Ischemic stroke is one of the leading causes of morbidity and mortality. Treatment options are limited and only a minority of patients receive acute interventions. Understanding the mechanisms that mediate neuronal injury and death may identify targets for neuroprotective treatments. Here we show that the aberrant activity of the protein kinase Cdk5 is a principal cause of neuronal death in rodents during stroke. Ischemia induced either by embolic middle cerebral artery occlusion (MCAO) in vivo or by oxygen and glucose deprivation in brain slices caused calpain-dependent conversion of the Cdk5-activating cofactor p35 to p25. Inhibition of aberrant Cdk5 during ischemia protected dopamine neurotransmission, maintained field potentials, and blocked excitotoxicity. Furthermore, pharmacological inhibition or conditional knock-out (CKO) of Cdk5 prevented neuronal death in response to ischemia. Moreover, Cdk5 CKO dramatically reduced infarctions following MCAO. Thus, targeting aberrant Cdk5 activity may serve as an effective treatment for stroke.
Motor learning and neuro-adaptations to drugs of abuse rely upon neuronal signaling in the striatum. Cyclin-dependent kinase 5 (Cdk5) regulates striatal dopamine neurotransmission and behavioral responses to cocaine. Although the role for Cdk5 in neurodegeneration in the cortex and hippocampus and in hippocampal-dependent learning has been demonstrated, its dysregulation in the striatum has not been examined. Here we show that strong activation of striatal NMDA receptors produced p25, the truncated form of the Cdk5 co-activator p35. Furthermore, inducible overexpression of p25 in the striatum prevented locomotor sensitization to cocaine and attenuated motor coordination and learning. This corresponded with reduced dendritic spine density, increased neuro-inflammation, altered dopamine signaling, and shifted Cdk5 specificity with regard to physiological and aberrant substrates, but no apparent loss of striatal neurons. Thus, dysregulation of Cdk5 dramatically affects striatal-dependent brain function and may be relevant to non-neurodegenerative disorders involving dopamine neurotransmission.
Abstract Regulation of cytoskeletal dynamics is essential to neuronal plasticity during development and adulthood. Dysregulation of these mechanisms may contribute to neuropsychiatric and neurodegenerative diseases. The neuronal protein kinase, cyclin‐dependent kinase 5 (Cdk5), is involved in multiple aspects of neuronal function, including regulation of cytoskeleton. A neuroproteomic search identified the tubulin‐binding protein, stathmin, as a novel Cdk5 substrate. Stathmin was phosphorylated by Cdk5 in vitro at Ser25 and Ser38, previously identified as mitogen‐activated protein kinase (MAPK) and p38 MAPKδ sites. Cdk5 predominantly phosphorylated Ser38, while MAPK and p38 MAPKδ predominantly phosphorylated Ser25. Stathmin was phosphorylated at both sites in mouse brain, with higher levels in cortex and striatum. Cdk5 knockout mice exhibited decreased phospho‐Ser38 levels. During development, phospho‐Ser25 and ‐Ser38 levels peaked at post‐natal day 7, followed by reduction in total stathmin. Inhibition of protein phosphatases in striatal slices caused an increase in phospho‐Ser25 and a decrease in total stathmin. Interestingly, the prefrontal cortex of schizophrenic patients had increased phospho‐Ser25 levels. In contrast, total and phospho‐Ser25 stoichiometries were decreased in the hippocampus of Alzheimer's patients. Thus, microtubule regulatory mechanisms involving the phosphorylation of stathmin may contribute to developmental synaptic pruning and structural plasticity, and may be involved in neuropsychiatric and neurodegenerative disorders.
The molecular factors regulating adult neurogenesis must be understood to harness the therapeutic potential of neuronal stem cells. Although cyclin-dependent kinase 5 (Cdk5) plays a critical role in embryonic corticogenesis, its function in adult neurogenesis is unknown. Here, we assessed the role of Cdk5 in the generation of dentate gyrus (DG) granule cell neurons in adult mice. Cre recombinase-mediated conditional knockout (KO) of Cdk5 from stem cells and their progeny in the DG subgranular zone (SGZ) prevented maturation of new neurons. In addition, selective KO of Cdk5 from mature neurons throughout the hippocampus reduced the number of immature neurons. Furthermore, Cdk5 gene deletion specifically from DG granule neurons via viral-mediated gene transfer also resulted in fewer immature neurons. In each case, the total number of proliferating cells was unaffected, indicating that Cdk5 is necessary for progression of adult-generated neurons to maturity. This role for Cdk5 in neurogenesis was activating-cofactor specific, as p35 KO but not p39 KO mice also had fewer immature neurons. Thus, Cdk5 has an essential role in the survival, but not proliferation, of adult-generated hippocampal neurons through both cell-intrinsic and cell-extrinsic mechanisms.
