Studies in the Xenopus model system have provided considerable insight into the developmental role of intracellular Ca2+ signals produced by activation of IP3Rs (inositol 1,4,5-trisphosphate receptors). However, unlike mammalian systems where three IP3R subtypes have been well characterized, our molecular understanding of the IP3Rs that underpin Ca2+ signalling during Xenopus embryogenesis relate solely to the original characterization of the ‘Xenopus IP3R’ cloned and purified from Xenopus laevis oocytes several years ago. In the present study, we have identified Xenopus type 2 and type 3 IP3Rs and report the full-length sequence, genomic architecture and developmental expression profile of these additional IP3R subtypes. In the light of the emerging genomic resources and opportunities for genetic manipulation in the diploid frog Xenopus tropicalis, these data will facilitate manipulations to resolve the contribution of IP3R diversity in Ca2+ signalling events observed during vertebrate development.
Nicotinic acid adenine dinucleotide phosphate (NAADP) is a widespread and potent calcium-mobilizing messenger that is highly unusual in activating calcium channels located on acidic stores. However, the molecular identity of the target protein is unclear. In this study, we show that the previously uncharacterized human two-pore channels (TPC1 and TPC2) are endolysosomal proteins, that NAADP-mediated calcium signals are enhanced by overexpression of TPC1 and attenuated after knockdown of TPC1, and that mutation of a single highly conserved residue within a putative pore region abrogated calcium release by NAADP. Thus, TPC1 is critical for NAADP action and is likely the long sought after target channel for NAADP.
Abstract: The primary emphasis of conservation biology has moved away from attempting to manage single species within a given habitat to the preservation of entire communities within ecoregions, requiring that greater attention be paid to how biodiversity and species composition vary across spatial scales. Using a nested sampling design, we examined spatial variation in the biodiversity of forest Lepidoptera across three hierarchical levels: 20 forest stands, five sites, and three ecoregions. We used blacklight traps to sample the moth communities of each forest stand every week in June and August of 2000. Lepidopteran community composition was most significantly influenced by ecoregional differences, whereas patterns of α and β diversity across scales differed depending on how diversity was measured. Diversity partitioning models demonstrated that turnover in species richness occurred equally across all spatial scales because numerically rare species were continually encountered. In contrast, within‐stand effects disproportionately influenced Simpson and Shannon diversity ( relative to outcomes from randomization tests ), suggesting that local factors determined species dominance. Because most Lepidoptera in forests appear to be rare ( >50% ), it will be impossible for conservation biologists to design management plans to account for every species. We suggest that a more meaningful strategy would be to identify species that attain a reasonable abundance within a community ( 5–10% of all the individuals in a sample ) and that are unique to particular spatial levels. This strategy should produce two desirable outcomes: the conservation of species that render ecoregions distinct and the maintenance of functionally dominant species within forests.
The human sodium-dependent vitamin C transporter (hSVCT1) mediates sodium-dependent cellular uptake of the essential micronutrient l-ascorbic acid (vitamin C). However, the molecular determinants that control the cell surface expression, subcellular distribution, and dynamics of hSVCT1 remain undefined. To identify molecular determinants involved in hSVCT1 targeting in polarized epithelia, we used live cell imaging approaches to resolve the targeting and trafficking dynamics of hSVCT1 truncation mutants in renal and intestinal cells. Confocal imaging demonstrated that hSVCT1 was expressed at the apical cell surface and video rate measurements revealed hSVCT1 also resided in a heterogeneous population of intracellular organelles with discrete dynamic properties. By progressive truncation of the cytoplasmic C-terminal tail of hSVCT1, we delimited an