The induction of host antimicrobial molecules following binding of pathogen components to pattern recognition receptors such as CD14 and the Toll-like receptors (TLRs) is a key feature of innate immunity. The human airway epithelium is an important environmental interface, but LPS recognition pathways have not been determined. We hypothesized that LPS would trigger β−defensin (hBD2) mRNA in human tracheobronchial epithelial (hTBE) cells through a CD14-dependent mechanism, ultimately activating NF-κB. An average 3-fold increase in hBD2 mRNA occurs 24 h after LPS challenge of hTBE cells. For the first time, we demonstrate the presence of CD14 mRNA and cell surface protein in hTBE cells and show that CD14 neutralization abolishes LPS induction of hBD2 mRNA. Furthermore, we demonstrate TLR mRNA in hTBE cells and NF-κB activation following LPS. Thus, LPS induction of hBD2 in hTBE cells requires CD14, which may complex with a TLR to ultimately activate NF-κB. The induction of host antimicrobial molecules following binding of pathogen components to pattern recognition receptors such as CD14 and the Toll-like receptors (TLRs) is a key feature of innate immunity. The human airway epithelium is an important environmental interface, but LPS recognition pathways have not been determined. We hypothesized that LPS would trigger β−defensin (hBD2) mRNA in human tracheobronchial epithelial (hTBE) cells through a CD14-dependent mechanism, ultimately activating NF-κB. An average 3-fold increase in hBD2 mRNA occurs 24 h after LPS challenge of hTBE cells. For the first time, we demonstrate the presence of CD14 mRNA and cell surface protein in hTBE cells and show that CD14 neutralization abolishes LPS induction of hBD2 mRNA. Furthermore, we demonstrate TLR mRNA in hTBE cells and NF-κB activation following LPS. Thus, LPS induction of hBD2 in hTBE cells requires CD14, which may complex with a TLR to ultimately activate NF-κB. Toll-like receptor human TLR lipopolysaccharide tracheal antimicrobial peptide human β−defensin 1 and 2, respectively human tracheobronchial epithelial cell interleukin polymerase chain reaction reverse transcription-PCR glycosylphosphatidylinositol The innate immune response comprises the first line of host defense against pathogenic microorganisms. Many protective elements including nitric oxide, peptides/proteins, and whole cells such as phagocytes and natural killer cells have been conserved during evolution. Studies in Drosophila illustrate the primary importance of pathogen recognition and induction of antimicrobial molecules. Toll mutations preventing antifungal peptide induction render mutant flies susceptible to fungal infection (1Lemaitre B. Nicolas E. Michaut L. Reichhart J.-M. Hoffmann J.A. Cell. 1996; 86: 973-983Abstract Full Text Full Text PDF PubMed Scopus (3083) Google Scholar). Signaling through Drosophila Toll results in activation of members of the NF-κB family of transcription factors and expression of antimicrobial factors (2Wu L.P. Anderson K.V. Nature. 1998; 392: 93-97Crossref PubMed Scopus (141) Google Scholar). Pathways for pattern recognition and signaling have been identified in mammals where Toll-like receptors (TLRs)1 (3Rock F.L. Hardiman G. Timans J.C. Kastelein R.A. Bazan F.A. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 588-593Crossref PubMed Scopus (1471) Google Scholar, 4Takeuchi O. Kawai T. Sanjo H. Copeland N.G. Gilbert D.J. Jenkins N.A. Takeda K. Akira S. Gene ( Amst. ). 1999; 231: 59-65Crossref PubMed Scopus (358) Google Scholar) and NF-κB provide functions similar to Drosophila Toll and dorsal or Dif, respectively (5Medzhitov R. Preston-Hurlburt P. Kopp E. Stadlen A. Chen C. Ghosh S. Janeway Jr., C.A. Mol. Cell. 1998; 2: 253-258Abstract Full Text Full Text PDF PubMed Scopus (1323) Google Scholar, 6Medzhitov R. Preston-Hurlburt P. Janeway Jr., C.A. Nature. 