The 5-hydroxytryptamine2c receptor (5-HT2cR) is subjected to RNA editing, in the second intracellular loop, generating 14 different isoforms in human brain. This post-transcriptional event markedly alters the signaling properties of the receptor by reducing its ability to couple to G-proteins. Although the non-edited form of the receptor is essentially fully constitutively active, edited forms show lesser degrees of constitutive activity. We have used two extensively edited receptor isoforms, VGV and VSV, and the non-edited INI isoform to investigate how variations in constitutive receptor activity affect the trafficking and the interaction of these isoforms with components of the desensitization machinery in HEK 293 cells. We found that cell surface expression of the 5-HT2cR decreased in parallel with increased constitutive activity of the isoforms. The subcellular distribution of the various isoforms was dependent of their ability to interact with βarrestin2, which correlated with the constitutive activity level of each isoform. We observed that the agonist-independent interaction of βarrestin2 with constitutively active 5-HT2cR isoforms was reversed by inverse agonist treatments promoting receptor redistribution to the cell surface. Overexpression of a G-protein-coupled receptor kinase (GRK2) was able to stabilize the interaction of βarrestin2 with constitutively active 5-HT2cR isoforms even in the presence of inverse agonists. Taken together, our observations indicate that the constitutively active 5-HT2cR isoforms are spontaneously internalized in an agonist-independent manner. This endocytosis process is mediated by a GRK/βarrestin-dependent mechanism and is directly correlated with the constitutive activity status of the RNA edited receptor variants. Thus the ultimate physiological output of constitutively active receptors may be determined not only by their agonist-independent activity but also by their interactions with GRKs and βarrestin. The 5-hydroxytryptamine2c receptor (5-HT2cR) is subjected to RNA editing, in the second intracellular loop, generating 14 different isoforms in human brain. This post-transcriptional event markedly alters the signaling properties of the receptor by reducing its ability to couple to G-proteins. Although the non-edited form of the receptor is essentially fully constitutively active, edited forms show lesser degrees of constitutive activity. We have used two extensively edited receptor isoforms, VGV and VSV, and the non-edited INI isoform to investigate how variations in constitutive receptor activity affect the trafficking and the interaction of these isoforms with components of the desensitization machinery in HEK 293 cells. We found that cell surface expression of the 5-HT2cR decreased in parallel with increased constitutive activity of the isoforms. The subcellular distribution of the various isoforms was dependent of their ability to interact with βarrestin2, which correlated with the constitutive activity level of each isoform. We observed that the agonist-independent interaction of βarrestin2 with constitutively active 5-HT2cR isoforms was reversed by inverse agonist treatments promoting receptor redistribution to the cell surface. Overexpression of a G-protein-coupled receptor kinase (GRK2) was able to stabilize the interaction of βarrestin2 with constitutively active 5-HT2cR isoforms even in the presence of inverse agonists. Taken together, our observations indicate that the constitutively active 5-HT2cR isoforms are spontaneously internalized in an agonist-independent manner. This endocytosis process is mediated by a GRK/βarrestin-dependent mechanism and is directly correlated with the constitutive activity status of the RNA edited receptor variants. Thus the ultimate physiological output of constitutively active receptors may be determined not only by their agonist-independent activity but also by their interactions with GRKs and βarrestin. Following the well established paradigm, agonist-bound G-protein-coupled receptors (GPCRs) 1The abbreviations used are: GPCR, G-protein-coupled receptor; βarr, β-arrestin; 5-HT, 5-hydroxytryptamine; 5-HT2cR, 5-hydroxytryptamine2c receptor; GFP, green fluorescent protein; YFP, yellow fluorescent protein; HcRed, Heteractis crispa red fluorescent protein; GRK, G-protein-coupled receptor kinase; PLC, phospholipase C; HA, hemagglutinin; MEM, minimal essential medium; ELISA, enzyme-linked immunosorbent assay. become substrates for G-protein-coupled receptor kinases (GRKs). Following GRK-mediated phosphorylation, the agonist-occupied receptor is bound with high affinity by arrestin proteins (1.Attramadal H. Arriza J.L. Aoki C. Dawson T.M. Codina J. Kwatra M.M. Snyder S.H. Caron M.G. Lefkowitz R.J. J. Biol. Chem. 1992; 267: 17882-17890Abstract Full Text PDF PubMed Google Scholar, 2.Premont R.T. Inglese J. Lefkowitz R.J. FASEB J. 1995; 9: 175-182Crossref PubMed Scopus (472) Google Scholar, 3.Gurevich V.V. Dion S.B. Onorato J.J. Ptasienski J. Kim C.M. Sterne-Marr R. Hosey M.M. Benovic J.L. J. Biol. Chem. 1995; 270: 720-731Abstract Full Text Full Text PDF PubMed Scopus (339) Google Scholar). Arrestin binding uncouples the receptor from its cognate G-protein (desensitization) resulting in receptor endocytosis mediated by clathrin-coated pits (4.Goodman Jr., O.B. Krupnick J.G. Santini F. Gurevich V.V. Penn R.B. Gagnon A.W. Keen J.H. Benovic J.L. Nature. 