essential role for an embedded ten amino acid sequence PICPVFKGFS (amino acids 563-572) in defining the physiological targeting of hSVCT1. Intriguingly, this sequence bears significant homology to recently identified apical targeting motifs in two other sodium-dependent transporters, and we suggest this conservation is reflected topologically through the adoption of a β-turn confirmation in the cytoplasmic C-tail of each transporter. Our results provide the first direct resolution of functional hSVCT1 expression at the apical cell surface of polarized epithelia and define an apical targeting signal of relevance to transporters of diverse substrate specificity. The human sodium-dependent vitamin C transporter (hSVCT1) mediates sodium-dependent cellular uptake of the essential micronutrient l-ascorbic acid (vitamin C). However, the molecular determinants that control the cell surface expression, subcellular distribution, and dynamics of hSVCT1 remain undefined. To identify molecular determinants involved in hSVCT1 targeting in polarized epithelia, we used live cell imaging approaches to resolve the targeting and trafficking dynamics of hSVCT1 truncation mutants in renal and intestinal cells. Confocal imaging demonstrated that hSVCT1 was expressed at the apical cell surface and video rate measurements revealed hSVCT1 also resided in a heterogeneous population of intracellular organelles with discrete dynamic properties. By progressive truncation of the cytoplasmic C-terminal tail of hSVCT1, we delimited an essential role for an embedded ten amino acid sequence PICPVFKGFS (amino acids 563-572) in defining the physiological targeting of hSVCT1. Intriguingly, this sequence bears significant homology to recently identified apical targeting motifs in two other sodium-dependent transporters, and we suggest this conservation is reflected topologically through the adoption of a β-turn confirmation in the cytoplasmic C-tail of each transporter. Our results provide the first direct resolution of functional hSVCT1 expression at the apical cell surface of polarized epithelia and define an apical targeting signal of relevance to transporters of diverse substrate specificity. Ascorbic acid (vitamin C) is an essential micronutrient required for many cellular functions relating to growth and development. Humans have lost the ability to synthesize vitamin C and therefore obtain it from dietary sources via absorption through intestinal epithelia. Dietary deficiencies in vitamin C lead to a variety of clinical abnormalities such as scurvy, delayed wound healing, bone and connective tissue disorders, and vasomotor instability (1Packer L. Fuchs J. Vitamin C in Health and Disease. Marcel Dekker Inc., New York1997Google Scholar). Furthermore recent studies demonstrate an increased intake of vitamin C plays a protective role against cardiovascular disease, cancer, and cataract formation (2Carr A.C. Frei B. Am. J. Clin. Nutr. 1999; 69: 1086-1107Crossref PubMed Scopus (661) Google Scholar). Two sodium-dependent vitamin C transporters have been identified in humans, sodium-dependent vitamin Ctransporter-1 (hSVCT1, 1The abbreviations used are: hSVCT1, human sodium-dependent vitamin C transporter; MDCK, Madin-Darby canine kidney cells; YFP, yellow fluorescent protein; GFP, green fluorescent protein; RT-PCR, reverse transcriptase-PCR.1The abbreviations used are: hSVCT1, human sodium-dependent vitamin C transporter; MDCK, Madin-Darby canine kidney cells; YFP, yellow fluorescent protein; GFP, green fluorescent protein; RT-PCR, reverse transcriptase-PCR. the product of the SLC23A1 gene) and human SVCT2 (hSVCT2, the product of the SLC23A2 gene), both of which mediate sodium-dependent accumulation of l-ascorbic acid in a variety of expression systems (3Daruwala R. Song J. Koh W.S. Rumsey S.C. Levine M. FEBS Lett. 1999; 460: 480-484Crossref PubMed Scopus (221) Google Scholar, 4Rajan P.D. Huang W. Dutta B. Devoe L.D. Leibach F.H. Ganapathy V. Prasad P.D. Biochem. Biophys. Res. Commun. 1999; 262: 762-768Crossref PubMed Scopus (146) Google Scholar, 5Wang Y. Mackenzie B. Tsukaguchi H. Weremowicz S. Morton C.C. Hediger M.A. Biochem. Biophys. Res. Commun. 