Cyclin-dependent kinase 5 (Cdk5) regulates dopamine neurotransmission and has been suggested to serve as a homeostatic target of chronic psychostimulant exposure. To study the role of Cdk5 in the modulation of the cellular and behavioral effects of psychoactive drugs of abuse, we developed Cre/loxP conditional knock-out systems that allow temporal and spatial control of Cdk5 expression in the adult brain. Here, we report the generation of Cdk5 conditional knock-out (cKO) mice using the alphaCaMKII promoter-driven Cre transgenic line (CaMKII-Cre). In this model system, loss of Cdk5 in the adult forebrain increased the psychomotor-activating effects of cocaine. Additionally, these CaMKII-Cre Cdk5 cKO mice show enhanced incentive motivation for food as assessed by instrumental responding on a progressive ratio schedule of reinforcement. Behavioral changes were accompanied by increased excitability of medium spiny neurons in the nucleus accumbens (NAc) in Cdk5 cKO mice. To study NAc-specific effects of Cdk5, another model system was used in which recombinant adeno-associated viruses expressing Cre recombinase caused restricted loss of Cdk5 in NAc neurons. Targeted knock-out of Cdk5 in the NAc facilitated cocaine-induced locomotor sensitization and conditioned place preference for cocaine. These results suggest that Cdk5 acts as a negative regulator of neuronal excitability in the NAc and that Cdk5 may govern the behavioral effects of cocaine and motivation for reinforcement.
Inhibitor-1, the first identified endogenous inhibitor of protein phosphatase 1 (PP-1), was previously reported to be a substrate for cyclin-dependent kinase 5 (Cdk5) at Ser67. Further investigation has revealed the presence of an additional Cdk5 site identified by mass spectrometry and confirmed by site-directed mutagenesis as Ser6. Basal levels of phospho-Ser6 inhibitor-1, as detected by a phosphorylation state-specific antibody against the site, existed in specific regions of the brain and varied with age. In the striatum, basal in vivo phosphorylation and dephosphorylation of Ser6 were mediated by Cdk5, PP-2A, and PP-1, respectively. Additionally, calcineurin contributed to dephosphorylation under conditions of high Ca2+. In biochemical assays the function of Cdk5-dependent phosphorylation of inhibitor-1 at Ser6 and Ser67 was demonstrated to be an intramolecular impairment of the ability of inhibitor-1 to be dephosphorylated at Thr35; this effect was recapitulated in two systems in vivo. Dephosphorylation of inhibitor-1 at Thr35 is equivalent to inactivation of the protein, as inhibitor-1 only serves as an inhibitor of PP-1 when phosphorylated by cAMP-dependent kinase (PKA) at Thr35. Thus, inhibitor-1 serves as a critical junction between kinase- and phosphatase-signaling pathways, linking PP-1 to not only PKA and calcineurin but also Cdk5. Inhibitor-1, the first identified endogenous inhibitor of protein phosphatase 1 (PP-1), was previously reported to be a substrate for cyclin-dependent kinase 5 (Cdk5) at Ser67. Further investigation has revealed the presence of an additional Cdk5 site identified by mass spectrometry and confirmed by site-directed mutagenesis as Ser6. Basal levels of phospho-Ser6 inhibitor-1, as detected by a phosphorylation state-specific antibody against the site, existed in specific regions of the brain and varied with age. In the striatum, basal in vivo phosphorylation and dephosphorylation of Ser6 were mediated by Cdk5, PP-2A, and PP-1, respectively. Additionally, calcineurin contributed to dephosphorylation under conditions of high Ca2+. In biochemical assays the function of Cdk5-dependent phosphorylation of inhibitor-1 at Ser6 and Ser67 was demonstrated to be an intramolecular impairment of the ability of inhibitor-1 to be dephosphorylated at Thr35; this effect was recapitulated in two systems in vivo. Dephosphorylation of inhibitor-1 at Thr35 is equivalent to inactivation of the protein, as inhibitor-1 only serves as an inhibitor of PP-1 when phosphorylated by cAMP-dependent kinase (PKA) at Thr35. Thus, inhibitor-1 serves as a critical junction between kinase- and phosphatase-signaling pathways, linking PP-1 to not only PKA and calcineurin but also Cdk5. Phosphatases are now recognized as important players in processes ranging from muscle contraction to synaptic plasticity. Protein phosphatase inhibitor-1, or simply inhibitor-1 (I-1), 2The abbreviations used are: I-1, (protein phosphatase) inhibitor-1; PP, protein phosphatase; PKA, cAMP-dependent protein kinase; Cdk, cyclin-dependent kinase; NMDA, N-methyl-d-aspartate; DARPP-32, dopamine- and cAMP-regulated phosphoprotein, Mr 32,000; MAPK, mitogen-activated protein kinase; MALDI-TOF MS, matrix-assisted laser desorption ionization time-of-flight mass spectrometry; HPLC, high-performance liquid chromatography. was identified from rabbit skeletal muscle in 1976 as an inhibitor of protein phosphatase 1 (PP-1) and a regulator of glycogen metabolism (1.Huang F.L. Glinsmann W.H. Eur. J. Biochem. 