1997; 388 (397): 397Crossref PubMed Scopus (4528) Google Scholar). Innate immunity is induced when loosely defined recognition elements of microbes bind to pattern recognition receptors present on both phagocytic and epithelial cells (7Diamond G. Legarda D. Ryan L.K. Immunol. Rev. 2000; 173: 27-38Crossref PubMed Scopus (359) Google Scholar). These receptors include the mannose receptor (8Fraser I.P. Kosiel H. Ezekowitz R.A.B. Semin. Immunol. 1998; 10: 363-372Crossref PubMed Scopus (204) Google Scholar), the GPI-linked LPS co-receptor CD14 (9Ulevitch R.J. Tobias P.S. Annu. Rev. Immunol. 1995; 13: 437-457Crossref PubMed Scopus (1333) Google Scholar) and the TLRs (3Rock F.L. Hardiman G. Timans J.C. Kastelein R.A. Bazan F.A. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 588-593Crossref PubMed Scopus (1471) Google Scholar). In human macrophages, TLR2 acts in concert with CD14 to bind LPS and initiate a signaling cascade (10Yang R.B. Mark M.R. Gurney A.L. Godowski P.J. J. Immunol. 1999; 163: 639-643PubMed Google Scholar, 11Kirschning C.J. Wesche H. Merrill Ayres T. Rothe M. J. Exp. Med. 1998; 188: 2091-2097Crossref PubMed Scopus (658) Google Scholar). The mouse TLR4 homologue is an important determinant of LPS responsiveness (12Poltorak A. He X. Smirnova I. Liu M.-Y. Van Huffel C. Du X. Birdwell D. Alejos E. Silva M. Galanos C. Freudenberg M. Ricciardi-Castagnoli P. Layton B. Beutler B. Science. 1998; 282: 2085-2088Crossref PubMed Scopus (6576) Google Scholar). In general, activation of pattern recognition receptors induces host defense gene products. As a primary interface between pathogens and the environment, epithelial cells lining the mammalian airways are a crucial site for the innate immune response. It has been proposed that dysfunction of innate immunity may result in recurrent airway infections as seen in cystic fibrosis (13Smith J.J. Travis S.M. Greenberg E.P. Welsh M.J. Cell. 1996; 85: 229-236Abstract Full Text Full Text PDF PubMed Scopus (909) Google Scholar). The bovine β-defensin tracheal antimicrobial peptide (TAP) serves as a paradigm for induction of innate immunity in the airway (14Diamond G. Russell J.P. Bevins C.L. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 5156-5160Crossref PubMed Scopus (231) Google Scholar). The TAP gene is expressed in the ciliated airway epithelium (15Diamond G. Jones D.E. Bevins C.L. Proc. Natl. Acad. Sci. 1993; 90: 4596-4600Crossref PubMed Scopus (139) Google Scholar) and is induced following experimental bacterial infection (14Diamond G. Russell J.P. Bevins C.L. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 5156-5160Crossref PubMed Scopus (231) Google Scholar). In vitro incubation of bovine tracheal epithelial cells with LPS increases TAP mRNA levels via a CD14-mediated response (14Diamond G. Russell J.P. Bevins C.L. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 5156-5160Crossref PubMed Scopus (231) Google Scholar), culminating in NF-κB activation and transcriptional up-regulation of the TAP gene (16Diamond G. Kaiser V. Rhodes J. Russell J.P. Bevins C.L. Infect. Immun. 2000; 68: 113-119Crossref PubMed Scopus (192) Google Scholar). Thus, in the bovine airway epithelium antimicrobial peptides are induced through a well defined recognition and activation pathway that helps prevent microbial colonization. Two β-defensins are present in human epithelia. Human β-defensin-1 (hBD1) (17Bensch K.W. Raida M. Magert H.-J. Schulz-Knappe P. Forssmann W.-G. FEBS Lett. 1995; 368: 331-335Crossref PubMed Scopus (504) Google Scholar) is highly expressed in urogenital tissues (18Valore E.V. Park C.H. Quayle A.J. Wiles K.R. McCray P.B. Ganz T. J. Clin. Invest. 