Tatsuya Nagata

Universidade de Brasília

Author Statistics

Papers

Citation

H-Index

i-10 index

Research Trends

Author Order

Document Type

Co-Authors

Alice K. Inoue‐Nagata

Brazilian Agricultural Research Corporation

Renato O. Resende

Universidade de Brasília

Rosana Blawid

Universidade Federal Rural de Pernambuco

João Marcos Fagundes Silva

Institute for Integrative Systems Biology

Elliot Watanabe Kitajima

Universidade de São Paulo

Fernando L. Melo

Universidade de Brasília

A. C. de Ávila

Brazilian Agricultural Research Corporation

Bergmann Morais Ribeiro

Universidade de Brasília

Jorge Alberto Marques Rezende

Universidade de São Paulo

Caterynne Melo Kauffmann

Universidade de Brasília

Cooperative Institutions

Universidade de Brasília

160

Brazilian Agricultural Research Corporation

109

Universidade de São Paulo

Nippon Dental University

The University of Tokyo

Hitachi (Japan)

Universidade Federal de Goiás

Universidade Federal de Viçosa

Universidade Católica de Brasília

British Society of Periodontology

Author Statistics

Papers

Citation

H-Index

i-10 index

Research Field

TSC due to space charge in polyvinylidene fluoride

Journal of Physics D Applied Physics (1984)

T. Mizutani Tatsuya Nagata Masayuki Ieda

The unstretched, alpha -form polyvinylidene fluoride (PVDF) film shows the four TSC peaks, P1, P2, P3 and P4 in ascending order of temperature. The P1 and P2 peaks are due to the dipolar depolarisations associated with the alpha a and alpha c relaxations, respectively. The TSC spectrum in each film composing a three-layer specimen gave evidence for the P3 and P4 peaks originating from space charge near the anode. Besides, the use of a blocking PP electrode revealed the contribution of hole injection to the current in PVDF under the application of high field and also the contribution of injected positive space charge to the P3 and P4 peaks.

Polyvinylidene fluoride

10.1088/0022-3727/17/9/013

Cite

Citations (31)

Field test result of 10MVA/20MJ SMES for load fluctuation compensation : Power Supply System

低温工学・超電導学会講演概要集 = Meetings of Cryogenics and Superconductivity (2007)

Shigeo Nagaya Tatsuya Nagata N. Hirano Taketoshi Noda Toshio Katagiri

Source

Cite

Citations (0)

Biological and molecular characterization of isolates of catharanthus mosaic virus infecting Mandevilla sp.

Tropical Plant Pathology (2020)

Gabriel Madoglio Favara Viviana M. Camelo-García João Marcos Fagundes Silva Talita N. Z. Silva Tatiana Mituti

Myzus persicae

Catharanthus roseus

10.1007/s40858-020-00346-9

Cite

Citations (3)

First Report of Grapevine Associated Jivivirus 1 Infecting Grapevines in Brazil

Plant Disease (2020)

João Marcos Fagundes Silva T. V. M. Fajardo Maher Al Rwahnih Tatsuya Nagata

Grapevines can host up to 86 virus species, some of which affect plant vigor, production and fruit quality (Fuchs, 2020). In 2014, a Vitis vinifera cv. Semillon vine showing yellow speckles and mild leafroll symptoms in Bento Gonçalves, RS, Brazil, was investigated for viruses (Silva et al., 2017), resulting in the detection of grapevine enamovirus 1, grapevine yellow speckle viroid 1 and hop stunt viroid. Total nucleic acids (TNA) extracts from this sample were enriched for dsRNA (Valverde et al., 1990), prepped with TruSeq Stranded mRNA kit (Illumina, USA), then subjected to high throughput sequencing (HTS) on the Illumina HiSeq 2000 platform. The HTS yielded 13,214 Mbp raw reads, which were trimmed and the host derived sequences subtracted with Trimmomatic and Burrows-Wheeler Aligner softwares, respectively. The remaining reads were subjected to taxonomic assignment with the Kaiju webserver, preliminarily indicating 26 reads related to citrus virga-like virus (Matsumura et al., 2017). De novo assembled contigs built by SPAdes generated five contigs that were subjected to tBLASTx searches against the NCBI viral RefSeq. Four sets of primers were designed to sequence the gaps between these contigs and the PCR amplicons were sequenced by Sanger method resulting in two long contigs. A third long contig related to citrus jingmen-like virus (Matsumura et al., 2017) was also retained for further analysis. BLASTn analyses of the assembled virus contigs showed that they are closely related to grapevine associated jivivirus 1 (GaJV-1) (Chiapello et al, 2020). The derived partial tripartite genomic sequences of GaJV-1 isolate SEM-BR from Brazil (GenBank acc. nos. MT657278-MT657280) covered 84.4% (3424 nt), 40.3% (1289 nt) and 73% (1555 nt) of RNAs 1, 2 and 3 of isolate DMG 109 from Italy (MN520745-MN520747), respectively. The pairwise nt sequence identities between both isolates were 99.3% (RNA1), 97.1% (RNA2) and 100% (RNA3), indicating that they are highly identical to each other. To confirm the HTS results, fresh TNA extracts from SEM-BR and four newly sampled vines were screened by RT-PCR using specific primers F (5'GGACGAAGTCACAACCAACACAGTTT3') and R (5'CGCGAGTAGGTCTGACAACTTTCATTAT3'), designed based on GaJV-1 RNA1. The resulting 478 bp amplicons were sequenced (MT657281-MT657285) and found to share 99.4%-99.8% nt identities with the corresponding sequences of GaJV-1 SEM-BR (MT657278). To assess graft-transmissibility of GaJV-1, Semillon scions of SEM-BR source vine were grafted onto 14 GaJV-1-free 1103P rootstocks. Six of 14 recipient plants (all asymptomatic) tested positive for GaJV-1 by RT-PCR 106 days after grafting. Additionally, RT-PCR screening of a Brazilian grapevine collection block resulted in the detection of GaJV-1 in nine of 33 tested vines of different accessions (27.3%). The GaJV-1 positive vines included eight commercial cultivars (Ancelotta, Aragonez, Merlot, Semillon, Michele Palieri, Malvasia, Viognier, and Pinot Nero). This is the first report of GaJV-1 in Brazil, a virus that was recently described in Italy and Spain (Chiapello et al, 2020). Our results also demonstrated the graft-transmissible nature of the virus but it is unclear if GaJV-1 is associated to grapevine plant cells or strictly to a possible grapevine fungal endophyte. Additional studies on the GaJV-1 prevalence in commercial vineyards in Brazil and possible effects of the virus on grapevines are necessary. References: Chiapello, M., et al. 2020. Annals of Applied Biology 176:180. https://doi.org/10.1111/aab.12563 Fuchs, M. 2020. J. Plant Pathol. https://doi.org/10.1007/s42161-020-00579-2 Matsumura, E.E., et al. 2017. Viruses 9:92. https://doi.org/10.3390/v9040092 Silva, J.M.F., et al. 2017. Virus Genes 53:667. https://doi.org/10.1007/s11262-017-1470-y Valverde, R.A., et al. 1990. Plant Dis. 74:255. https://www.apsnet.org/publications/plantdisease/backissues/Documents/1990Articles/PlantDisease74n03_255.PDF.