2000; 267: 488-494Crossref PubMed Scopus (179) Google Scholar, 6Wang H. Dutta B. Huang W. Devoe L.D. Leibach F.H. Ganapathy V. Prasad P.D. Biochim. Biophys. Acta. 1999; 1461: 1-9Crossref PubMed Scopus (117) Google Scholar, 7Maulen N.P. Henriquez E.A. Kempe S. Carcamo J.G. Schmid-Kotsas A. Bachem M. Grunert A. Bustamante M.E. Nualart F. Vera J.C. J. Biol. Chem. 2003; 278: 9035-9041Abstract Full Text Full Text PDF PubMed Scopus (100) Google Scholar). These transporters display considerable structural and functional homologies: structurally, each protein has a 12 transmembrane spanning topology with cytoplasmic C- and N-terminal domains; functionally, both transporters exhibit high affinity (10-100 μm) for l-ascorbic acid. However, hSVCT1 and hSVCT2 display differential localizations; whereas hSVCT1 expression is confined to epithelia (e.g. kidney, intestine, and liver), hSVCT2 is more widely expressed (5Wang Y. Mackenzie B. Tsukaguchi H. Weremowicz S. Morton C.C. Hediger M.A. Biochem. Biophys. Res. Commun. 2000; 267: 488-494Crossref PubMed Scopus (179) Google Scholar, 6Wang H. Dutta B. Huang W. Devoe L.D. Leibach F.H. Ganapathy V. Prasad P.D. Biochim. Biophys. Acta. 1999; 1461: 1-9Crossref PubMed Scopus (117) Google Scholar, 8Takanaga H. Mackenzie B. Hediger M.A. Pflugers Arch. 2004; 447: 677-682Crossref PubMed Scopus (121) Google Scholar). The abundance of hSVCT1 in renal and intestinal epithelia implies a physiological role in renal reabsorption as well as dietary uptake of vitamin C. To fulfill such roles, Tsukaguchi et al. (9Tsukaguchi H. Tokui T. Mackenzie B. Berger U.V. Chen X.Z. Wang Y. Brubaker R.F. Hediger M.A. Nature. 1999; 399: 70-75Crossref PubMed Scopus (713) Google Scholar) have speculated that SVCT1 is localized to the apical surface of absorptive epithelial, and recent biochemical measurements in polarized CaCo-2 cells (a human colon carcinoma cell line) support such an apical localization of hSVCT1 (7Maulen N.P. Henriquez E.A. Kempe S. Carcamo J.G. Schmid-Kotsas A. Bachem M. Grunert A. Bustamante M.E. Nualart F. Vera J.C. J. Biol. Chem. 2003; 278: 9035-9041Abstract Full Text Full Text PDF PubMed Scopus (100) Google Scholar). To date, however, the cellular distribution of hSVCT1 has not been directly visualized in any epithelial cell line, and nothing is known about the mechanisms that dictate hSVCT1 targeting to the (apical) cell surface. Conventionally, molecular determinants that dictate the export of proteins from the endoplasmic reticulum and/or their localization at the cell surface comprise short motifs; for example, discrete tyrosine and di-leucine motifs have been identified within the cytoplasmic tail of many basolaterally targeted proteins (10Mellman I. Cold Spring Harb. Symp. Quant. Biol. 1995; 60: 745-752Crossref PubMed Scopus (21) Google Scholar, 11Roush D.L. Gottardi C.J. Naim H.Y. Roth M.G. Caplan M.J. J. Biol. Chem. 1998; 273: 26862-26869Abstract Full Text Full Text PDF PubMed Scopus (101) Google Scholar). For apically targeted proteins, sorting mechanisms appear to encompass a wider variety of signals, including post-translational modifications (glycosylation, glycosylphosphatidylinositol linkage) or specific determinants within the extracellular, transmembrane, or cytoplasmic domains (12Winckler B. Mellman I. Neuron. 1999; 23: 637-640Abstract Full Text Full Text PDF PubMed Scopus (115) Google Scholar, 13Dunbar L.A. Courtois-Country N. Roush D.L. Muth T.R. Gottardi C.J. Rajendran V. Geibel J. Kashgarian M. Caplan M.J. Acta Physiol. Scand. Suppl. 1998; 643: 289-295PubMed Google Scholar, 14Jacob R. Preuss U. Panzer P. Alfalah M. Quack S. Roth M.G. Naim H. Naim H.Y. J. Biol. Chem. 1999; 274: 8061-8067Abstract Full Text Full Text PDF PubMed Scopus (34) Google Scholar, 15Muth T.R. Ahn J. Caplan M.J. J. Biol. Chem. 1998; 273: 25616-25627Abstract Full Text Full Text PDF PubMed Scopus (88) Google Scholar, 16Cheng C. Glover G. Banker G. Amara S.G. J. Neurosci. 2002; 22: 10643-10652Crossref PubMed Google Scholar, 17Sun A-Q. Salkar R. Sachchidanand X. Shuhua Zeng L. Zhou M.