1996; 383: 447-450Crossref PubMed Scopus (1172) Google Scholar, 5.Ferguson S.S.G. Downey III, W.E. Colapietro A.M. Barak L.S. Ménard L. Caron M.G. Science. 1996; 271: 363-366Crossref PubMed Scopus (846) Google Scholar). Internalized receptor can then be recycled back to the plasma membrane with highly variable kinetics (resensitization) or be degraded (down-regulation) or both. However, beyond this classic receptor theory, it has been found that some receptors can exhibit constitutive activity, defined as a specific molecular conformation of the receptor that is able to signal in an agonist-independent fashion (6.Kjelsberg M.A. Cotecchia S. Ostrowski J. Caron M.G. Lefkowitz R.J. J. Biol. Chem. 1992; 267: 1430-1433Abstract Full Text PDF PubMed Google Scholar, 7.Parma J. Duprez L. Van Sande J. Cochaux P. Gervy C. Mockel J. Dumont J. Vassart G. Nature. 1993; 365: 649-651Crossref PubMed Scopus (851) Google Scholar, 8.Shenker A. Laue L. Kosugi S. Merendino Jr., J.J. Minegishi T. Cutler G.B.Jr Nature. 1993; 365: 652-654Crossref PubMed Scopus (653) Google Scholar). Most known spontaneously constitutively active GPCRs are constitutively phosphorylated, including the bradykinin B2 receptor (9.Quitterer U. AbdAlla S. Jarnagin K. Muller-Esterl W. Biochemistry. 1996; 35: 13368-13377Crossref PubMed Scopus (36) Google Scholar, 10.Blaukat A. Pizard A.Breit A. Wernstedt C. Alhenc-Gelas F. Muller-Esterl W. Dikic I. J. Biol. Chem. 2001; 276: 40431-40440Abstract Full Text Full Text PDF PubMed Scopus (74) Google Scholar), the metabotropic glutamate receptor mGluR1 (11.Prezeau L. Gomeza J. Ahern S. Mary S. Galvez T. Bockaert J. Pin J.P. Mol. Pharmacol. 1996; 49: 422-429PubMed Google Scholar), the peripheral cannabinoid receptor (CB2) (12.Bouaboula M. Dussossoy D. Casellas P. J. Biol. Chem. 1999; 274: 20397-20405Abstract Full Text Full Text PDF PubMed Scopus (90) Google Scholar), the human cytomegalovirus US28 receptor (13.Miller W.E. Houtz D.A. Nelson C.D. Kolattukudy P.E. Lefkowitz R.J. J. Biol. Chem. 2003; 278: 21663-21671Abstract Full Text Full Text PDF PubMed Scopus (85) Google Scholar), as well as the 5-hydroxytryptamine2c receptor (5-HT2cR) (14.Westphal R.S. Backstrom J.R. Sanders-Bush E. Mol. Pharmacol. 1995; 48: 200-205PubMed Google Scholar). Serotonin 2c (previously 5-HT1c) receptors belong to the rhodopsin-like family of GPCRs and interact with Gαq to stimulate phospholipase Cβ (PLCβ) (15.Chang M. Zhang L. Tam J.P. Sanders-Bush E. J. Biol. Chem. 2000; 275: 7021-7029Abstract Full Text Full Text PDF PubMed Scopus (85) Google Scholar). The 5-HT2cR is known to exist naturally as several distinct protein isoforms secondary to RNA editing (16.Burns C.M. Chu H. Rueter S.M. Hutchinson L.K. Canton H. Sanders-Bush E. Emeson R.B. Nature. 1997; 387: 303-308Crossref PubMed Scopus (860) Google Scholar, 17.Niswender C.M. Sanders-Bush E. Emeson R.B. Ann. N. Y. Acad. Sci. 1998; 861: 38-48Crossref PubMed Scopus (77) Google Scholar). RNA editing is mediated by adenosine desaminases that act on double-stranded RNA to convert up to five adenosines residues to inosines residues within the pre-mRNA of the 5-HT2cR, creating non-synonymous changes in amino acids 156, 158, and 160 (16.Burns C.M. Chu H. Rueter S.M. Hutchinson L.K. Canton H. Sanders-Bush E. Emeson R.B. Nature. 1997; 387: 303-308Crossref PubMed Scopus (860) Google Scholar, 18.Liu Y. Emeson R.B. Samuel C.E. J. Biol. Chem. 1999; 274: 18351-18358Abstract Full Text Full Text PDF PubMed Scopus (86) Google Scholar). Interestingly, RNA editing takes place in the second intracellular loop region of the 5-HT2cR, starting two residues downstream of the DRY (Asp-Arg-Tyr) motif that is highly conserved among the GPCR family. This motif is suggested to play a critical role in agonist-induced receptor activation. Indeed, mutations of the aspartate residue in the DRY motif have been found to lead to constitutively active mutants of many GPCRs (19.Cohen G.B. Yang T. Robinson P.R. Oprian D.D. Biochemistry. 1993; 32: 6111-6115Crossref PubMed Scopus (218) Google Scholar, 20.Scheer A. Fanelli F. Costa T. De Benedetti P.G. Cotecchia S. EMBO J. 1996; 15: 3566-3578Crossref PubMed Scopus (361) Google Scholar, 21.Morin D. Cotte N. Balestre M.N. Mouillac B. Manning M. Breton C. Barberis C. FEBS Lett. 1998; 441: 470-475Crossref PubMed Scopus (73) Google Scholar, 22.Rasmussen S.G.F. Jensen A.D. Liapakis G. Ghanouni P. Javitch J.A. Gether U. Mol. Pharmacol. 