Zhengwei Zhou

Jiaxing University

Author Statistics

Papers

Citation

H-Index

i-10 index

Research Trends

Author Order

Document Type

Co-Authors

Gang Yin

Central South University

Guang Shu

Central South University

Juan Iovanna

Inserm

Yi Xia

Fudan University

Ling Peng

Centre National de la Recherche Scientifique

Wenjun Lan

Inner Mongolia Agricultural University

Paipai Guo

Anhui Medical University

Qingtong Wang

Shandong University

Qing Xiao

First Affiliated Hospital of Chongqing Medical University

Patricia Santofimia‐Castaño

Centre de Recherche en Cancérologie de Marseille

Cooperative Institutions

Central South University

Anhui Medical University

Ministry of Education of the People's Republic of China

Inserm

Nanjing Medical University

Aix-Marseille Université

Xiangya Hospital Central South University

Centre de Recherche en Cancérologie de Marseille

China Pharmaceutical University

Centre National de la Recherche Scientifique

Author Statistics

Papers

Citation

H-Index

i-10 index

Research Field

Tweety homolog 3 promotes colorectal cancer progression through mutual regulation of histone deacetylase 7

MedComm (2024)

Pengyan Lu Shumin Deng Jiaxin Liu Qing Xiao Zhengwei Zhou

Abstract Colorectal cancer (CRC) is one of the leading cancers worldwide, with metastasis being a major cause of high mortality rates among patients. In this study, dysregulated gene Tweety homolog 3 (TTYH3) was identified by Gene Expression Omnibus database. Public databases were used to predict potential competing endogenous RNAs (ceRNAs) for TTYH3. Quantitative real‐time polymerase chain reaction, western blot, and immunohistochemistry were utilized to analyze TTYH3 and histone deacetylase 7 (HDAC7) levels. Luciferase assays confirmed miR‐1271‐5p directly targeting the 3′ untranslated regions of TTYH3 and HDAC7. In vitro experiments such as transwell and human umbilical vein endothelial cell tube formation, as well as in vivo mouse models, were conducted to assess the biological functions of TTYH3 and HDAC7. We discovered that upregulation of TTYH3 in CRC promotes cell migration by affecting the Epithelial–mesenchymal transition pathway, which was independent of its ion channel activity. Mechanistically, TTYH3 and HDAC7 functioned as ceRNAs, reciprocally regulating each other's expression. TTYH3 competes for binding miR‐1271‐5p, increasing HDAC7 expression, facilitating CRC metastasis and angiogenesis. This study reveals the critical role of TTYH3 in promoting CRC metastasis through ceRNA crosstalk, offering new insights into potential therapeutic targets for clinical intervention.

Crosstalk

Competing Endogenous RNA

10.1002/mco2.576

Cite

Citations (2)

Comparing successful gene knock-in efficiencies of CRISPR/Cas9 with ZFNs and TALENs gene editing systems in bovine and dairy goat fetal fibroblasts

Journal of Integrative Agriculture (2018)