1998; 101: 1633-1642Crossref PubMed Scopus (641) Google Scholar), and to a lesser extent in airway and other epithelia, entirely in a constitutive manner (19Zhao C. Wang I. Lehrer R.I. FEBS Lett. 1996; 396: 319-322Crossref PubMed Scopus (506) Google Scholar). Human β-defensin-2 (hBD2) was initially found in psoriatic skin and is present in cultured keratinocytes in response to bacteria (20Harder J. Bartels J. Christophers E. Schroder J.-M. Nature. 1997; 387: 861Crossref PubMed Scopus (1207) Google Scholar). The hBD2 gene is similar to TAP and includes three NF-κB consensus sequences upstream from the transcriptional initiation site (21Liu L. Wang L. Jia H.P. Zhao C. Heng H.H.Q. Schutte B.C. McCray P.B. Ganz T. Gene ( Amst. ). 1998; 222: 237-244Crossref PubMed Scopus (233) Google Scholar). The mRNA for hBD2 is present in human lung (22Bals R. Wang X. Wu Z. Freeman T. Bafna V. Zasloff M. Wilson J.M. J. Clin. Invest. 1998; 102: 874-880Crossref PubMed Scopus (520) Google Scholar) and is up-regulated in chronic inflammation and by the proinflammatory mediator IL-1β (23Singh P.K. Jia H.P. Wiles K. Hesselberth J. Liu L. Conway B.A.D. Greenberg E.P. Valore E.V. Welsh M.J. Ganz T. Tack B.F. McCray Jr P.B. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 14961-14966Crossref PubMed Scopus (525) Google Scholar). Thus, hBD2 is a host defense molecule whose production is induced in response to infection and inflammation. Purified hBD2 peptide acts synergistically with other antibacterial components of the airway surface fluid, including lysozyme and lactoferrin (22Bals R. Wang X. Wu Z. Freeman T. Bafna V. Zasloff M. Wilson J.M. J. Clin. Invest. 1998; 102: 874-880Crossref PubMed Scopus (520) Google Scholar), suggesting a role in maintaining a pathogen-free environment. As an innate immune response tissue, the human airway must recognize pathogen-associated molecular patterns such as LPS via cell surface receptors. Surprisingly, neither CD14 nor TLRs have been documented in human tracheobronchial epithelial (hTBE) cells. We hypothesized that LPS would trigger hBD2 expression possibly through a CD14-mediated recognition, ultimately resulting in hBD2 induction via activation of NF-κB. To establish this paradigm, we analyzed the hBD2 mRNA response to LPS in hTBE cells and determined the role of CD14. Furthermore, we document expression of TLRs in these cells and demonstrate activation of NF-κB in response to LPS. Escherichia coli LPS serotype O127:B8, Igepal CA-630, nitro blue tetrazolium, and 5-bromo-4-chloro-3-indolylphosphate were from Sigma. Mouse monoclonal My4 and mouse IgG2b antibodies were obtained from Beckman Coulter (Miami, FL). IL-1β was from R&D Systems (Minneapolis, MN). hTBE cells were isolated under the auspices of Institutional Review Board approved protocols as described in detail previously (24Bernacki S.H. Nelson A.L. Abdullah L. Sheehan J.K. Harris A. William Davis C. Randell S.H. Am. J. Respir. Cell Mol. Biol. 1999; 20: 595-604Crossref PubMed Scopus (175) Google Scholar). Passage 1 or 2 hTBE cells were cultured at an air-liquid interface on 24-mm T-COL membrane supports (Costar, Cambridge, MA) for the number of days indicated in each experiment. Initial seeding density was 0.7–1 × 106cells/support. Growth medium was modified from that in Ref. 24Bernacki S.H. Nelson A.L. Abdullah L. Sheehan J.K. Harris A. William Davis C. Randell S.H. Am. J. Respir. Cell Mol. Biol. 1999; 20: 595-604Crossref PubMed Scopus (175) Google Scholar by the use of bovine pituitary extract from Upstate Biotechnology, Inc. (Lake Placid, NY) and the elimination of antibiotics. The medium was periodically tested for endotoxin levels with the Limulus Amebocyte Lysate assay (BioWhittaker (Walkersville, MD) or Associates