Mutations in reverse transcriptase (RT) confer high levels of HIV resistance to drugs. However, while conferring drug resistance, they can lower viral replication capacity (fitness). The molecular mechanisms behind remain largely unknown. The aim of the study was to characterize the effect of drug-resistance mutations on HIV RT expression. Genes encoding AZT-resistant RTs with single or combined mutations D67N, K70R, T215F, and K219Q, and RTs derived from drug-resistant HIV-1 strains were designed and expressed in a variety of eukaryotic cells. Expression in transiently transfected cells was assessed by Western blotting and immunofluorescent staining with RT-specific antibodies. To compare the levels of expression, mutated RT genes were microinjected into the nucleus of the oocytes of Xenopus laevis. Expression of RT was quantified by sandwich ELISA. Relative stability of RTs was assessed by pulse-chase experiments. Xenopus oocytes microinjected with the genes expressed 2-50 pg of RT mutants per cell. The level of RT expression decreased with accumulation of drug-resistance mutations. Pulse-chase experiments demonstrated that poor expression of DR-RTs was due to proteolytic instability. Instability could be attributed to additional cleavage sites predicted to appear in the vicinity of resistance mutations. Accumulation of drug-resistance mutations appears to affect the level of eukaryotic expression of HIV-1 RT by inducing proteolytic instability. Low RT levels might be one of the determinants of impaired replication fitness of drug-resistant HIV-1 strains.
One way to overcome the difficulties in HIV vaccination would be to enhance the primary immunization by particular adjuvants. We recently developed a very effective DNA immunization in which the immunogenicity of a single gene could be strongly enhanced. The administration of viral genes has been shown to induce both cellular and humoral immune responses, and to give protection in many animal models of infectious diseases [1]. DNA vaccination has been shown to be much more potent in rodents than in primates and humans [1,2]. Many strategies have been devised to overcome this problem. Priming with DNA and boosting with attenuated viral vectors has been shown to be very efficient in increasing cellular immune responses and protection [3]. Reverse transcriptase (RT) is an enzyme that plays a crucial role in the HIV-1 life cycle. We have demonstrated that immunization with the RT gene induces potent immune responses in rodents [4]. RT DNA alone, however, induced only weak immune responses in primates. Here, we show that priming with the HIV-1 RT gene followed by a boost with the RT protein together with the primate-specific CpG-oligodeoxynucleotide 2006 (TCGTCGTTTTGTCGTTTTGTC GTT) [5] induced very potent cellular responses in macaques (Table 1). Both the DNA prime and the oligodeoxynucleotide were found to be essential components to evoke the strong response. The RT-specific cellular response was measured using the enzyme-linked immunospot (ELISPOT) assay for IFN-γ secretion. Twenty-seven peptides (15 mers with 10aa overlap; Centralised Facility for AIDS Reagents, UK) covering amino acids 151–282 of the RT protein were used for cytokine activation [6]. RT-DNA prime followed by RT protein plus oligodeoxynucleotide boost induced a very strong response of over 600 RT-specific spots/million peripheral blood mononuclear cells (Table 1). A prominent IFN-γ response to RT peptides, but low response to the RT protein (not shown), argues for a CD8 cell-specific response [7]. Bacterial DNA has been found to contain immunostimulatory motifs called CpG motifs. Such motifs have been used as oligodeoxynucleotide adjuvants together with recombinant proteins. Primate-specific oligodeoxynucleotides mixed with protein have been shown to enhance humoral immune responses in primates [8]. The immunization method presented combines for the first time the potent priming abilities of DNA with the strong adjuvant effect of CpG oligodeoxynucleotides in the protein boost. This promising immunization strategy is less expensive and cumbersome than using viral vectors for boosting a primary response, yet it induces as good cellular immune responses.Table 1: Prime boost regimens using reverse transcriptase DNA or reverse transcriptase protein. Bartek Zubera,b,c Barbro Mäkitaloa Anne Kjerrström Zubera,b Britta Wahrena,b
Human immunodeficiency virus type I eludes control by the immune response through a high degree of variability and immune escape mechanisms. Induction of a broad specific immune response is important to clear virus-infected cells. DNA vaccination is a relatively new approach that induces both humoral and cellular immune responses in vaccinated hosts. The aim of this thesis was to enhance immune responses to different HIV-1 proteins using different DNA vaccine regimens. The three regulatory genes tat, rev and nef of HIV-1 have been of particular interest in vaccine design. A strong cytotoxic T-lymphocyte response against these three proteins correlates to long-term non-progression of disease. The protein expression from regulatory genes was characterized from patient and laboratory strain viruses. The laboratory strain derived genes resulted in the most efficient protein expression and were used for further studies. We examined single versus combined genes and found that individual responses to each protein were strongest after single gene administration. Immune responses to several targets were induced when the three genes were used together, which is important when developing an effective HIV-1 vaccine. The strongest responses were seen to the Nef protein. However, these responses decreased when co-immunizing with the tat and rev genes, as was the case with responses to Rev. Different combinations of plasmids, different injection sites and different doses might however overcome these drawbacks. Several immunization strategies, using DNA, recombinant modified vaccinia Ankara (MVA) vectors, protein mixed with CpG oligodeoxyribonucleotides (ODN), and a novel adjuvant, were evaluated. Different prime-boost regimes were used to enhance Nef-specific immune responses. The combination of nef DNA and MVAnef resulted in partial resistance from challenge with HIV-1/MuLV infected cells. The combination of recombinant Nef protein mixed with CpG ODN with or without a booster immunization with MVAnef also cleared HIV/MuLV infected cells. A broad response to Nef after HIV-1/MuLV challenge was apparent in the groups of mice that had received the recombinant Nef protein mixed with CpG ODN. To develop these findings, another HIV- I gene, the reverse transcriptase (RT) gene, was used. RT gene priming followed by RT protein mixed with CpG ODN booster was used in primates. Again, strong cellular responses were induced by RT DNA followed by RT protein mixed with CpG ODN. A combination of regulatory and structural genes might give a beneficial broad immune response. The compound imiquimod activates the Toll like receptor 7 and is used in the clinic for treating genital warts. Imiquimod was evaluated as an adjuvant with thenef, p37 (p17 and p24 genes) and RT genes of HIV- 1, and was shown to potentiate cellular immune responses capable of clearing HIV-1/MuLV infected cells. In conclusion, we were able to induce strong immune responses to all antigens tested using DNA vaccination. The responses were increased by using either adjuvants in combination with the DNA, by boosting with protein mixed with CpG ODN or by boosting with a recombinant modified vaccinia Ankara vector. The strongest cellular responses related to partial protection from challenge with HIV-1/MuLV infected cells.