Hui Liu Chang Liu Yuhang Zhao Xuejie Han Zhengwei Zhou

This study aimed to compare the efficiencies of clustered regulatory interspaced short palindromic repeat (CRISPR)/Cas9-mediated gene knock-ins with zinc finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs) in bovine and dairy goat fetal fibroblasts. To test the knock-in efficiency, a set of ZFNs and CRISPR/Cas9 plasmids were designed to edit the bovine myostatin (MSTN) gene at exon 2, while a set of TALENs and CRISPR/Cas9 plasmids were designed for editing the dairy goat β-casein gene at exon 2. Donor plasmids utilizing the ZFNs, TALENs, and CRISPR/Cas9 cutting sites were constructed in the GFP-PGK-NeoR plasmid background, including a 5' and 3' homologous arm flanking the genes humanized Fat-1 (hFat-1) or enhanced green fluorescent protein (eGFP). Subsequently, the ZFNs, TALENs, or CRISPR/Cas9 and the hFat-1 or eGFP plasmids were co-transfected by electroporation into bovine and dairy goat fetal fibroblasts. After G418 (Geneticin) selection, single cells were obtained by mouth pipetting, flow cytometry or a cell shove. The gene knock-in events were screened by PCR across the homologous arms. The results showed that in bovine fetal fibrobalsts, the efficiencies of ZFNs-mediated eGFP and hFat-1 gene knock-ins were 13.68 and 0%, respectively. The efficiencies of CRISPR/Cas9-mediated eGFP and hFat-1 gene knock-ins were 77.02 and 79.01%, respectively. The eGFP gene knock-in efficiency using CRISPR/Cas9 was about 5.6 times higher than when using the ZFNs gene editing system. Additionally, the hFat-1 gene knock-in was only obtained when using the CRISPR/Cas9 system. The difference of knock-in efficiencies between the ZFNs and CRISPR/Cas9 systems were extremely significant (P<0.01). In the dairy goat fetal fibroblasts, the efficiencies of TALENs-mediated eGFP and hFat-1 gene knock-ins were 32.35 and 26.47%, respectively. The efficiencies of eGFP and hFat-1 gene knock-ins using CRISPR/Cas9 were 70.37 and 74.29%, respectively. The knock-in efficiencies difference between the TALENs and CRISPR/Cas9 systems were extremely significant (P<0.01). This study demonstrated that CRISPR/Cas9 was more efficient at gene knock-ins in domesticated animal cells than ZFNs and TALENs. The CRISPR/Cas9 technology offers a new era of precise gene editing in domesticated animal cell lines.

Zinc finger nuclease

Gene knockout

Gene targeting

10.1016/s2095-3119(17)61748-9

Cite

Citations (18)

Biology and Clinical Relevance of HCMV-Associated Adaptive NK Cells

Frontiers in Immunology (2022)

Fei Gao Zhengwei Zhou Ying Lin Guang Shu Gang Yin

Natural killer (NK) cells are an important component of the innate immune system due to their strong ability to kill virally infected or transformed cells without prior exposure to the antigen (Ag). However, the biology of human NK (hNK) cells has largely remained elusive. Recent advances have characterized several novel hNK subsets. Among them, adaptive NK cells demonstrate an intriguing specialized antibody (Ab)-dependent response and several adaptive immune features. Most adaptive NK cells express a higher level of NKG2C but lack an intracellular signaling adaptor, FcϵRIγ (hereafter abbreviated as FcRγ). The specific expression pattern of these genes, with other signature genes, is the result of a specific epigenetic modification. The expansion of adaptive NK cells in vivo has been documented in various viral infections, while the frequency of adaptive NK cells among peripheral blood mononuclear cells correlates with improved prognosis of monoclonal Ab treatment against leukemia. This review summarizes the discovery and signature phenotype of adaptive NK cells. We also discuss the reported association between adaptive NK cells and pathological conditions. Finally, we briefly highlight the application of adaptive NK cells in adoptive cell therapy against cancer.

Janus kinase 3

Lymphokine-activated killer cell

10.3389/fimmu.2022.830396

Cite

Citations (8)

G protein-coupled receptor kinase 2 as a novel therapeutic target for gland fibrosis of Sjögren’s syndrome

Acta Pharmacologica Sinica (2024)

Ruhong Fang Zhengwei Zhou Rui Chu Qiuyun Guan Feng He

10.1038/s41401-024-01350-4

Cite

Citations (1)

Wnt3a Activates the WNT-YAP/TAZ Pathway to Sustain CDX2 Expression in Bovine Trophoblast Stem Cells

DNA and Cell Biology (2019)