of Cape Cod (Falmouth, MA)), and endotoxin levels were below 100 pg/ml. LPS (E. coli) at 5 μg/ml was added either apically or basolaterally to cultures with 5% human serum (Sigma catalog no. H4522) as a source of LPS-binding protein. It is important to note that our cells are normally cultured at an air-liquid interface and that the cells respond to apical flooding by increased acid production (yellowing of the media). In preliminary experiments, we challenged cells with LPS from both sides simultaneously or from only the basal or apical side (with apical flooding controls). The most consistent response was observed with a basal challenge while maintaining an air-liquid interface. Since we observed CD14 on both the apical and basal membrane (this study) and to avoid disturbance of the air-liquid interface, we chose basal challenge for our studies. IL-1β was added basolaterally at 25 ng/ml. For blocking experiments, My4 or IgG2b was added to the cultures both apically and basolaterally 20 min prior to the addition of LPS. RNA was isolated with TRI-reagent according to the manufacturer's protocol (MRC, Cincinnati, OH). Unless otherwise noted, all of the RNA from one 24-mm T-COL was electrophoresed in a single lane on 1.2% agarose-formaldehyde gels. Northern blot analysis was carried out by standard capillary transfer to a Hybond N membrane (Amersham Pharmacia Biotech). Blots were hybridized with Quikhyb (Stratagene, La Jolla, CA) with 2 × 106 counts per ml of 32P-labeled probe. For hBD2, either a random primed fragment (bp11–265; accession numberZ71389) or an end-labeled oligonucleotide (5′-AATATGAAGAGGAACGAGAAGAGGAGATACAAGACCCTCAT-3′) was used. Fragments for CD14 (base pairs 52–563, accession numberX06882) and TLR4 (base pairs 446–945, accession number U88880) were PCR-cloned with the Invitrogen (Carlsbad, CA) TOPO TA or TA kit, respectively. The inserts were isolated and random prime-labeled (Rediprime; Amersham Pharmacia Biotech) for use as probes. Inserts for TLR2 (base pairs 2012–2600; accession number U88878) and γ-actin (XhoI fragment of pHFγA-1 (25Gunning P. Ponte P. Okayama H. Engel J. Blau H. Kedes L. Mol. Cell. Biol. 1983; 3: 787-795Crossref PubMed Scopus (1048) Google Scholar) encompassing the entire cDNA sequence) also were random primed. All accession numbers refer to GenBankTM. Quantitation was performed with a Molecular Dynamics PhosphorImager. The production of IL-8 was measured by enzyme-linked immunosorbent assay (R&D Systems) in samples of the growth medium taken before and after LPS challenge. RT-PCR was performed as described previously (24Bernacki S.H. Nelson A.L. Abdullah L. Sheehan J.K. Harris A. William Davis C. Randell S.H. Am. J. Respir. Cell Mol. Biol. 1999; 20: 595-604Crossref PubMed Scopus (175) Google Scholar). Seven-day-old cultures were used for the RNA isolation. Primers used are listed in TableI. The THP-1 cells were obtained from the ATCC (TIB 202) and were maintained in RPMI 1640 with 5 × 10−5m 2-mercaptoethanol plus 10% fetal bovine serum. Lung RNA was obtained fromCLONTECH (Palo Alto, CA).Table IGene (accession no.)Forward primer (5′ → 3′)BasesReverse primer (5′ → 3′)Basesγ-Actin (M19283)GCCAACAGAGAGAAGATGAC1350–1369AGGAAGGAAGGCTGGAAC2087–2070TLR1 (U88540)TGCCCTGCCTATATGCAA381–398GAACACATCGCTGACAACT936–918TLR2 (U88878)CCTACATTAGCAACAGTGACCTAC323–346ATCTCGCAGTTCCAAACATTCCA822–800TLR3 (U88879)CGCCAACTTCACAAGGTA277–294GGAAGCCAAGCAAAGGAA966–949TLR4 (U88880)AGATGGGGCATATCAGAGC446–464CCAGAACCAAACGATGGAC945–927TLR5 (U88881)TTCTGACTGCATTAAGGGGAC93–113TTGAGCAAAGCATTCTGCAC660–641TLR6 (AB020807)CCTCAACCACATAGAAACGAC832–852CACCACTATACTCTCAACCCAA1363–1342 Open table in a new tab For detection of hBD2, Western blots were performed as in Ref. 18Valore E.V. Park C.H. Quayle A.J. Wiles K.R. McCray P.B. Ganz T. J. Clin. Invest. 