1999; 56: 175-184Crossref PubMed Scopus (197) Google Scholar). The unedited version of the 5-HT2cR displays a large degree of constitutive activity essentially being unresponsive to further agonist stimulation. Importantly, RNA editing of the 5-HT2cR has been shown to create receptor isoforms that display lesser degrees of constitutive signaling by severely reducing the G-protein coupling efficiency (23.Niswender C.M. Copeland S.C. Herrick-Davis K. Emeson R.B. Sanders-Bush E. J. Biol. Chem. 1999; 274: 9472-9478Abstract Full Text Full Text PDF PubMed Scopus (298) Google Scholar). Among the 14 5-HT2cR isoforms expressed in human brain, we have focused our study on three isoforms, the fully edited VGV, the partially edited VSV, and the unedited INI. The fully edited 5-HT2cR-VGV (Val156-Gly158-Val160) isoform displays the lowest level of constitutive activity and is essentially silent, requiring agonist stimulation to couple to PLC activation. The 5-HT2cR-VSV (Val156-Ser158-Val160), the predominant isoform expressed in human brain, displays modest constitutive activity, essentially 50% of that achieved by maximal activation of the receptor by the full agonist serotonin (5-HT). Finally, as stated above, the unedited 5-HT2cR-INI (Ile156-Asn158-Ile160)is the isoform that presents maximal levels of constitutive activity, approaching that achieved by serotonin (24.Price R.D. Weiner D.M. Chang M.S.S. Sanders-Bush E.S. J. Biol. Chem. 2001; 276: 44663-44668Abstract Full Text Full Text PDF PubMed Scopus (93) Google Scholar, 25.Weiner D.M. Burstein E.S. Nash N. Croston G.E. Currier E.A. Vanover K.E. Harvey S. Donohue E. Hansen H.C. Andersson C.M. Spalding T.A. Gibson D.F.C. Krebs-Thomson K. Powell S.B. Geyer M.A. Hacksell U. Brann M.R. J. Pharm. Exp. Ther. 2001; 299: 268-271PubMed Google Scholar). Thus, the 5-HT2cR is unique in that the natural isoform signals in a ligand-independent manner and that this property is attenuated by RNA editing. Previous studies have evaluated the signaling properties of the various 5-HT2cR isoforms based on inositol phosphate accumulation measurements and have also proposed that GRK2 can mediate desensitization of the 5-HT2cR (26.Sallese M. Mariggio S. D'Urbano E. Iacovelli L. De Blasi A. Mol. Pharmacol. 2000; 57: 826-831Crossref PubMed Scopus (122) Google Scholar, 27.Berg K.A. Stout B.D. Maayani S. Clarke W.P. J. Pharmacol. Exp. Ther. 2001; 299: 593-602PubMed Google Scholar). However, whether the differential intrinsic signaling properties of the various isoforms might influence or be mediated by interaction with βarrestins and subsequently influence their relative cellular localization have not yet been examined. In this report, we have used these three edited variants of the human 5-HT2cR to investigate how various levels of constitutive activity, resulting from naturally occurring amino acids modifications, influence the cellular distribution of these GPCRs. Furthermore, we examined if the 5HT2cR internalization was βarrestin-dependent and to what extend constitutive activity of the receptor could lead to an agonist-independent recruitment of the βarrestins. Thus, these various isoforms allow us to address the issue of whether constitutively active receptors are also constitutively desensitized and internalized. Materials—Collagen solution, anti-FLAG M2-HRP antibody, anti-FLAG M2-agarose, 5-hydroxytryptamine hydrochloride, mesulergine hydrochloride N′-[(8a)-1,6-dimethylergolin-8-yl]-N,N-dimethylsulfamide hydrochloride, SB206553 (N-3-pyridinyl-3,5-dihydro-5-methylbenzo[1,2-b:4,5-b′]dipyrrole-1[2H]carboxamide) hydrochloride, brefeldin A, and o-phenylenediamine dihydrochloride were obtained from Sigma-Aldrich Co. (St. Louis, MO). Living Colors A.v. peptide polyclonal antibody against the green fluorescent protein (GFP) was from BD Biosciences Clontech (Palo Alto, CA). Texas-Red transferrin was purchased from Molecular Probes (Eugene, OR). Cell culture reagents were obtained from Life Sciences. Monoclonal antibody against actin was from Chemicon International Inc. (Temecula, CA). Plasmid Constructs—Construction of plasmids βarr2-GFP, βarr1-GFP, βarrestin2 dominant negative mutant V54D, GRK2, and GRK2 dominant negative mutant [K220R] have been described previously (5.Ferguson S.S.G. Downey III, W.E. Colapietro A.M. Barak L.S. Ménard L. Caron M.G. Science. 1996; 271: 363-366Crossref PubMed Scopus (846) Google Scholar, 28.Barak L.S. Ferguson S.S. Zhang J. Caron M.G. J. Biol. Chem. 1997; 272: 27497-27500Abstract Full Text Full Text PDF PubMed Scopus (396) Google Scholar, 29.Zhang J. Barak L.S. Anborgh P.H. Laporte S.A. Caron M.G. Ferguson S.S. J. Biol. Chem. 1999; 274: 10999-11006Abstract Full Text Full Text PDF PubMed Scopus (192) Google Scholar, 30.Koch W.J. Hawes B.E. Inglese J. Luttrell L.M. Lefkowitz R.J. J. Biol. Chem. 1994; 269: 6193-6197Abstract Full Text PDF PubMed Google Scholar, 31.Kong G. Penn R. Benovic J.L. J. Biol. Chem. 1994; 269: 13084-13087Abstract Full Text PDF PubMed Google Scholar). βarr2-HcRed was constructed via polymerase chain reaction using a proofreading polymerase (Pfu, Stratagene). The following primers were used: βarr2-5′, ACTGGAGCTCAAATGGGTGAAAAACCCGGGACC; and βarr2-3′, ACTGGGTACCGCAGAACTGGTCATCACAGTCGTC (underlined residues are restriction sites of SacI and KpnI). The PCR products were subcloned into the SacI-KpnI sites of pHC-Red-N1 (Clontech). The Golgi-YFP expression vector labeling the trans-Golgi network was from Clontech. The cDNA vector encoding the HA-tagged human Rab11a was a gift from SSG Ferguson. cDNA vectors for the 5-HT2C-INI, 5-HT2C-VSV, and 5-HT2C-VGV isoforms of the 5-HT2c receptor have been described previously (24.Price R.D. Weiner D.M. Chang M.S.S. Sanders-Bush E.S. J. Biol. Chem. 2001; 276: 44663-44668Abstract Full Text Full Text PDF PubMed Scopus (93) Google Scholar). FLAG-tagged 5-HT2c receptor isoforms were constructed via polymerase chain reaction using Pfu polymerase with the following primers: 5-HT2C-5′, ATATGGTACCACC[ATGGATTATAAGGATGATGATGATGCG]GTGACCCTGAGGAATGCGG; and 5-HT2C-3′, GATCGGGCCCTCACACACTGCTAATCCTTTCGC (brackets surround the epitope sequence, and underlined residues are restriction sites of KpnI or NotI). The PCR products were subcloned into the KpnI-NotI sites of pCDNA3.1+. The primers used for the construction of 5-HT2c-GFP receptor isoforms were: 5-HT2C-5′, ATATAGATCTATGGTGAACCTGAGGAATGCGG; and 5-HT2C-3′, CAGTGAATTCCACACTGCTAATCCTTTCGC (underlined residues are restriction sites of BglII or EcoRI). The PCR products were subcloned into the BglII-EcoRI sites of pEGFP-N2 (Clontech). The sequences were confirmed using an automated ABI DNA sequencer. Cell Culture and Transfection—HEK 293 cells were grown in Eagle's minimum essential medium with Earle's salt (MEM) supplemented with 10% (v/v) fetal bovine serum and a 1:1000 dilution of gentamicin reagent solution (Invitrogen). Cells were transiently transfected in 100-mm dishes (Falcon) with 5 μg of receptor and 0.8 μg of βarrestin2-GFP or βarrestin1-GFP using a calcium phosphate co-precipitation method (32.Barak L.S. Menard L. Ferguson S.S. Colapietro A.M. Caron M.G. Biochemistry. 1995; 34: 15407-15414Crossref PubMed Scopus (139) Google Scholar). Co-immunoprecipitation—100-mm plates of HEK 293 cells were cotransfected with FLAG 5-HT2cR, βarr2-GFP, or βarr1-GFP and in some experiments with GRK2 or GRK2 dominant negative mutant [K220R]. 18 h after transfection the media was removed and cells were incubated with fresh complemented media. 14 h later, the cells were starved for 5 h before incubation for 30 min at 37 °C with 10 μm serotonin or 1 μm SB206553. The cells were rinsed with ice-cold phosphate-buffered saline and harvested by addition of 500 μl of cold radioimmune precipitation assay buffer (150 mm NaCl, 50 mm Tris/HCl, pH 8, 5 mm EDTA, 1% Nonidet P-40, 0.5% sodium deoxycholate, 0.1% SDS, anti-proteases mixture (Roche Applied Science), 1 mm sodium fluoride, and 1 mm phenylmethylsulfonyl). Cells were scraped on ice and incubated with rotation for 45 min at 4 °C and lysates were centrifuged at 4 °C for 20 min at 14,000 rpm in a microcentrifuge. Radioimmune precipitation assay-soluble proteins cells were incubated overnight at 4 °C with 30 μl of anti-FLAG M2-agarose beads. After three washes of 10 min in radioimmune precipitation assay buffer, immunoprecipitated proteins were eluted in Laemmli buffer for 15 min at 55 °C, resolved by SDS-PAGE, transferred to a nitrocellulose membrane, and detected by Western blotting. Confocal Microscopy in Living Cells—18 h after transfection, cells were split into collagen-coated 35-mm glass bottom dishes (MatTek, Ashland, MA). 14 h later, the medium was replaced with serum-free MEM and cells were starved for 5 h. Then HEK 293 cells were stimulated with 10 μm serotonin or 1 μm SB206553. Confocal microscopy was performed at 37 °C using a heated microscope stage at 100× magnification with a Zeiss laser-scanning microscope (LSM-510). Images were collected sequentially using single line excitation (488 nm) for GFP-labeled βarrestins or GFP-labeled 5-HT2cR. A double line excitation (488 and 568 nm) was used for detection of both GFP-tagged proteins and Texas Red-conjugated transferrin or βarr2-RedFP. For detection of both GFP- and YFP-tagged proteins a broad excitation spectra (488–590 nm) was applied, and a deconvolution process was used to discriminate the respective emission spectra. Sequestration Assays—Measurement of receptor surface expression by ELISA was performed under non-permeabilized conditions as follows. HEK 293 cells plated at a density of 3 × 106 per 100-mm dish were transfected or not with FLAG-5-HT2c receptor cDNA augmented with empty vector cDNA to a total or 7 μg using a calcium phosphate protocol (32.Barak L.S. Menard L. Ferguson S.S. Colapietro A.M. Caron M.G. Biochemistry. 