Chen Wang Xuejie Han Zhengwei Zhou Uyunbilig Borjigin Xianghua Huang

Trophoblast stem cells (TSCs), the precursors of placental cells, are effective for studying placental formation in vitro. Using a dual inhibition (2i) medium and mixed L-Wnt3a/mouse embryonic fibroblast feeder cells, we previously established the bovine trophoblast cell line BTS-1. In this study, we used bovine fetal fibroblasts and added Wnt3a to the 2i medium to establish another bovine TSC line (BTSW). BTSW cells expressed pluripotency markers, including NANOG, SOX2, OCT4, TRA-1-60, TRA-1-81, SSEA4, CDH1, and KRT18, and TSC markers CDX2, TEAD4, and ESRRB. Methylation sequencing of the promoter regions of NANOG, OCT4, and CDX2 revealed no significant differences between BTS-1 and BTSW cells. Removal of Wnt3a from the culture medium resulted in downregulation (p < 0.05) of NANOG, OCT4, CDX2, and TSC marker genes, and upregulation of TSC differentiation markers, including MASH2, GCM1, and PAG. Western blotting indicated activation of the WNT-YAP/TAZ signaling pathway in BTS-1 and BTSW cells, consequently activating TEAD4 transcription. However, this pathway was not activated in BCFF cells, an established bovine embryonic stem-like cell line that expresses OCT4, SOX2, and NANOG, but not CDX2. Thus, Wnt3a may play a critical role in bovine TSC maintenance by activating and regulating CDX2 expression through the WNT-YAP/TAZ signaling pathway.

Homeobox protein NANOG

Trophoblast

WNT3A

XIST

10.1089/dna.2018.4458

Cite

Citations (24)

Truncated gRNA reduces CRISPR/Cas9-mediated off-target rate for MSTN gene knockout in bovines

Journal of Integrative Agriculture (2019)

Zhengwei Zhou Guo-hua CAO Zhe Li Xue-jie HAN Chen Li

The CRISPR/Cas9 mediates efficient gene editing but has off-target effects inconducive to animal breeding. In this study, the efficacy of CRISPR/Cas9 vectors containing different lengths of gRNA in reduction of the off-target phenomenon in the bovine MSTN gene knockout fibroblast cell lines was assessed, providing insight into improved methods for livestock breeding. A 20-bp gRNA was designed for the second exon of the bovine MSTN gene, and CRISPR/Cas9-B was constructed to guide the Cas9 protein to the AGAACCAGGAGAAGATGGACTGG site. The alternative CRISPR/Cas9-19, CRISPR/Cas9-18, CRISPR/Cas9-17 and CRISPR/Cas9-15 vectors were constructed using gRNAs truncated by 1, 2, 3 and 5 bp, respectively. These vectors were then introduced into bovine fetal fibroblasts by the electroporation method, and single cells were obtained by flow cytometry sorting. PCR was performed for each off-target site. All samples were sequenced and analyzed, and finally the efficiency of each vector in target and off-target sites was compared. The CRISPR/Cas9-B vector successfully knocked out the MSTN gene, but the off-target phenomenon was observed. The efficiencies of CRISPR/Cas-B, CRISPR/Cas9-19, CRISPR/Cas9-18, CRISPR/Cas9-17 and CRISPR/Cas9-15 in triggering gene mutations at MSTN targeting sites were 62.16, 17.39, 7.69, 74.29 and 3.85%, respectively; rates of each at the Off-MSTN-1 locus were 52.86, 0, 0, 8.82 and 0%, respectively; all were 0% at the Off-MSTN-2 locus; rates at the Off-MSTN-3 site were 44.87, 51.72, 86.36, 0 and 50%, respectively. The efficiency of the CRISPR/Cas9-17 plasmid in the MSTN site was higher than that in the CRISPR/Cas9-B plasmid, and the effect at the three off-target sites was significantly lower. This study demonstrated that the CRISPR/Cas9-17 plasmid constructed by truncating 3 bp gRNA can effectively reduce the off-target effect without reducing the efficiency of bovine MSTN gene targeting. This finding will provide more effective gene editing strategy for use of CRISPR/Cas9 technology.

Guide RNA

Gene knockout

10.1016/s2095-3119(19)62744-9

Cite

Citations (6)

EN2 as an oncogene promotes tumor progression via regulating CCL20 in colorectal cancer

Cell Death and Disease (2020)

Yimin Li Jiaxin Liu Qing Xiao Ruotong Tian Zhengwei Zhou

Abstract Engrailed-2 (EN2), a member of the engrailed homeobox family, has been shown to be abnormally expressed in a variety of cancers. However, the expression and the clinical significance of EN2 in colorectal cancer (CRC) are largely unknown. Firstly, we found that EN2 acted as an oncogene in CRC. EN2 was upregulated in colorectal cancer tissues compared with adjacent normal tissues. Higher EN2 expression was significantly associated with poorer survival rate. Knockdown of EN2 markedly inhibited proliferation and migration capacities of SW480 cells in vitro, and suppressed tumorigenicity in vivo. Mechanistically, Chemokine ligand 20 (CCL20), a member of the C-C motif chemokine subfamily, was identified as a direct target gene of EN2 in CRC. CCL20 expression was positively correlated with EN2 expression in CRC tissues. Moreover, EN2 promoted the proliferation and migration of CRC cells by regulating the expression of CCL20 in vitro. These results suggest that EN2 plays a critical role in the CRC tumor progression and may serve as a potential target for CRC prevention and therapy.