-M. Suchy F.J. J. Biol. Chem. 2003; 278: 4000-4009Abstract Full Text Full Text PDF PubMed Scopus (55) Google Scholar). In order to define the subcellular distribution and targeting of hSVCT1 in live cells, we employed confocal imaging methods to visualize the targeting profile of hSVCT1 in polarized cell lines, derived from kidney (Madin-Darby canine kidney cells, MDCK) as well as intestine (CaCo-2). In both epithelia, we show that hSVCT1 is expressed at the apical brush border, although a significant fraction of the full-length protein is retained within a heterogeneous population of intracellular organelles. Using video rate confocal microscopy, these structures were further characterized by their distinctive dynamics. Thereafter, we employed a systematic truncation approach to identify regions within the full-length protein that were crucial for this physiological targeting profile of hSVCT1. Using this method, we identified a region within the C-terminal tail of hSVCT1 that is critical for its export to the apical brush border membrane. By analogy with recent results from other sodium-dependent transporters of disparate substrate specificity (16Cheng C. Glover G. Banker G. Amara S.G. J. Neurosci. 2002; 22: 10643-10652Crossref PubMed Google Scholar, 17Sun A-Q. Salkar R. Sachchidanand X. Shuhua Zeng L. Zhou M.-M. Suchy F.J. J. Biol. Chem. 2003; 278: 4000-4009Abstract Full Text Full Text PDF PubMed Scopus (55) Google Scholar), we suggest that topological variants of this motif may play a widespread role as apical determinants of protein targeting. Materials—[14C]Ascorbic acid (13mCi/mmol) was purchased from Amersham Biosciences. The enhanced yellow fluorescent protein vector (EYFP-N1) and red fluorescent protein vector (DsRed2-ER) were from BD Biosciences (Palo Alto, CA). Geneticin (G418) was from Invitrogen. Tissue culture cell lines were obtained from ATCC (Manassas, VA). All other reagents were from Sigma. A fusion protein of the neurotrophin receptor to a C-terminal GFP tag (p75-GFP) was a gift from Dr. Rodriguez-Boulan (Cornell University). Generation of hSVCT1-YFP and Truncated Constructs—The cDNA of the full-length hSVCT1 (1794 bp) was amplified by RT-PCR from total RNA isolated from CaCo-2 cells using gene-specific primers (Table I) and subcloned into pGEMT vector (Promega). The full-length hSVCT1-YFP fusion protein and truncated hSVCT1-YFP constructs were generated using the specific primer combinations defined in Table I under PCR conditions outlined previously (18Subramanian V.S. Marchant J.S. Parker I. Said H.M. J. Biol. Chem. 2003; 278: 3976-3984Abstract Full Text Full Text PDF PubMed Scopus (55) Google Scholar). PCR products and the EYFP-N1 vector were subsequently digested with the restriction enzymes HindIII and SacII, the products were gel-isolated and ligated together to generate in-frame fusion proteins with enhanced yellow fluorescent protein (YFP) fused to the C terminus of each construct. The nucleotide sequence of each construct was confirmed by sequencing (Laragen, Los Angeles, CA).Table IPrimer combinations used for preparation of hSVCT1 constructs by PCRConstructForward and reverse primers (5′-3′)PositionFragmentbpbphSVCT1-YFPCCCAAGCTTATGAGGGCCCAGGAGGAC;1-17971797TCCCCGCGGGACCTTGGTGCACACAGATGhSVCT1[576]-YFPCCCAAGCTTATGAGGGCCCAGGAGGAC;1-17281728TCCCCGCGGTTTTGAACTTGAAGAAAATCCThSVCT1[572]-YFPCCCAAGCTTATGAGGGCCCAGGAGGAC;1-17161716TCCCCGCGGAGAAAATCCTTTGAAGACTGGGhSVCT1[566]-YFPCCCAAGCTTATGAGGGCCCAGGAGGAC;1-16981698TCCCCGCGGTGGGCAGATAGGAATGTATTTCAhSVCT1[562]-YFPCCCAAGCTTATGAGGGCCCAGGAGGAC;1-16861686TCCCCGCGGAATGTATTTCAGAAAGGTAATTChSVCT1[553]-YFPCCCAAGCTTATGAGGGCCCAGGAGGAC;1-16591659TCCCCGCGGTACTATGCCCATCCCAATGhSVCT1[537]-YFPCCCAAGCTTATGAGGGCCCAGGAGGAC;1-16111611TCCCCGCGGCATGTCACTGTTGGCAThSVCT1[510]-YFPCCCAAGCTTATGAGGGCCCAGGAGGAC;1-15301530TCCCCGCGGTATGAAAGCAAGGCACCCGhSVCT1[566-KNTEFS]-YFPCCCAAGCTTATGAGGGCCCAGGAGGAC;1-17161716TCCCCGCGGAGAAAATTCTGTGTTTTTTGGGCAGATAGGAAThSVCT1[566-VAKVFS]-YFPCCCAAGCTTATGAGGGCCCAGGAGGAC;1-17161716TCCCCGCGGAGAAAATACTTTGGCGACTGGG Open table in a new tab Cell Culture and Transient Transfection—MDCK and human duodenally derived cells (HuTu-80) were maintained in minimal essential medium (MEM), and human colonic CaCo-2 cells cultured in Dulbecco's minimal essential medium, supplemented with 10% fetal bovine serum, glutamine (0.29 g/liter), sodium bicarbonate (2.2g/liter), penicillin (100,000 units/liter), and streptomycin (10 mg/liter). For radiolabel uptake and confocal imaging experiments, cells were seeded onto collagen-coated filters (Corning Costar, Cambridge, MA) and grown until post-confluency. Individual filter dishes were transiently transfected ∼5 days post-confluency with 2 μg of plasmid DNA using LipofectAMINE 2000 (Invitrogen) and then imaged 24-48 h later. For imaging of HuTu-80 cells, cells were grown on sterile