1995; 34: 15407-15414Crossref PubMed Scopus (139) Google Scholar). The cells were trypsinized 18 h later and plated at a density of 125,000 cells per well in a 24-well plate and incubated in minimal essential media (MEM) containing 10% fetal bovine serum. After 48 h the cells were serum-starved for 5 h before treatment with 10 μm serotonin or 1 μm SB206553 with or without 5 μm brefeldin A. After 30 or 60 min at 37 °C in a 5% CO2 incubator the cells were washed once in ice-cold PBS and incubated in 1% bovine serum albumin in PBS for 30 min on ice. The cells were incubated on ice for 1 h with 4 μg/ml anti-FLAG M2-HRP antibody and wash three times with ice-cold 1% bovine serum albumin in PBS before being fixed in 3.7% paraformaldehyde in PBS for 15 min. The media was removed, and 750 μl of o-phenylenediamine dihydrochloride was added to each well. The reaction was stopped by 100 μl of HCl (3 n) before measurement of absorbance at 492 nm with a SmartSpec™ 3000 spectrophotometer (Bio-Rad Laboratories). Transferrin Uptake—Transferrin uptake was carried out as described previously (33.van Dam E.M. Stoorvogel W. Mol. Biol. Cell. 2002; 13: 169-182Crossref PubMed Scopus (178) Google Scholar). Briefly, HEK 293 transfected cells, grown on collagen-coated 35-mm glass bottom dishes, were staved for 5 h before transferrin treatment. Texas Red-conjugated transferrin was added to the cells at a final concentration of 35 μg/ml and incubated at 37 °C in a 5% CO2 incubator. After 30 min the living cells were washed twice with warm MEM containing 10 μm serotonin before microscopy observation at 37 °C. Statistical Analysis—Data are expressed as mean ± S.E. from the indicated number of independent experiments performed in triplicate. Statistical comparisons were performed using an unpaired Student's t test. Cellular Localization and Trafficking of 5-HT2cR GFP-tagged Isoforms—First we asked whether the RNA-editing process could affect the subcellular distribution of the three 5-HT2cR isoforms. For that purpose, the 5-HT2cR isoforms were tagged at the C terminus with the enhanced GFP and transiently expressed in HEK 293 cells. In the absence of agonist, the 5-HT2cR-VGV-GFP isoform was expressed exclusively at the cell surface (Fig. 1A). After 7 min of serotonin stimulation at a saturating concentration (10 μm), the 5-HT2cR-VGV-GFP isoform underwent internalization and was clearly detected in intracellular vesicles (Fig. 1A). In contrast to the VGV isoform, the 5-HT2cR-INI-GFP chimera was detected mainly in large intracellular vesicles, but a faint signal could also be observed at the plasma membrane in a majority of cells (Fig. 1C, left panel). The agonist-independent internalization observed here most probably reflects the constitutive activity of this isoform. Stimulation of the 5-HT2cR-INI-GFP with serotonin did not induce any noticeable variation of the vesicular distribution of this GFP-tagged isoform, suggesting that the agonist can induce no further internalization of this isoform (Fig. 1C, middle panel). However, after treatment with the 5-HT2cR inverse agonist SB206553 (34.Kennett G.A. Wood M.D. Bright F. Cilia J Piper D.C. Gager T. Thomas D. Baxter G.S. Forbes I.T. Ham P. Blackburn T.P. Br. J. Pharmacol. 1996; 117: 427-434Crossref PubMed Scopus (233) Google Scholar) (1 μm) for 30 min at 37 °C, the 5-HT2cR-INI-GFP was largely detected at the plasma membrane suggesting recycling of the receptor (Fig. 1C, right panel). With respect to the 5-HT2cR-VSV-GFP isoform, we observed a cellular distribution intermediate between the lowest and the highest constitutively active 5-HT2cR-GFP isoforms. This isoform was detected mainly at the plasma membrane and at a lower degree in intracellular vesicles. Moreover, in response to serotonin stimulation, it was further internalized, whereas treatment with inverse agonist enhanced its plasma membrane localization (Fig. 1B). Quantification of 5-HT2cR Isoform Cell Surface Expression—We next sought to quantify, by ELISA, the respective proportion of each N terminus FLAG-tagged 5-HT2cR isoforms internalized in the presence of agonist or recycled back to the plasma membrane in the presence of inverse agonist. First, we measured the cell surface expression of the FLAG-5-HT2cRVGV isoform transiently expressed in HEK 293 cells. After 30 min of 10 μm serotonin stimulation we observed a 38% decrease of FLAG-5-HT2cR-VGV cell surface expression (Fig. 2A). No significant variation of cell surface receptor expression was observed in cells treated with 1 μm SB206553 for 30 min. These findings suggest that the FLAG-5-HT2cR-VGV isoform was expressed at the cell surface and internalized upon agonist stimulation. We observed that the agonist and inverse agonist treatments for 30 min at 37 °C of cells expressing the FLAG-5-HT2cR-VSV resulted in a 29% decrease but a 1.8-fold increase of cell surface expression of this isoform respectively, suggesting that serotonin can induce internalization of cell surface receptors but that not all the receptors are expressed at the plasma membrane in the absence of stimulation (Fig. 2B). Regarding the cellular distribution of the FLAG-5-HT2cR-INI isoform transiently expressed in HEK 293 cells no significant agonist effects were observed (data not shown). Moreover, 30 and 60 min of 1 μm SB206553 exposure, resulted in a 2-fold and a 2.5-fold increase of cell surface receptor expression, respectively (Fig. 2C). These