1976; 70: 419-426Crossref PubMed Scopus (309) Google Scholar). In recent years, interest in the protein has focused on its role in heart failure and neuronal plasticity. In the brain, inhibitor-1 can be found in many areas including the olfactory bulb, neostriatum, cerebral cortex, and the dentate gyrus of the hippocampus. The level of inhibitor-1 in the rest of the hippocampus is a matter of some debate; reports range from little or none to moderate amounts (2.Allen P.B. Hvalby O. Jensen V. Errington M.L. Ramsay M. Chaudhry F.A. Bliss T.V. Storm-Mathisen J. Morris R.G. Andersen P. Greengard P. J. Neurosci. 2000; 20: 3537-3543Crossref PubMed Google Scholar, 3.Barbas H. Gustafson E.L. Greengard P. J. Comp. Neurol. 1993; 334: 1-18Crossref PubMed Scopus (27) Google Scholar, 4.Gustafson E.L. Girault J.A. Hemmings Jr., H.C. Nairn A.C. Greengard P. J. Comp. Neurol. 1991; 310: 170-188Crossref PubMed Scopus (43) Google Scholar, 5.Lowenstein P.R. Shering A.F. MacDougall L.K. Cohen P. Brain Res. 1995; 676: 80-92Crossref PubMed Scopus (11) Google Scholar, 6.Sakagami H. Ebina K. Kondo H. Brain Res. Mol. Brain Res. 1994; 25: 7-18Crossref PubMed Scopus (35) Google Scholar). Inhibitor-1 is a heat-stable 19-kDa protein that possesses little ordered structure and a preponderance of glutamic acid and proline in its amino acid sequence (7.Nimmo G.A. Cohen P. Eur. J. Biochem. 1978; 87: 341-351Crossref PubMed Scopus (209) Google Scholar). As a regulator of one of the three major serine/threonine phosphatases in mammalian cells that can itself be regulated by a major kinase, inhibitor-1 occupies an important position in neuronal signal transduction cascades. Only when phosphorylated by cAMP-dependent protein kinase (PKA) at Thr35 does inhibitor-1 become a potent (IC50 = 1nm) and selective inhibitor of PP-1 (1.Huang F.L. Glinsmann W.H. Eur. J. Biochem. 1976; 70: 419-426Crossref PubMed Scopus (309) Google Scholar, 8.Foulkes J.G. Strada S.J. Henderson P.J. Cohen P. Eur. J. Biochem. 1983; 132: 309-313Crossref PubMed Scopus (56) Google Scholar, 9.Endo S. Zhou X. Connor J. Wang B. Shenolikar S. Biochemistry (Mosc.). 1996; 35: 5220-5228Crossref Scopus (150) Google Scholar). Through its action on inhibitor-1, PKA can amplify cAMP signals by preventing the dephosphorylation of sites it shares with PP-1. That calcineurin (PP-2B, or Ca2+/calmodulin-dependent protein phosphatase) can inactivate I-1 by dephosphorylating the PKA site (10.Cohen P. Annu. Rev. Biochem. 1989; 58: 453-508Crossref PubMed Scopus (2161) Google Scholar, 11.Mulkey R.M. Endo S. Shenolikar S. Malenka R.C. Nature. 1994; 369: 486-488Crossref PubMed Scopus (907) Google Scholar, 12.Shenolikar S. Nairn A.C. Adv. Second Messenger Phospho-protein Res. 1991; 23: 1-121PubMed Google Scholar) provides an added layer of complexity, as well as a point of integration for cAMP- and Ca2+-dependent second messenger systems. The ability of inhibitor-1 to link the actions of PKA and calcineurin to PP-1 has allowed it to occupy a central position in molecular models of synaptic plasticity. In 2001, inhibitor-1 was found to be phosphorylated at another residue (Ser67) by cyclin-dependent kinase 5 (Cdk5) (13.Bibb J.A. Nishi A. O'Callaghan J.P. Ule J. Lan M. Snyder G.L. Horiuchi A. Saito T. Hisanaga S. Czernik A.J. Nairn A.C. Greengard P. J. Biol. Chem. 2001; 276: 14490-14497Abstract Full Text Full Text PDF PubMed Scopus (79) Google Scholar), a proline-directed serine/threonine kinase. This phosphorylation did not have an effect on the ability of phospho-Thr35 inhibitor-1 to inhibit PP-1 and had only a mild effect on the ability of PKA to phosphorylate inhibitor-1 at Thr35. Despite its name, Cdk5 is not cyclin-dependent. Furthermore, unlike all other cyclin-dependent kinases, Cdk5 is most active in postmitotic neurons because of its requirement for the relatively neuron-specific cofactor, p35 (14.Lew J. Huang Q.Q. Qi Z. Winkfein R.J. Aebersold R. Hunt T. Wang J.H. Nature. 1994; 371: 423-426Crossref PubMed Scopus (540) Google Scholar, 15.Tsai L.H. Delalle I. Caviness Jr., V.S. Chae T. Harlow E. Nature. 