glass-bottomed dishes (MatTek). Generation of Stable Cell Lines for Uptake Studies—hSVCT1-YFP-expressing MDCK or HuTu-80 cells were selected with G418 (0.8 mg/ml) for ∼8 weeks, after which hSVCT1 expression was quantified using semiquantitative RT-PCR. Total RNA (5 μg) was isolated from stably transfected and untransfected cells and used to generate first-stranded cDNA with hSVCT1 gene-specific primers (Table I) and a superscript First-Strand synthesis kit (Invitrogen). PCR reactions were loaded onto an agarose gel (0.7%), stained with ethidium bromide, and the intensity of the product band (1794 bp) was quantified by densitometry. For [14C]ascorbic acid uptake experiments, MDCK cells were seeded onto collagen-coated filters and grown to 3-5 days post-confluency. Monolayers were incubated for 3 min at 37 °C in Krebs-Ringer buffer (pH 7.4) in the presence of [14C]ascorbic acid (30 μm) added to either the apical of basolateral surface of the monolayer. Uptake of ascorbic acid was terminated by addition of ice-cold Krebs-Ringer buffer and accumulated radioactivity measured by scintillation counting. Confocal Microscopy—Cells were imaged using a BioRad MRC1024 confocal scanner attached to an Olympus AX70 microscope equipped with a ×60 oil and a ×60 water immersion objective for imaging coverslips and filters, respectively. Fluorophores were excited with the 488-nm line of an argon ion-laser, and emitted fluorescence was monitored with a 530 ± 20 nm band-pass (YFP) or 620-nm long-pass filters (DsRed). Fluorescence distribution was quantified using the IDL analysis package (Research Systems, Boulder, CO). For real-time confocal studies, a home-brew confocal microscope (19Callamaras N. Parker I. Cell Calcium. 1999; 26: 272-279Crossref Scopus (78) Google Scholar) was used to record images at 30 Hz (1 frame every 33 ms) with the microscope focused about 2 μm above the coverglass. The data stream was acquired using the VideoSavant processing package (IO Industries, London, ON), and the motion of individual vesicles tracked using the point to point tracking function in Metamorph (Universal Imaging, Downingtown, PA). In all movies, the heterogeneous size and fluorescence intensity of the hSVCT1-containing structures rendered it difficult to simultaneously image each object class without the fluorescence of some particles saturating. This drawback did not preclude particle tracking analyses, as individual data sets were analyzed separately. QuickTime videos of image sequences are appended as Supplementary Materials. Flow Cytometry—Flow cytometry was performed using a FACSCalibur bench top cytometer (BD Biosciences). MDCK cells were grown in T25 tissue culture flasks and transfected using LipofectAMINE 2000 in serum-free media (Optimem). Monolayers were trypsinized 48-h post-transfection and cells pelleted, resuspended, and filtered (35-μm filter) in 2-ml aliquots of Ca2+-free media at a density of 1 × 106 cells/ml as described previously (20Marchant J.S. Subramanian V.S. Parker I. Said H.M. J. Biol. Chem. 2002; 277: 33325-33333Abstract Full Text Full Text PDF PubMed Scopus (35) Google Scholar). In all flow cytometry experiments, control samples of untransfected and YFP-transfected MDCK cells were run in parallel with hSVCT1-YFP transfected samples, in order to calibrate optical parameters for identifying the intact, transfected cell population. Cellular Distribution and Functionality of hSVCT1-YFP—Fig. 1A shows a schematic representation of the full-length hSVCT1-YFP construct to illustrate the domain organization of the protein, which comprises a cytoplasmic N-terminal domain (amino acid residues 1-40), a transmembrane domain with twelve predicted membrane-spanning regions (41-510) and a cytoplasmic C-terminal tail (amino acid residues 511-598) to which YFP was fused. To investigate the cellular distribution and functionality of the full-length protein, a stable hSVCT1-YFP-expressing MDCK cell line was generated by antibiotic selection with G418. After ∼8 weeks of selection, RT-PCR measurements showed that hSVCT1 mRNA expression was ∼3-fold greater relative to mock-transfected MDCK cells (Fig. 1B, panel i), and a majority of cells (∼60%) scored positive for YFP fluorescence by flow cytometric analysis (data not shown). In confluent monolayers of the stable MDCK cell line grown on filters, hSVCT1-YFP