results suggest a dynamic recycling of intracellular receptor pools to the plasma membrane, and small differences of cell surface receptor detected between 30 and 60 min of inverse agonist treatment indicates that most of the internalized receptors were recycled back to the membrane after 30 min. Altogether, these findings confirm our cellular visualization data regarding the intracellular trafficking of the 5-HT2cR-GFP isoforms and indicate that RNA editing induces a progressive loss of constitutive endocytosis of the unedited 5-HT2cR isoform. Investigation of βarrestin Translocation to the 5-HT2cR Isoforms—Next we examined whether the 5-HT2cR could induce a cellular relocalization of βarrestins. To assess this hypothesis, we used HEK 293 cells transiently co-transfected with βarr2-GFP or βarr1-GFP chimeras and each of the three 5-HT2cRs isoforms. In cells expressing the 5-HT2cR-VGV isoform, which best responds to agonist, the βarr2-GFP was found in the cytosol. However, a slight punctated signal could still be detected at the plasma membrane indicating a minor degree of constitutive activity of this isoform and highlighting the sensitivity of the βarrestin translocation assay. After serotonin stimulation, the βarr2-GFP was recruited to the plasma membrane (Fig. 3A, upper panels). By contrast, in cells expressing the constitutively active 5-HT2cR-INI isoform, the βarr2-GFP was localized at the plasma membrane as well as on large vesicles, suggesting a constitutive βarr2 recruitment and receptor internalization (Fig. 3A, lower panels). As expected, stimulation of this isoform with serotonin did not promote any apparent changes in the βarr2-GFP distribution. In cells transiently transfected with the partially responsive 5-HT2cR-VSV isoform, the distribution of the βarr2-GFP was similar to that observed with the 5-HT2cR-INI isoform, but recruitment of the βarr2-GFP from the cytosol to the plasma membrane can be further enhanced in the presence of serotonin (Fig. 3A, middle panels). Interestingly, when either the 5-HT2cR-VSV or -INI isoform was expressed, βarr1-GFP was mostly distributed in the cytoplasm. Furthermore, under identical experimental conditions, βarr1-GFP did not appear to redistribute upon serotonin stimulation (Fig. 3B). Nevertheless, in some cells a faint punctated βarr1-GFP signal was detected at the plasma membrane, in the absence of agonist, regardless of the 5-HT2cR isoform expressed. Among the tested isoforms, the 5-HT2cR-VGV was the only one capable of inducing a slight βarr1-GFP translocation in response of agonist stimulation (Fig. 3B). Altogether, these results suggest that βarrestin2 is the predominantly interacting βarrestin with the 5-HT2cR isoforms. Characterization of 5-HT2cR-INI-containing Vesicles—To investigate whether the constitutively activated 5-HT2cR-INI isoform traffic with βarrestin, their relative cellular distributions were studied in HEK 293 cells by confocal fluorescence microscopy using a GFP-tagged 5-HT2cR-INI isoform and an Hc-Red-tagged βarr2. We observed that 5-HT2cR-INI-GFP and βarr2-HcRed fully co-localized in large vesicles in absence of agonist (Fig. 4A, upper panels). To ensure that this phenomenon was reflecting a continuous endocytosis-recycling cycle of the constitutively active receptor, we used Texas Red-labeled transferrin, which is well characterized as a marker for recycling compartments (35.Dautry-Varsat A. Biochimie. (Paris). 1986; 68: 375-381Crossref PubMed Scopus (158) Google Scholar, 36.Griffiths G. Hoflack B. Simons K. Mellman I. Kornfeld S. Cell. 1988; 52: 329-341Abstract Full Text PDF PubMed Scopus (589) Google Scholar). We observed that the βarr2-GFP as well as the 5-HT2cR-INI-GFP co-localized with transferrin-containing vesicles (Fig. 4, B and C). To identify the intracellular compartment containing the 5-HT2cR-INI, we compared the distribution pattern of the 5-HT2cR-INI-GFP and HA-tagged rab11a, a well established marker of the pericentriolar recycling endosome (37.Ullrich O. Reinsch S. Urbé S. Zerial M. Parton R.G. J. Cell Biol. 1996; 135: 913-924Crossref PubMed Scopus (1080) Google Scholar). We observed that most of the 5-HT2cR-INI-GFP co-localize with rabb11a in absence of stimulation (Fig. 5A). In addition this receptor also co-localized partially with the early endosome marker rab5-YFP (data not shown). Altogether, these data suggest that the 5-HT2cR-INI·βarr2 complexes are present in the same endosomal vesicles and that the 5-HT2cR-INI isoform undergoes constitutive endocytosis.Fig. 5Identification of the intracellular compartment containing the 5-HT2cR-INI isoform in HEK 293 cells. A, Confocal fluorescence micrographs of HEK 293 cells co-transfected with HA-tagged Rab11a (0.7 μg) (red, left panel) and the 5-HT2cR-INI-GFP (5 μg) (green, middle panel) in basal condition. The