1994; 371: 419-423Crossref PubMed Scopus (813) Google Scholar), or its homologue, p39 (16.Tang D. Yeung J. Lee K.Y. Matsushita M. Matsui H. Tomizawa K. Hatase O. Wang J.H. J. Biol. Chem. 1995; 270: 26897-26903Abstract Full Text Full Text PDF PubMed Scopus (297) Google Scholar, 17.Tang D. Wang J.H. Prog. Cell Cycle Res. 1996; 2: 205-216Crossref PubMed Scopus (75) Google Scholar). Although early studies focused on its ability to hyperphosphorylate tau and its relationship to Alzheimer disease (18.Baumann K. Mandelkow E.M. Biernat J. Piwnica-Worms H. Mandelkow E. FEBS Lett. 1993; 336: 417-424Crossref PubMed Scopus (425) Google Scholar), Cdk5 now boasts an extensive list of substrates, including N-methyl-d-aspartate (NMDA) receptor (19.Li B.S. Sun M.K. Zhang L. Takahashi S. Ma W. Vinade L. Kulkarni A.B. Brady R.O. Pant H.C. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 12742-12747Crossref PubMed Scopus (227) Google Scholar), postsynaptic density, Mr 95,000 (PSD-95) (20.Morabito M.A. Sheng M. Tsai L.H. J. Neurosci. 2004; 24: 865-876Crossref PubMed Scopus (188) Google Scholar), meiosis-specific kinase 1 (MEK1) (21.Sharma P. Veeranna Sharma M. Amin N.D. Sihag R.K. Grant P. Ahn N. Kulkarni A.B. Pant H.C. J. Biol. Chem. 2002; 277: 528-534Abstract Full Text Full Text PDF PubMed Scopus (135) Google Scholar), c-Jun N-terminal kinase 3 (JNK3) (22.Li B.S. Zhang L. Takahashi S. Ma W. Jaffe H. Kulkarni A.B. Pant H.C. EMBO J. 2002; 21: 324-333Crossref PubMed Scopus (122) Google Scholar), P/Q-type voltage-gated Ca2+ channel (23.Tomizawa K. Ohta J. Matsushita M. Moriwaki A. Li S.T. Takei K. Matsui H. J. Neurosci. 2002; 22: 2590-2597Crossref PubMed Google Scholar), synapsin I (24.Matsubara M. Kusubata M. Ishiguro K. Uchida T. Titani K. Taniguchi H. J. Biol. Chem. 1996; 271: 21108-21113Abstract Full Text Full Text PDF PubMed Scopus (213) Google Scholar), mammalian unc-18 (Munc18) (25.Fletcher A.I. Shuang R. Giovannucci D.R. Zhang L. Bittner M.A. Stuenkel E.L. J. Biol. Chem. 1999; 274: 4027-4035Abstract Full Text Full Text PDF PubMed Scopus (172) Google Scholar, 26.Shuang R. Zhang L. Fletcher A. Groblewski G.E. Pevsner J. Stuenkel E.L. J. Biol. Chem. 1998; 273: 4957-4966Abstract Full Text Full Text PDF PubMed Scopus (143) Google Scholar), amphiphysin I (27.Floyd S.R. Porro E.B. Slepnev V.I. Ochoa G.C. Tsai L.H. De Camilli P. J. Biol. Chem. 2001; 276: 8104-8110Abstract Full Text Full Text PDF PubMed Scopus (114) Google Scholar, 28.Nguyen C. Bibb J.A. J. Cell Biol. 2003; 163: 697-699Crossref PubMed Scopus (37) Google Scholar, 29.Tan T.C. Valova V.A. Malladi C.S. Graham M.E. Berven L.A. Jupp O.J. Hansra G. McClure S.J. Sarcevic B. Boadle R.A. Larsen M.R. Cousin M.A. Robinson P.J. Nat. Cell Biol. 2003; 5: 701-710Crossref PubMed Scopus (256) Google Scholar, 30.Tomizawa K. Sunada S. Lu Y.F. Oda Y. Kinuta M. Ohshima T. Saito T. Wei F.Y. Matsushita M. Li S.T. Tsutsui K. Hisanaga S. Mikoshiba K. Takei K. Matsui H. J. Cell Biol. 2003; 163: 813-824Crossref PubMed Scopus (161) Google Scholar), dynamin I (28.Nguyen C. Bibb J.A. J. Cell Biol. 2003; 163: 697-699Crossref PubMed Scopus (37) Google Scholar, 29.Tan T.C. Valova V.A. Malladi C.S. Graham M.E. Berven L.A. Jupp O.J. Hansra G. McClure S.J. Sarcevic B. Boadle R.A. Larsen M.R. Cousin M.A. Robinson P.J. Nat. Cell Biol. 2003; 5: 701-710Crossref PubMed Scopus (256) Google Scholar, 30.Tomizawa K. Sunada S. Lu Y.F. Oda Y. Kinuta M. Ohshima T. Saito T. Wei F.Y. Matsushita M. Li S.T. Tsutsui K. Hisanaga S. Mikoshiba K. Takei K. Matsui H. J. Cell Biol. 2003; 163: 813-824Crossref PubMed Scopus (161) Google Scholar), microtubule-associated protein 1B (MAP1B) (31.Paglini G. Pigino G. Kunda P. Morfini G. Maccioni R. Quiroga S. Ferreira A. Caceres A. J. Neurosci. 1998; 18: 9858-9869Crossref PubMed Google Scholar, 32.Pigino G. Paglini G. Ulloa L. Avila J. Caceres A. J. Cell Sci. 1997; 110: 257-270Crossref PubMed Google Scholar), β-catenin (33.Kesavapany S. Lau K.F. McLoughlin D.M. Brownlees J. Ackerley S. Leigh P.N. Shaw C.E. Miller C.C. Eur. J. Neurosci. 2001; 13: 241-247PubMed Google Scholar, 34.Kwon Y.T. Gupta A. Zhou Y. Nikolic M. Tsai L.H. Curr. Biol. 2000; 10: 363-372Abstract Full Text Full Text PDF PubMed Scopus (156) Google Scholar), focal adhesion kinase (FAK) (35.Xie Z. Sanada K. Samuels B.A. Shih H. Tsai L.H. Cell. 2003; 114: 469-482Abstract Full Text Full Text PDF PubMed Scopus (261) Google Scholar), stathmin (36.Hayashi K. Pan Y. Shu H. Ohshima T. Kansy J.W. White III, C.L. Tamminga C.A. Sobel A. Curmi P.A. Mikoshiba K. Bibb J.A. J. Neurochem. 2006; 99: 237-250Crossref PubMed Scopus (45) Google Scholar), tyrosine hydroxylase (37.Kansy J.W. Daubner S.C. Nishi A. Sotogaku N. Lloyd M.D. Nguyen C. Lu L. Haycock J.W. Hope B.T. Fitzpatrick P.F. Bibb J.A. J. Neurochem. 2004; 91: 374-384Crossref PubMed Scopus (45) Google Scholar, 38.Moy L.Y. Tsai L.H. J. Biol. Chem. 2004; 279: 54487-54493Abstract Full Text Full Text PDF PubMed Scopus (65) Google Scholar), and DARPP-32 (dopamine- and cAMP-regulated phosphoprotein, Mr 32,000) (39.Bibb J.A. Snyder G.L. Nishi A. Yan Z. Meijer L. Fienberg A.A. Tsai L.H. Kwon Y.T. Girault J.A. Czernik A.J. Huganir R.L. Hemmings Jr., H.C. Nairn A.C. Greengard P. Nature. 