targeted to the apical cell surface as well as in a variety of intracellular structures resolved distally to the cell membrane (Fig. 1B, panel ii). Similar results were obtained with filter-grown CaCo-2 cells (Fig. 1C). Finally, functional measurements of ascorbic acid uptake demonstrated that hSVCT1-YFP overexpression resulted in a ∼6.7-fold increase in [14C]ascorbic acid accumulation after addition of substrate to the apical compartment, compared with only a 1.9-fold increase when substrate was applied basolaterally (Fig. 1B, panel iii). Together, these results suggest that hSVCT1-YFP mediates vitamin C accumulation across the apical plasma membrane domain in both renal and intestinal epithelia. In axial sections (xz) of renal (MDCK) and intestinal (CaCo-2) cells grown on permeable filter supports (Fig. 1C), the proportion of hSVCT1-YFP retained intracellularly was compared with that observed with two other constructs: first, the p75 neurotrophin receptor (p75-GFP), which targets to the apical plasma membrane domain and is known to recycle through endocytic pathways and second, the human thiamine transporter-2 (hTHTR2-GFP) which we have shown targets efficiently to the apical brush border in both MDCK and CaCo-2 cells (21Boulware M.J. Subramanian V.S. Said H.M. Marchant J.S. Biochem. J. 2003; 376: 43-48Crossref PubMed Scopus (35) Google Scholar, 22Said H.M. Balamurugan K. Subramanian V.S. Marchant J.S. Am. J. Physiol. 2003; 286: G491-G498Google Scholar). For each construct, measurements were made of the ratio between the average fluorescence at the apical surface and the cell midpoint (R, as shown in Fig. 1C, panel i). Although all three constructs tested were expressed at the apical cell surface, the proportion of full-length hSVCT1 protein observed intracellularly was significantly more than that resolved for hTHTR2-GFP but similar to that observed with p75-GFP (e.g. fluorescence ratios surface/intracellular of 3.6 ± 0.6, 4.2 ± 0.8, and 7.9 ± 1.2 for hSVCT1-YFP, p75-GFP, and hTHTR2-GFP in MDCK cells respectively, Fig. 1C, panel ii). Similar observations were made by comparison in MDCK stable cell lines expressing hSVCT1-YFP and hTHTR2-GFP (fluorescence ratios of 3.7 ± 1.2 for hSVCT1-YFP and 9.5 ± 3.9 for hTHTR2-GFP). Lateral (xy) confocal sections, in cells cotransfected with an endoplasmic reticulum marker (DsRed2-ER, Fig. 1C, panel iii) revealed that this disparity resulted from the abundant presence of hSVCT1-YFP within a variety of intracellular structures distinct from the endoplasmic reticulum, the properties of which were subsequently investigated (see below). Molecular Determinants of hSVCT1 Plasma Membrane Targeting Reside within the Cytoplasmic Domain of the Protein—To investigate the role of specific regions of hSVCT1 structure in determining the targeting of protein to the apical surface of epithelial cells, we employed a truncation approach, in which the full-length protein was progressively shortened from the C terminus by stretches of ∼20 amino acids, and the cellular distribution of each truncation mutant was resolved by transfection into filter-grown MDCK and CaCo-2 cells. Fig. 2A shows results obtained with four truncation mutants spanning the length of the cytoplasmic C terminus of hSVCT1 (511-598 amino acids; hSVCT1[576]-YFP, hSVCT1[553]-YFP, hSVCT1[537]-YFP, and hSVCT1[510]-YFP). Loss of the 22 terminal amino acids of the full-length protein failed to impact the plasma membrane targeting of hSVCT1[576]-YFP in either MDCK or CaCo-2 cells. Quantification of the axial distribution of hSVCT1[576]-YFP revealed a similar distribution of protein localization between the apical cell surface and intracellular organelles (ratio of 3.2 ± 0.6 in MDCKs, 4.6 ± 1.2 in CaCo-2 cells) as observed with the full-length hSVCT1-YFP (3.6 ± 0.6 and 5.3 ± 0.4, Fig. 2B). In contrast, further truncation of the cytoplasmic tail after 510, 537, or 553 amino acids resulted in a loss of cell surface targeting and expression of the truncated protein within intracellular membranes (Fig. 2A, panel i). Dual emission imaging of cells co-transfected with a red fluorescent protein construct targeted to the endoplasmic reticulum (DsRed2-ER) revealed considerable fluorescence overlap between the DsRed2 variant and each of these three truncated constructs (e.g.Fig. 2A, panel ii, left), indicating that these