Embryonic development and adult tissue homeostasis require precise information exchange between cells and their microenvironment to coordinate cell behavior. A specialized class of ultra-long actin-rich filopodia, termed cytonemes, provides one mechanism for this spatiotemporal regulation of extracellular cues. We provide here a mechanism whereby the stem-cell marker Lgr5, and its family member Lgr4, promote the formation of cytonemes. Lgr4- and Lgr5-induced cytonemes exceed lengths of 80 µm, are generated through stabilization of nascent filopodia from an underlying lamellipodial-like network and functionally provide a pipeline for the transit of signaling effectors. As proof-of-principle, we demonstrate that Lgr5-induced cytonemes act as conduits for cell signaling by demonstrating that the actin motor and filopodial cargo carrier protein myosin X (Myo10) and the G-protein-coupled receptor (GPCR) signaling effector β-arrestin-2 (Arrb2) transit into cytonemes. This work delineates a biological function for Lgr4 and Lgr5 and provides the rationale to fully investigate Lgr4 and Lgr5 function and cytonemes in mammalian stem cell and cancer stem cell behavior.
Le recepteur de l'hormone folliculo-stimulante (RFSH), exprime chez le mâle par les cellules de Sertoli, est un recepteur couple aux proteines G (GPCR). En presence de son agoniste, il perd rapidement sa capacite a activer son effecteur principal, l'adenylate cyclase. Les travaux menes sur des lignees cellulaires transfectees par le RFSH, ont montre que cette desensibilisation requiert la phosphorylation du recepteur occupe par son agoniste par les kinases specifiques des GPCRs, les GRKs. Cette phosphorylation provoque la liaison des beta-arrestines (β-arr) au RFSH, son decouplage avec la proteine G alphas et l'internalisation clathrine-dependante du complexe recepteur-ligand. Nous avons mis en evidence que le RFSH interagit de facon agoniste-dependante avec des GRKs deficientes pour leur activite kinase impliquant que le decouplage du RFSH pourrait resulter d'un encombrement sterique plutot que d'une phosphorylation. Nous avons etabli que la surexpression de chacune des GRKs 2, 3, 5 et 6 et β-arr1 et 2 decouple la reponse FSH en terme de production d'AMPc dans des cellules de Sertoli en culture primaire. De plus, la GRK2 et la β-arr1 endogenes sont recrutees sous stimulation vers les membranes, confirmant l'implication des GRKs et β-arr endogenes dans la modulation de la reponse FSH dans les cellules de Sertoli. Afin de preciser la cinetique des evenements nous avons suivi le trafic intracellulaire in situ du RFSH, des GRKs et β-arr. Le RFSH surexprime en cellules Cos7 est membranaire et la GRK2 et la β-arr1 sont cytosoliques. Apres 4 min. De stimulation FSH, le recepteur colocalise avec la GRK2 et la β-arr1. Apres 30 a 60 min. De stimulation le RFSH, la GRK2 et la β-arr1 sont concentres dans un compartiment peri-nucleaire, avant que le RFSH ne recycle vers la membrane selon un cycle long, alors que la GRK2 et la β-arr1 retrouvent une distribution cytosolique. Aucune colocalisation du RFSH avec la β-arr2 n'a ete observee dans la cinetique de stimulation etudiee.
Striatal dopamine D2 receptor (D2R) relies upon G protein- and β-arrestin-dependent signaling pathways to convey its action on motor control and behavior. Considering that D2R activation inhibits Akt in the striatum and that huntingtin physiological functions are affected by Akt phosphorylation, we sought to investigate whether D2R-mediated signaling could regulate huntingtin phosphorylation. We demonstrate that D2R activation decreases huntingtin phosphorylation on its Akt site. This dephosphorylation event depends upon the Gαi-dependent engagement of specific members of the protein phosphatase metallo-dependent (PPM/PP2C) family and is independent of β-arrestin 2. These observations identify the PPM/PP2C family as a mediator of G protein-coupled receptor signaling and thereby suggest a novel mechanism of dopaminergic signaling.
The highly homologous beta-arrestin1 and -2 adaptor proteins play important roles in the function of G protein-coupled receptors. Either beta-arrestin variant can function as a molecular chaperone for clathrin-mediated receptor internalization. This role depends primarily upon two distinct, contiguous C-terminal beta-arrestin motifs recognizing clathrin and the beta-adaptin subunit of AP2. However, a molecular basis is lacking to explain the different endocytic efficacies of the two beta-arrestin isoforms and the observation that beta-arrestin N-terminal substitution mutants can act as dominant negative inhibitors of receptor endocytosis. Despite the near identity of the beta-arrestins throughout their N termini, sequence variability is present at a small number of residues and includes tyrosine to phenylalanine substitutions. Here we show that corresponding N-terminal (Y/F)VTL sequences in beta-arrestin1 and -2 differentially regulate mu-adaptin binding. Our results indicate that the beta-arrestin1 Tyr-54 lessens the interaction with mu-adaptin and moreover is a Src phosphorylation site. A gain of endocytic function is obtained with the beta-arrestin1 Y54F substitution, which improves both the beta-arrestin1 interaction with mu-adaptin and the ability to enhance beta2-adrenergic receptor internalization. These data indicate that beta-arrestin2 utilizes mu-adaptin as an endocytic partner, and that the inability of beta-arrestin1 to sustain a similar degree of interaction with mu-adaptin may result from coordination of Tyr-54 by neighboring residues or its modification by Src kinase. Additionally, these naturally occurring variations in beta-arrestins may also differentially regulate the composition of the signaling complexes organized on the receptor.