1999; 402: 669-671Crossref PubMed Scopus (491) Google Scholar), an inhibitor-1 homologue. In the past decade, Cdk5 has been implicated in many aspects of normal and abnormal neuronal function, including neurodevelopment, synaptic plasticity, and neurodegeneration. In this report, we show that inhibitor-1 is actually phosphorylated at two sites by Cdk5 in vitro and in vivo. Following discovery of the second site by phosphopeptide and phosphoamino acid analyses, mass spectrometric identification of the novel site as Ser6 was confirmed by in vitro phosphorylation of site-directed mutants. Basal levels of phospho-Ser6 inhibitor-1 as detected by a phosphorylation-state specific antibody generated against the site allowed demonstration of its relevance to in vivo systems. Pharmacological manipulation of both striatal lysates and striatal slices suggested that basal levels of phosphorylation at Ser6 are controlled by the opposing actions of Cdk5, PP-2A, and PP-1, whereas biochemical analyses revealed a novel intramolecular regulatory function for Cdk5-dependent phosphorylation of inhibitor-1 that was recapitulated in two in vivo systems. Chemicals and Enzymes−All chemicals were from Sigma, except where indicated. Trypsin, shrimp alkaline phosphatase, and endoproteinase Lys-C were from Promega. Phosphorylase b was purchased from Calzyme. Protease inhibitors, dithiothreitol, isopropyl-β-d-thiogalactopyranoside, and ATP were from Roche. [γ-32P]ATP was from PerkinElmer Life Sciences. Cyclosporin A, calyculin A, okadaic acid, and forskolin were from LC Laboratories, U0126 was from Tocris, and butyrolactone I was from Biomol. Roscovitine and indolinone A and B were generously provided by Laurent Meijer (CNRS, Roscoff, France) and Frank Gillardon (Boehringer Ingelheim), respectively. The catalytic subunits of PKA and PP-1 were purified as described previously from bovine heart (40.Kaczmarek L.K. Jennings K.R. Strumwasser F. Nairn A.C. Walter U. Wilson F.D. Greengard P. Proc. Natl. Acad. Sci. U. S. A. 1980; 77: 7487-7491Crossref PubMed Scopus (172) Google Scholar) and rabbit skeletal muscle (41.Cohen P. Alemany S. Hemmings B.A. Resink T.J. Stralfors P. Tung H.Y. Methods Enzymol. 1988; 159: 390-408Crossref PubMed Scopus (387) Google Scholar), respectively. Cdk5 and p25-His6 were co-expressed in insect Sf9 cultures using baculovirus vectors and affinity-purified (42.Saito T. Onuki R. Fujita Y. Kusakawa G. Ishiguro K. Bibb J.A. Kishimoto T. Hisanaga S. J. Neurosci. 2003; 23: 1189-1197Crossref PubMed Google Scholar). Cdk1/cyclin B and mitogen-activated protein kinase (MAPK) were from New England Biolabs and Calbiochem, respectively. Cell culture reagents were from Invitrogen. Oligonucleotides were ordered from Integrated DNA Technologies, and peptides and phosphopeptides were synthesized at Rockefeller University. Horseradish peroxidase-conjugated anti-rabbit secondary antibody was from Chemicon, and the enhanced chemiluminescence immunoblotting detection system from Amersham Biosciences. Site-directed Mutagenesis−The pET-15b expression vector incorporating the cDNA for rat inhibitor-1-His6 (13.Bibb J.A. Nishi A. O'Callaghan J.P. Ule J. Lan M. Snyder G.L. Horiuchi A. Saito T. Hisanaga S. Czernik A.J. Nairn A.C. Greengard P. J. Biol. Chem. 2001; 276: 14490-14497Abstract Full Text Full Text PDF PubMed Scopus (79) Google Scholar) served as a template for site-directed mutagenesis (43.Bibb J.A. da Cruz e Silva E.F. Hemmings Jr., H.C. Regulatory Protein Modification: Techniques and Protocols. Humana Press, Totowa, NJ1997: 275-307Google Scholar) using Stratagene’s QuikChange kit. The manufacturer’s recommendations for mutagenic primer design were followed, and mutations were confirmed by DNA sequencing. Purification of Inhibitor-1−Recombinant His-tagged-inhibitor-1 was generated as described previously (13.Bibb J.A. Nishi A. O'Callaghan J.P. Ule J. Lan M. Snyder G.L. Horiuchi A. Saito T. Hisanaga S. Czernik A.J. Nairn A.C. Greengard P. J. Biol. Chem. 2001; 276: 14490-14497Abstract Full Text Full Text PDF PubMed Scopus (79) Google Scholar). Proteins were stored at -80 °C following analysis for purity by 15% SDS-PAGE and Coomassie Brilliant Blue staining. In Vitro Protein Phosphorylation and Dephosphorylation Reactions−Protein phosphorylation reactions and PP-1 inhibition assays were performed as described (13.Bibb J.A. Nishi A. O'Callaghan J.P. Ule J. Lan M. Snyder G.L. Horiuchi A. Saito T. Hisanaga S. Czernik A.J. Nairn A.C. Greengard P. J. Biol. Chem. 2001; 276: 14490-14497Abstract Full Text Full Text PDF PubMed Scopus (79) Google Scholar, 44.Hemmings Jr., H.C. Greengard P. Tung H.Y. Cohen P. Nature. 