proteins were likely retained within the endoplasmic reticulum. In contrast, there was little fluorescence overlap between DsRed2-ER and hSVCT1[576]-YFP (Fig. 2A, panel ii, right). Finally, we performed flow cytometry measurements from populations of MDCK cells transfected with all of these individual truncations to gauge the expression efficiency of each construct. Measurements of the mean fluorescent intensity of the transfected population revealed no difference between the expression efficiency of hSVCT1-YFP and hSVCT1[576]-YFP but a significantly lower fluorescence intensity with truncation mutations retained within the endoplasmic reticulum (hSVCT1[553]-YFP, hSVCT1[537]-YFP, and hSVCT1[510]-YFP, Fig. 2C). The Region between Amino Acids 563 and 572 Dictates the Apical Expression of hSVCT1 in Renal and Intestinal Cells—On the basis of the results described above, demonstrating that amino acids between 553 and 576 were important for cell surface targeting, we performed further truncation analyses within this region to delimit the sequence important for apical membrane expression of hSVCT1. The results of these analyses are summarized in Fig. 3. Further truncation of the cytoplasmic tail up to amino acid residue 572 (hSVCT1[572]YFP) did not impair the apical plasma membrane localization, assessed by both measurements of axial distribution (hSVCT1[572]-YFP polarity ratio of 3.5 ± 0.9 versus 3.6 ± 0.6 for wild-type protein in MDCK cells and 5.40 ± 0.74 versus 5.34 ± 0.58 in CaCo-2 cells, Fig. 3B) or efficiency of expression (hSVCT1[572]-YFP population brightness 112.1 ± 13.0% of wild type, Fig. 3C). In contrast, truncation of the preceding ten amino acids (hSVCT1[562]-YFP) dramatically altered the targeting phenotype, as the truncated protein was retained within intracellular membranes (Fig. 3, A and B) and exhibited a considerably lower expression efficiency as assessed by flow cytometry (47 ± 3% of wild type, Fig. 3C). Truncation after proline 566 (hSVCT1[566]-YFP) resulted in an intermediate phenotype, where although some MDCK and CaCo-2 cells displayed an apical targeting phenotype, the majority of cells retained hSVCT1[566]-YFP within the endoplasmic reticulum (Fig. 3). Role of Sequence and Topology of the C-terminal VFKG Motif—In light of the above results, we focused upon amino acid residues 567-572 (VFKGFS) as a key sequence determinant of hSVCT1 export from the endoplasmic reticulum to the apical cell surface. To determine whether truncation of this region impaired apical targeting owing to a loss of specific sequence, rather than a simple shortening of the hSVCT1 polypeptide, we replaced residues within this region with randomly chosen amino acids while conserving the overall polypeptide length of 572 residues that targets just as the full-length protein (Figs. 1 and 3). Substitution of the VFKG tetrapeptide alone (e.g. hSVCT1[566-KNTEFS]-YFP) was sufficient to abrogate an apical targeting phenotype in MDCK cells (Fig. 4A, hSVCT1[566-KNTEFS]-YFP polarity ratio of 1.66 ± 0.11 versus 4.36 ± 0.36 for wild-type protein). Further the efficiency of expression of hSVCT1[566-KNTEFS]-YFP was considerably lower than hSVCT1[572]-YFP (FACS population brightness: 69.4 ± 6.5% of wild type, Fig. 4B). These data suggest that specific sequence determinants within this region dictate the apical targeting of hSVCT1. Comparison of the VFKGFS sequence with known targeting motifs within the cytoplasmic tail of other transporters, highlighted two reports that merit immediate discussion. Cheng et al. (16Cheng C. Glover G. Banker G. Amara S.G. J. Neurosci. 2002; 22: 10643-10652Crossref PubMed Google Scholar) recently identified a novel motif within the cytoplasmic tail of the excitatory amino acid transporter 3 (EAAT3) that directed the apical targeting of this protein in MDCK cells and defined the essential core motif as VNGGFA/S (amino acids 504-509). Alignment of this region with hSVCT1 shows conservation of four of these six residues (Fig. 4C, panel i). Second, Sun et al. (17Sun A-Q. Salkar R. Sachchidanand X. Shuhua Zeng L. Zhou M.