'/%3e%3cpath id='l' d='M-26.25 0h52.5v-12h-40.5v-16h33v-12h-33v-11H25v-12h-51.25z'/%3e%3cpath id='k' d='M-31.5 0h12v-48l14 48h11l14-48V0h12v-70H14L0-22l-14-48h-17.5z'/%3e%3cpath id='b' fill-rule='evenodd' d='M0 0a31.5 35 0 0 0 0-70A31.5 35 0 0 0 0 0m0-13a18.5 22 0 0 0 0-44 18.5 22 0 0 0 0 44'/%3e%3cpath id='d' fill-rule='evenodd' d='M-31.5 0h13v-26h28a22 22 0 0 0 0-44h-40zm13-39h27a9 9 0 0 0 0-18h-27z'/%3e%3cpath id='n' d='M-15.75-22C-15.75-15-9-11.5 1-11.5s14.74-3.25 14.75-7.75c0-14.25-46.75-5.25-46.5-30.25C-30.5-71-6-70 3-70s26 4 25.75 21.25H13.5c0-7.5-7-10.25-15-10.25-7.75 0-13.25 1.25-13.25 8.5-.25 11.75 46.25 4 46.25 28.75C31.5-3.5 13.5 0 0 0c-11.5 0-31.55-4.5-31.5-22z'/%3e%3cuse xlink:href='%23a' id='o' transform='scale(31.5)'/%3e%3cuse xlink:href='%23a' id='p' transform='scale(26.25)'/%3e%3cuse xlink:href='%23a' id='r' transform='scale(21)'/%3e%3cuse xlink:href='%23a' id='q' transform='scale(15)'/%3e%3cuse xlink:href='%23a' id='s' transform='scale(10.5)'/%3e%3cg id='m'%3e%3cclipPath id='c'%3e%3cpath d='M-31.5 0v-70h63V0zM0-47v12h31.5v-12z'/%3e%3c/clipPath%3e%3cuse xlink:href='%23b' clip-path='url(%23c)'/%3e%3cpath d='M5-35h26.5v10H5z'/%3e%3cpath d='M21.5-35h10V0h-10z'/%3e%3c/g%3e%3cg id='h'%3e%3cuse xlink:href='%23d'/%3e%3cpath d='M28 0c0-10 0-32-15-32H-6c22 0 22 22 22 32'/%3e%3c/g%3e%3cg id='a' fill='%23fff'%3e%3cg id='f'%3e%3cpath id='e' d='M0-1v1h.5' transform='rotate(18 0 -1)'/%3e%3cuse xlink:href='%23e' transform='scale(-1 1)'/%3e%3c/g%3e%3cuse xlink:href='%23f' transform='rotate(72)'/%3e%3cuse xlink:href='%23f' transform='rotate(-72)'/%3e%3cuse xlink:href='%23f' transform='rotate(144)'/%3e%3cuse xlink:href='%23f' transform='rotate(216)'/%3e%3c/g%3e%3c/defs%3e%3crect width='100%25' height='100%25' x='-50%25' y='-50%25' fill='%23009b3a'/%3e%3cpath fill='%23fedf00' d='M-1743 0 0 1113 1743 0 0-1113z'/%3e%3ccircle r='735' fill='%23002776'/%3e%3cclipPath id='g'%3e%3ccircle r='735'/%3e%3c/clipPath%3e%3cpath fill='%23fff' d='M-2205 1470a1785 1785 0 0 1 3570 0h-105a1680 1680 0 1 0-3360 0z' clip-path='url(%23g)'/%3e%3cg fill='%23009b3a' transform='translate(-420 1470)'%3e%3cuse xlink:href='%23b' y='-1697.5' transform='rotate(-7)'/%3e%3cuse xlink:href='%23h' y='-1697.5' transform='rotate(-4)'/%3e%3cuse xlink:href='%23i' y='-1697.5' transform='rotate(-1)'/%3e%3cuse xlink:href='%23j' y='-1697.5' transform='rotate(2)'/%3e%3cuse xlink:href='%23k' y='-1697.5' transform='rotate(5)'/%3e%3cuse xlink:href='%23l' y='-1697.5' transform='rotate(9.75)'/%3e%3cuse xlink:href='%23d' y='-1697.5' transform='rotate(14.5)'/%3e%3cuse xlink:href='%23h' y='-1697.5' transform='rotate(17.5)'/%3e%3cuse xlink:href='%23b' y='-1697.5' transform='rotate(20.5)'/%3e%3cuse xlink:href='%23m' y='-1697.5' transform='rotate(23.5)'/%3e%3cuse xlink:href='%23h' y='-1697.5' transform='rotate(26.5)'/%3e%3cuse xlink:href='%23j' y='-1697.5' transform='rotate(29.5)'/%3e%3cuse xlink:href='%23n' y='-1697.5' transform='rotate(32.5)'/%3e%3cuse xlink:href='%23n' y='-1697.5' transform='rotate(35.5)'/%3e%3cuse xlink:href='%23b' y='-1697.5' transform='rotate(38.5)'/%3e%3c/g%3e%3cuse xlink:href='%23o' x='-600' y='-132'/%3e%3cuse xlink:href='%23o' x='-535' y='177'/%3e%3cuse xlink:href='%23p' x='-625' y='243'/%3e%3cuse xlink:href='%23q' x='-463' y='132'/%3e%3cuse xlink:href='%23p' x='-382' y='250'/%3e%3cuse xlink:href='%23r' x='-404' y='323'/%3e%3cuse xlink:href='%23o' x='228' y='-228'/%3e%3cuse xlink:href='%23o' x='515' y='258'/%3e%3cuse xlink:href='%23r' x='617' y='265'/%3e%3cuse xlink:href='%23p' x='545' y='323'/%3e%3cuse xlink:href='%23p' x='368' y='477'/%3e%3cuse xlink:href='%23r' x='367' y='551'/%3e%3cuse xlink:href='%23r' x='441' y='419'/%3e%3cuse xlink:href='%23p' x='500' y='382'/%3e%3cuse xlink:href='%23r' x='365' y='405'/%3e%3cuse xlink:href='%23p' x='-280' y='30'/%3e%3cuse xlink:href='%23r' x='200' y='-37'/%3e%3cuse xlink:href='%23o' y='330'/%3e%3cuse xlink:href='%23p' x='85' y='184'/%3e%3cuse xlink:href='%23p' y='118'/%3e%3cuse xlink:href='%23r' x='-74' y='184'/%3e%3cuse xlink:href='%23q' x='-37' y='235'/%3e%3cuse xlink:href='%23p' x='220' y='495'/%3e%3cuse xlink:href='%23r' x='283' y='430'/%3e%3cuse xlink:href='%23r' x='162' y='412'/%3e%3cuse xlink:href='%23o' x='-295' y='390'/%3e%3cuse xlink:href='%23s' y='575'/%3e%3c/svg%3e)
'/%3e%3cpath d='m450 224.315-44.467 136.87 116.401-84.559h-143.87l116.403 84.559z' style='fill:none;stroke:%23006233;stroke-width:14.62993431;stroke-miterlimit:4;stroke-dasharray:none'/%3e%3c/svg%3e)