Sanger sequencing

Amplicon

Sequence assembly

RefSeq

10.1094/pdis-08-20-1689-pdn

Cite

Citations (5)

Survival and death-promoting events after transient spinal cord ischemia in rabbits: Induction of Akt and caspase3 in motor neurons

Journal of Thoracic and Cardiovascular Surgery (2003)

Masahiro Sakurai Tatsuya Nagata Koji Abe Takashi Horinouchi Yasuto Itoyama

10.1067/mtc.2003.112

Cite

Citations (89)

Factors determining vector competence and specificity for transmission of Tomato spotted wilt virus

Journal of General Virology (2002)

Tatsuya Nagata Alice K. Inoue‐Nagata J.W.M. van Lent Rob Goldbach Dick Peters

The competence of a Frankliniella occidentalis and a Thrips tabaci population to transmit Tomato spotted wilt virus (TSWV) was analysed. Adults of the F. occidentalis population transmitted this virus efficiently, whereas those of the thelytokous T. tabaci population failed to transmit. TSWV replicated in the midgut of the larvae of both populations after ingestion of virus; however, lower amounts accumulated in T. tabaci larvae than in F. occidentalis larvae. The virus was almost undetectable in T. tabaci adults, whereas high titres were readily detected in the F. occidentalis adults. The first infections in F. occidentalis larvae were detected by immunocytochemical studies in midgut epithelial and subsequently in midgut muscle cells, the ligaments, and finally in the salivary glands. The infections were weaker in the midgut epithelial and muscle cells of T. tabaci larvae, followed by an almost complete absence of any infection in the ligaments, and a complete absence in the salivary glands. Studies by electron microscopy revealed the budding of some virus particles from the basal membrane of midgut epithelial cells of F. occidentalis larvae into the extracellular space of the basal labyrinth. Enveloped virus particles were also seen in midgut muscle cells of F. occidentalis larvae. They were not discerned in epithelial and muscle cells of T. tabaci larvae and adults. This study showed that the rate of virus replication in the midgut and the extent of virus migration from the midgut to the visceral muscle cells and the salivary glands are probably crucial factors in the determination of vector competence.

10.1099/0022-1317-83-3-663

Cite

Citations (87)

Preparation of Imide-modified Benzoxazines and Characterization of Cured Films

Journal of Photopolymer Science and Technology (2015)

Tatsuya Nagata Kosaku Kurowarabi Takehiro Kawauchi Akihiko Matsumoto Nobuyuki Furukawa

We synthesized novel monofunctional and bifunctional benzoxazines having imide groups. Brown-colored transparent films were obtained by curing the benzoxazines up to 240 °C. Monofunctional benzoxazine gave brittle film, but bifunctional benzoxazine gave tough film. Viscoelastic analysis revealed that glass transition temperature of the polybenzoxazine film obtained from the bifunctional benzoxazine was 289 °C, about 90 °C higher than that of a typical polybenzoxazine. Thermogravimetric analyses revealed that the introduction of imide groups was also effective to improve the thermal stability of polybenzoxazines.

Thermogravimetric analysis

Imide

Thermal Stability

10.2494/photopolymer.28.145

Cite

Citations (5)

New features on the genomic organization of a novel dicistrovirus identified from the sweet potato whitefly Bemisia tabaci

Virus Research (2020)

Marcio Hedil Erich Y. T. Nakasu Tatsuya Nagata Jing Wen Eric Jan

ORFS

Intergenic region

Whitefly