1984; 310: 503-505Crossref PubMed Scopus (485) Google Scholar, 45.Sahin B. Shu H. Fernandez J. El-Armouche A. Molkentin J.D. Nairn A.C. Bibb J.A. J. Biol. Chem. 2006; 281: 24322-24335Abstract Full Text Full Text PDF PubMed Scopus (21) Google Scholar). Calcineurin-mediated dephosphorylation assays were conducted similar to PP-1 inhibition assays, except in 33 mm Tris, pH 7.0, 0.01% Brij, 0.1% β-mercaptoethanol, 0.3 mg/ml bovine serum albumin, 100 μm CaCl2, and 1 μm calmodulin with 1 μm 32P-Thr35 inhibitor-1. Substrates for calcineurin assays were phosphorylated first by PKA and then by Cdk5. In some studies, preparative phosphorylation of inhibitor-1 by a protein kinase was followed by repurification of phospho-inhibitor-1 prior to use in a subsequent assay. For these experiments, phospho-inhibitor-1 was repurified from in vitro protein phosphorylation reaction mixtures by trichloroacetic acid precipitation and dialysis as described previously (13.Bibb J.A. Nishi A. O'Callaghan J.P. Ule J. Lan M. Snyder G.L. Horiuchi A. Saito T. Hisanaga S. Czernik A.J. Nairn A.C. Greengard P. J. Biol. Chem. 2001; 276: 14490-14497Abstract Full Text Full Text PDF PubMed Scopus (79) Google Scholar). Phosphatase assays employing tissue lysates were performed as described (13.Bibb J.A. Nishi A. O'Callaghan J.P. Ule J. Lan M. Snyder G.L. Horiuchi A. Saito T. Hisanaga S. Czernik A.J. Nairn A.C. Greengard P. J. Biol. Chem. 2001; 276: 14490-14497Abstract Full Text Full Text PDF PubMed Scopus (79) Google Scholar). [γ-32P]Ser6/S67D was generated by preparative phosphorylation of S67D inhibitor-1 with Cdk5 in the presence of [γ-32P]ATP. 15 μg of striatal lysate was used for each reaction. Phosphopeptide Maps and Phosphoamino Acid Analysis−Phosphopeptide maps and phosphoamino acid analysis were conducted as described (46.Hemmings Jr., H.C. Nairn A.C. Greengard P. J. Biol. Chem. 1984; 259: 14491-14497Abstract Full Text PDF PubMed Google Scholar). Phosphorylation Site Identification by Mass Spectrometry−32P-Labeled phospho-Ser6/S67A inhibitor-1, resulting from phosphorylation by Cdk5 in the presence of [γ-32P]ATP, was analyzed by SDS-PAGE and digested with Asp-N. Some of the digest mixture was subjected to matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MALDI-TOF MS) (47.Campbell D.G. Morrice N.A. J. Biomol. Tech. 2002; 13: 119-130PubMed Google Scholar). The remainder was fractionated by reversed phase high-performance liquid chromatography (HPLC) on a C18 column (Vydac, 1.0 mm inner diameter × 150 mm), and collected fractions were screened for radioactivity (13.Bibb J.A. Nishi A. O'Callaghan J.P. Ule J. Lan M. Snyder G.L. Horiuchi A. Saito T. Hisanaga S. Czernik A.J. Nairn A.C. Greengard P. J. Biol. Chem. 2001; 276: 14490-14497Abstract Full Text Full Text PDF PubMed Scopus (79) Google Scholar). The fraction containing the radiolabel was analyzed by MALDI-TOF MS. A small aliquot of the fraction was also treated with shrimp alkaline phosphatase in 50 mm NH4HCO3 at 37 °C for 30 min before MALDI-TOF MS to confirm phosphorylation. The identity of the peptide was verified by Edman degradation. Generation of Phosphorylation State-specific Antibodies−Polyclonal phosphorylation state-specific antibodies for phospho-Ser6 inhibitor-1 were generated and affinity-purified as described previously (48.Czernik A.J. Mathers J. Mische S.M. Hemmings Jr., H.C. Regulatory Protein Modification: Techniques and Protocols. Humana Press, Totowa, NJ1997: 219-250Google Scholar) using synthetic phosphopeptides encompassing the local amino acid sequence around Ser6 of inhibitor-1. Purified antibodies were evaluated for specificity by immunoblot analysis of dephospho- and phospho-inhibitor-1 standards (50 ng). Preparation and Incubation of Acute Dorsal Striatal Slices−Slices from male C57BL/6 mice (6-10 weeks old) were prepared in Krebs buffer as described (45.Sahin B. Shu H. Fernandez J. El-Armouche A. Molkentin J.D. Nairn A.C. Bibb J.A. J. Biol. Chem. 2006; 281: 24322-24335Abstract Full Text Full Text PDF PubMed Scopus (21) Google Scholar). Each 400-μm slice was transferred to a net-well (Costar) resting in one well of a 12-well plate containing 3 ml of Krebs buffer and allowed to recover at 30 °C under constant oxygenation with 95% O2, 5% CO2 for 45-60 min with one or two changes of buffer. Slices were subsequently treated with drugs as specified for each experiment, transferred to microcentrifuge tubes, snap-frozen on dry ice, and stored at -80 °C until further analysis. Transfection of PC12 Cells−Inhibitor-1 was subcloned into pcDNA3.1 FLAG (Invitrogen) using the HindIII and KpnI restriction sites and the following primers: 5′-CGGCCGAAGCTTATG GAGCCCGACAACAGTCC-3′ and 5′-CCCGGGGG TACCTCATTTATCGTCATCGTCTTTGTAGTCCATGACCAAGCTGGCTCCTTGGG-3′. A C-terminal FLAG tag (underlined) was included in the primer design to avoid insertion of extraneous amino acids between the end of the protein and the FLAG tag. PC12 rat pheochromocytoma cells were maintained in Dulbecco’s modified Eagle’s medium containing 5% fetal bovine serum and 10% horse serum in 10-cm plates. Experiments were conducted in 24-well pates coated with poly-d-lysine. Cells were transfected using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s protocol. After 24 h, the culture medium was replaced with medium containing one-tenth the normal amount of serum. Transfected cells were cultured for an additional 16 h before being treated with forskolin (5 μm, 10 min). After drug treatment, cells were washed twice with phosphate-buffered saline and lysed directly in the plate with boiling 1% SDS containing 50 mm NaF. Lysates were boiled for 10 min and stored at -80 °C until further analysis. Immunoblot Analysis of Cell and Tissue Homogenates−Lysis and immunoblot analysis of striatal slices, as well as gross dissections of brain and body parts, were performed essentially as described (45.Sahin B. Shu H. Fernandez J. El-Armouche A. Molkentin J.D. Nairn A.C. Bibb J.A. J. Biol. Chem. 2006; 281: 24322-24335Abstract Full Text Full Text PDF PubMed Scopus (21) Google Scholar). However, samples for the peripheral distribution of inhibitor-1 had to be lysed in a different buffer (5 mm Tris, pH 8.4, 0.1 mm EGTA), boiled for 40 min, and centrifuged at 15,000 × g for 15 min to eliminate a cross-reactive band at the same molecular weight. An equal amount of total protein (80-100 μg of brain homogenate, 25 μg of cleared peripheral tissue homogenate, or 25 μg of PC12 cell lysate) from each sample as determined by the bicinchoninic acid protein assay (BCA, Pierce) was analyzed. The membranes were immunoblotted using antibodies for phospho-Ser6 inhibitor-1 (1:750) (see “Results”), phospho-Ser67 inhibitor-1 (1:4000) (13.Bibb J.A. Nishi A. O'Callaghan J.P. Ule J. Lan M. Snyder G.L. Horiuchi A. Saito T. Hisanaga S. Czernik A.J. Nairn A.C. Greengard P. J. Biol. Chem. 2001; 276: 14490-14497Abstract Full Text Full Text PDF PubMed Scopus (79) Google Scholar), total inhibitor-1 (1:2000) (4.Gustafson E.L. Girault J.A. Hemmings Jr., H.C. Nairn A.C. Greengard P. J. Comp. Neurol. 1991; 310: 170-188Crossref PubMed Scopus (43) Google Scholar), or phospho-Thr34 DARPP-32/phospho-Thr35 inhibitor-1 (1:750) (49.Snyder G.L. Girault J.A. Chen J.Y. Czernik A.J. Kebabian J.W. Nathanson J.A. Greengard P. J. Neurosci. 1992; 12: 3071-3083Crossref PubMed Google Scholar) following published protocols. All antibody incubations were in 5% milk plus Tris-buffered saline-Tween 20 except that for phospho-Thr35 inhibitor-1, in which bovine serum albumin replaced milk. Data Analysis−NIH Image J was used to quantitate immunoblots. All results are stated as percentage decrease or fold increase of the mean ± error. Error of change was calculated from standard errors of the mean using error propagation formulas. Discovery, Identification, and Confirmation of Ser6 as a Novel Cdk5 Site of Inhibitor-1−Inhibitor-1 was reported previously to be phosphorylated by Cdk5 at Ser67 (13.Bibb J.A. Nishi A. O'Callaghan J.P. Ule J. Lan M. Snyder G.L. Horiuchi A. Saito T. Hisanaga S. Czernik A.J. Nairn A.C. Greengard P. J. Biol. Chem. 2001; 276: 14490-14497Abstract Full Text Full Text PDF PubMed Scopus (79) Google Scholar). Phosphopeptide maps of wild-type and S67A inhibitor-1 phosphorylated by the proline-directed serine/threonine kinases Cdk1, MAPK, and Cdk5 were generated during the characterization of this phosphorylation site (Fig. 1A). Surprisingly, unlike that for Cdk1 and MAPK, the phosphopeptide map for wild-type inhibitor-1 phosphorylated by Cdk5 revealed two major phosphopeptide species. Mutation of Ser67 to an alanine eliminated one of these phosphopeptide species, suggesting the presence of an additional site of Cdk5-dependent phosphorylation. Phosphoamino acid analysis of wild-type and S67A inhibitor-1 revealed the novel site to be a serine (Fig. 1B). S67A inhibitor-1 preparatively phosphorylated by Cdk5 in the presence of [γ-32P]ATP was next digested with Asp-N to facilitate identification of the novel site. MALDI-TOF MS of the digest revealed peaks at 1707.86 and 1613.20, representing the phosphorylated peptide 4DNSPRKIQFTVPLL17 and its daughter ion, respectively (Fig. 2A). The daughter ion, which resulted from a loss of H3PO4, formed a characteristic broad peak because