engrailed

CCL20

10.1038/s41419-020-02804-3

Cite

Citations (31)

Design of Inhibitors of the Intrinsically Disordered Protein NUPR1: Balance between Drug Affinity and Target Function

Biomolecules (2021)

Bruno Rizzuti Wenjun Lan Patricia Santofimia‐Castaño Zhengwei Zhou Adrián Velazquez‐Campoy

Intrinsically disordered proteins (IDPs) are emerging as attractive drug targets by virtue of their physiological ubiquity and their prevalence in various diseases, including cancer. NUPR1 is an IDP that localizes throughout the whole cell, and is involved in the development and progression of several tumors. We have previously repurposed trifluoperazine (TFP) as a drug targeting NUPR1 and, by using a ligand-based approach, designed the drug ZZW-115 starting from the TFP scaffold. Such derivative compound hinders the development of pancreatic ductal adenocarcinoma (PDAC) in mice, by hampering nuclear translocation of NUPR1. Aiming to further improve the activity of ZZW-115, here we have used an indirect drug design approach to modify its chemical features, by changing the substituent attached to the piperazine ring. As a result, we have synthesized a series of compounds based on the same chemical scaffold. Isothermal titration calorimetry (ITC) showed that, with the exception of the compound preserving the same chemical moiety at the end of the alkyl chain as ZZW-115, an increase of the length by a single methylene group (i.e., ethyl to propyl) significantly decreased the affinity towards NUPR1 measured in vitro, whereas maintaining the same length of the alkyl chain and adding heterocycles favored the binding affinity. However, small improvements of the compound affinity towards NUPR1, as measured by ITC, did not result in a corresponding improvement in their inhibitory properties and in cellulo functions, as proved by measuring three different biological effects: hindrance of the nuclear translocation of the protein, sensitization of cells against DNA damage mediated by NUPR1, and prevention of cancer cell growth. Our findings suggest that a delicate compromise between favoring ligand affinity and controlling protein function may be required to successfully design drugs against NUPR1, and likely other IDPs.

Isothermal Titration Calorimetry

Lead compound

Drug Development

Piperazine

Moiety

10.3390/biom11101453

Cite

Citations (19)

Wnt/β-catenin signalling: function, biological mechanisms, and therapeutic opportunities

Signal Transduction and Targeted Therapy (2022)

Jiaqi Liu Qing Xiao Jiani Xiao Chenxi Niu Yuanyuan Li

Abstract The Wnt/β-catenin pathway comprises a family of proteins that play critical roles in embryonic development and adult tissue homeostasis. The deregulation of Wnt/β-catenin signalling often leads to various serious diseases, including cancer and non-cancer diseases. Although many articles have reviewed Wnt/β-catenin from various aspects, a systematic review encompassing the origin, composition, function, and clinical trials of the Wnt/β-catenin signalling pathway in tumour and diseases is lacking. In this article, we comprehensively review the Wnt/β-catenin pathway from the above five aspects in combination with the latest research. Finally, we propose challenges and opportunities for the development of small-molecular compounds targeting the Wnt signalling pathway in disease treatment.

LRP6

10.1038/s41392-021-00762-6

Cite

Citations (1,110)

Flavonoid–alkylphospholipid conjugates elicit dual inhibition of cancer cell growth and lipid accumulation

Chemical Communications (2019)

Zhengwei Zhou Biyao Luo Xi Liu Mimi Chen Wenjun Lan

Quercetin–alkylphospholipid conjugates are promising chemical entities with anticancer activity and the ability to inhibit lipid synthesis and metabolism.

Conjugate

Lipid Accumulation

10.1039/c9cc04084f

Cite

Citations (9)