concentrations observed for this metabolite after ∼2–3 days of starvation in humans and ∼1–2 days in mice (7Laffel L. Diabetes/Metabolism Res. Rev. 1999; 15: 412-426Crossref PubMed Google Scholar, 10Cahill G.F. N. Engl. J. Med. 1970; 282: 668-675Crossref PubMed Google Scholar). The effect of (d)-β-OHB is, like nicotinic acid, anti-lipolytic (1Tavintharan S. Kashyap M.L. Curr. Atheroscler. Rep. 2001; 3: 74-82Crossref PubMed Scopus (87) Google Scholar, 2Carlson L.A. Acta Med. Scand. 1963; 173: 719-722Crossref PubMed Scopus (134) Google Scholar, 6Pike N.B. Wise A. Curr. Opin. Investig. Drugs. 2004; 5: 271-275PubMed Google Scholar). (d)-β-OHB is thus the first endogenous ligand described for the orphan receptor PUMA-G. During starvation, the rate of hepatic ketone body synthesis is at least partially limited by the rate of adipocyte lipolysis (7Laffel L. Diabetes/Metabolism Res. Rev. 1999; 15: 412-426Crossref PubMed Google Scholar). That (d)-β-OHB is itself anti-lipolytic suggests a homeostatic negative feedback mechanism in which this metabolite regulates its own production by decreasing the serum level of fatty acid precursors available for hepatic ketogenesis. Indeed, in a study of the serum NEFA-lowering effect of β-OHB infused into humans, Senior and Loridan (9Senior B. Loridan L. Nature. 1968; 219: 83-84Crossref PubMed Scopus (55) Google Scholar) proposed that during starvation ketone bodies exert “a fine regulatory adjustment” of their own synthesis by inhibiting adipocyte lipolysis. Such a mechanism would potentially conserve fat stores during extended starvation and attenuate excessive formation of ketoacids from unrestrained lipolysis and ketogenesis. This model implies that PUMA-G knock-out mice would experience higher rates of lipolysis and ketogenesis during a fast, as (d)-β-OHB does not inhibit lipolysis in the absence of this receptor. In preliminary experiments, we have not observed significant reproducible differences between wild-type and PUMA-G knock-out animals in rate of body fat depletion or serum levels of NEFA or (d)-β-OHB during 24 and 48 h of fasting. 3D. Marsh, M. Reitman, and A. Taggart, unpublished observations. However, we note that adipocytes from knock-out animals are refractory to stimulation with isoproterenol (Fig. 2B), perhaps suggesting a fundamental difference in lipolysis regulation in the knock-out cells that may compensate for lack of PUMA-G. Studies with inducible knock-outs of PUMA-G in adult animals may shed light on this question. We thank Steve Colletti of Merck Research Laboratories for synthesis of lithium (dl)-β-OHB; Graeme Semple and colleagues at Arena Pharmaceuticals for synthesis of Acifran; Sorin Tunaru of the University of Heidelberg for assistance with PUMA-G knock-out mice experiments; Donald Marsh, Kimberly Cox-York, and Marc Reitman for fasting studies with knock-out animals and advice; and Ismail Kola of Merck Research Laboratories for comments on the manuscript and support of this project.