of its inability to be focused on the MALDI-TOF detector (47.Campbell D.G. Morrice N.A. J. Biomol. Tech. 2002; 13: 119-130PubMed Google Scholar). Because Ser6 is the only serine or threonine directly followed by a proline in this fragment, it was concluded that it was the novel site of phosphorylation. As further confirmation, the proteolytic fragments were fractionated by capillary HPLC into a 96-well plate, and collected fractions were screened for radioactivity (Fig. 2B, top panel). Counts were found primarily in a single fraction, which produced a predominant Mr of 1708.26 by MALDI-TOF MS analysis (Fig. 2B, middle panel). Upon treatment of a small portion of the fraction with alkaline phosphatase, a mass of 1708.26-80 Da (Mr PO3) = 1628.67 was observed (Fig. 2B, bottom panel), confirming that the peptide was phosphorylated. The identity of this peptide as 4DNSPRKIQFTVPLL17 was verified by Edman degradation microsequencing. These findings were supported by site-directed mutagenesis. Mutation of both Ser6 and Ser67 resulted in no detectable phosphorylation by Cdk5 (Fig. 2C). Thus, Ser6 and Ser67 are the only sites of phosphorylation by Cdk5. Curiously, in in vitro phosphorylation reactions mutation of Ser6 to Ala decreased phosphorylation of inhibitor-1 by 44% after 1 h, whereas mutation of Ser67 to Ala decreased phosphorylation by 85% instead of the expected 66%. The incongruence of these numbers suggests that phosphorylation of Ser6 may have to follow that of Ser67. Indeed, phosphomimetic mutation of Ser67 to Asp more than doubled the ability of Cdk5 to phosphorylate Ser6, whereas phosphomimetic mutation of Ser6 did not affect the ability of Cdk5 to phosphorylate Ser67. Demonstration of the in Vivo Phosphorylation of inhibitor-1 at Ser6−To confirm the in vivo relevance of this novel phosphorylation event, a phosphorylation state-specific antibody to phospho-Ser6 inhibitor-1 was generated. Phosphospecificity of the purified antibody was demonstrated by immunoblot analysis of recombinant wild-type or S6A inhibitor-1 preparatively phosphorylated or mock phosphorylated by Cdk5 (Fig. 3A). A strong signal was detected from wild-type inhibitor-1 incubated with Cdk5 but not wild-type inhibitor-1 incubated without Cdk5 or S6A inhibitor-1 incubated with Cdk5. In a tissue distribution analysis, basal levels of phospho-Ser6 inhibitor-1 were observed throughout the mouse brain in regions where total inhibitor-1 was detected, including the olfactory bulb, striatum, hippocampus, and cortex (Fig. 3B). In peripheral tissues, phospho-Ser67 and total inhibitor-1 could be detected in kidney, fat, gastrocnemius, and abdominal skeletal muscle. However, phosphorylation of inhibitor-1 at Ser6 was not detected in peripheral tissues, with the exception of fat (Fig. 3C). No signal was detected in the corresponding regions of I-1-/- mice (2.Allen P.B. Hvalby O. Jensen V. Errington M.L. Ramsay M. Chaudhry F.A. Bliss T.V. Storm-Mathisen J. Morris R.G. Andersen P. Greengard P. J. Neurosci. 2000; 20: 3537-3543Crossref PubMed Google Scholar), confirming the specificity of the observed band in tissue homogenates. The developmental profile o
Abstract The ∈-amino groups of the six lysyl residues of the fd gene 5 DNA-binding protein have been modified by reductive methylation to form N∈, N∈-dimethyl lysyl derivatives containing 13C-labeled methyl groups. The α-amino terminus of the protein was not accessible to methylation. Circular dichroism studies show that the modified protein binds to fd DNA, but with a slightly reduced affinity compared with that of unmodified gene 5 protein. We also find that both the modified and unmodified proteins bind to an oligodeoxynucleotide, d(A)7, but in neither case does binding cause a decrease in the 228 nm CD band of the protein as occurs when the protein binds to long DNA polymers. 13C NMR spectra at 50.1 MHz of [13C]methylated gene 5 protein show five distinct resonances between 43.30 and 42.76 ppm originating from the six N∈, N∈-dimethyl lysyl residues. We attribute one of the resonances to two solvated lysyl residues and the other four to individual lysyl residues in different microenvironments. All four of these latter resonances are affected by the binding of d(A)7. However, since two of these resonances are similarly affected by the presence of salt in the absence of DNA, only two are uniquely affected by DNA binding.
Previous studies have identified intervening sequences that encode homing endonucleases within the genes encoding several archaeal DNA polymerases. We report the sequence of the gene encoding the DNA polymerase of Methanococcus voltae and describe evidence that it lacks analogous intervening sequences.