-M. Suchy F.J. J. Biol. Chem. 2003; 278: 4000-4009Abstract Full Text Full Text PDF PubMed Scopus (55) Google Scholar) defined a fourteen amino acid sequence required for optimal apical membrane targeting of the rat ileal bile acid transporter (Asbt), with shorter regions within this sequence sufficient to produce an apical bias of protein location. The authors analyzed the structural conformation of this region by NMR and demonstrated that the tetrapeptide sequence NKGF (amino acids 340-343) formed a β-turn motif within the targeting sequence. This elegant study provided the first evidence of a unique secondary structure determinant within an apical targeting motif. Homology alignment of this region with hSVCT1 and EAAT-3 sequence (Fig. 4C, panel i), demonstrated that three of the four amino residues within the tetrapeptide β-turn are conserved between Asbt and both the other apically targeted proteins. On the basis of these reports, we were intrigued by the idea that the VFKGFS sequence in hSVCT1 may confer a similar conformational topology, i.e. adopt a β-turn important for apical targeting. To test this idea, we initially applied two different predictive methods to identify β-turns within proteins: first, a tetrapeptide residue-coupled model developed by Chou (predictive success rate of 88.0% from both known β-turn and non-β-turn training sets, (23Chou K.C. J. Pept. Res. 1997; 49: 120-144Crossref PubMed Scopus (59) Google Scholar) and second, a neural-network based method developed by Kaur and Raghava (BetaTPred2, predictive success rate of 75.5%, Ref. 24Kaur H. Raghava G.P. Protein Sci. 2003; 12: 627-634Crossref PubMed Scopus (122) Google Scholar). First, using the Chou method, successive tetrapeptide regions along the C-terminal region of hSVCT1 were analyzed for propensity to form β-turns, scored in terms of a discriminant function Δ, where values of Δ>0 indicate the tetrapeptide forms a β-turn. Fig. 4C, panel ii shows that sequential tetrapeptides within the proposed core targeting sequence (underlined) VFKGFS scored positively for the occurrence of a β-turn. Similar predictions were obtained using BetaTPred2 (www.imtech.res.in/raghava/betatpred2). As a control for the predictive capacity of this method, the Asbt sequence was analyzed (Fig. 4C, panel iii, yellow bars), and the algorithm positively scored the NKGF β-turn tetrapeptide (17Sun A-Q. Salkar R. Sachchidanand X. Shuhua Zeng L. Zhou M.-M. Suchy F.J. J. Biol. Chem. 2003; 278: 4000-4009Abstract Full Text Full Text PDF PubMed Scopus (55) Google Scholar). Further, analysis of the region spanning the fourteen amino acid apical targeting sequence of EAAT-3 identified the tetrapeptide sequence VNGG as a potential β-turn at a position, which aligns exactly with the VFKG tetrapeptide scored most positively in hSVCT1 (Fig. 4C, panel iii, red arrows). We then tested whether replacement of the putative β-turn forming sequence with a known non-β-turn forming tetrapeptide would disrupt the apical targeting phenotype. From a known set of non-β-turns (23Chou K.C. J. Pept. Res. 1997; 49: 120-144Crossref PubMed Scopus
The functionality of the endoplasmic reticulum (ER) as a Ca(2+) storage organelle is supported by families of Ca(2+) pumps, buffers and channels that regulate Ca(2+) fluxes between the ER lumen and cytosol. Although many studies have identified heterogeneities in Ca(2+) fluxes throughout the ER, the question of how differential functionality of Ca(2+) channels is regulated within proximal regions of the same organelle is unresolved. Here, we studied the in vivo dynamics of an ER subdomain known as annulate lamellae (AL), a cytoplasmic nucleoporin-containing organelle widely used in vitro to study the mechanics of nuclear envelope breakdown. We show that nuclear pore complexes (NPCs) within AL suppress local Ca(2+) signalling activity, an inhibitory influence relieved by heterogeneous dissociation of nucleoporins to yield NPC-denuded ER domains competent at Ca(2+) signalling. Consequently, we propose a novel generalized role for AL - reversible attenuation of resident protein activity - such that regulated AL (dis)assembly via a kinase/phosphatase cycle allows cells to support rapid gain/loss-of-function transitions in cellular physiology.
'%3e%3cpath fill='%23012169' d='M0 0v30h60V0z'/%3e%3cpath stroke='%23fff' stroke-width='6' d='m0 0 60 30m0-30L0 30'/%3e%3cpath stroke='%23C8102E' stroke-width='4' d='m0 0 60 30m0-30L0 30' clip-path='url(%23b)'/%3e%3cpath stroke='%23fff' stroke-width='10' d='M30 0v30M0 15h60'/%3e%3cpath stroke='%23C8102E' stroke-width='6' d='M30 0v30M0 15h60'/%3e%3c/g%3e%3c/svg%3e)