1998; 101: 1633-1642Crossref PubMed Scopus (641) Google Scholar. Briefly, cells were lysed in 5% acetic acid, and acid-soluble proteins were extracted overnight at 4 °C. After lyophilization, proteins were separated on acid urea-polyacrylamide gels and electroblotted to an Immobilon PSQ membrane (Millipore Corp., Bedford, MA). Membranes were blocked and incubated with a 1:1000 dilution of anti-hBD2 (the kind gift of Tomas Ganz, UCLA, Los Angeles, CA) or normal rabbit serum overnight. Subsequently, blots were incubated with an alkaline phosphatase-conjugated secondary antibody (Jackson Immunoresearch, West Grove, PA) and visualized with nitro blue tetrazolium/5-bromo-4-chloro-3-indolylphosphate. Cell surface biotinylation, immunoprecipitation, and Western blots were performed as described (26Pickles R.J. McCarty D. Matsui H. Hart P.J. Randell S.H. Boucher R.C. J. Virol. 1998; 72: 6014-6023Crossref PubMed Google Scholar). Briefly, 7-day-old cultures of hTBE cells were surface-biotinylated with EZ-Link sulfo-NHS-biotin (Pierce) according to the manufacturer's protocol. Proteins were isolated in radioimmune precipitation buffer and immunoprecipitated with the My4 antibody or an IgG2b isotype control. Immunoprecipitated proteins were run on a 4–20% acrylamide gel (NOVEX, San Diego, CA) and electroblotted to a polyvinylidene difluoride membrane. Biotinylated proteins were detected by streptavidin-linked horseradish peroxidase and chemiluminescence (Pierce). Cells were harvested from the membrane in phosphate-buffered saline plus protease inhibitors (1 mm phenylmethylsulfonyl fluoride, 1.2 μg/ml leupeptin, 1 μg/ml pepstatin, 0.5 mm EDTA) with a cell scraper. Extracts were prepared according to the method of Dignam (27Dignam J.D. Lebovitz R.M. Roeder R.G. Nucleic Acids Res. 1983; 11: 1475-1489Crossref PubMed Scopus (9572) Google Scholar) with the modification that Igepal CA-630 (0.25%) was added to buffer A before homogenization, and buffer D was added directly to the cleared supernatant rather than dialyzed against buffer D. Complementary oligonucleotides containing the NF-κB consensus sequence from the class I MHC promoter (28Scheinman R.I. Beg A.A. Baldwin Jr., A.S. Mol. Cell. Biol. 1993; 13: 6089-6101Crossref PubMed Google Scholar) were annealed and labeled by end filling with Klenow and [32P]dCTP. Binding reactions were performed according to Ref. 29F.M. Ausubel Current Protocols in Molecular Biology. John Wiley & Sons, Inc., New York1994: 12.0.3-12.2.7Google Scholar, and complexes were separated by 5% nondenaturing polyacrylamide gel electrophoresis in Tris-glycine-EDTA buffer. For competition experiments, 20 μg of NF-κB consensus or mutant oligonucleotides from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA) were added to the binding reaction. Inducibility of antimicrobial factors by bacterial products and/or inflammatory mediators is a key feature of innate immunity. LPS induction of hBD2 gene expression was examined in passage 1 or 2 hTBE grown in culture at an air-liquid interface. Cells were grown for 7, 14, or 21 days, which corresponds to distinct stages of mucociliary differentiation (24Bernacki S.H. Nelson A.L. Abdullah L. Sheehan J.K. Harris A. William Davis C. Randell S.H. Am. J. Respir. Cell Mol. Biol. 1999; 20: 595-604Crossref PubMed Scopus (175) Google Scholar), and were treated with E. coli LPS at 1 or 5 μg/ml in the presence of human serum as a source of LPS-binding protein. Fig. 1 shows that hBD2 mRNA levels are highest early in culture and that expression is induced after incubation with LPS. In subsequent experiments conducted at 7 days postseeding, steady-state levels of hBD2 mRNA increased an average of 3-fold following LPS (range 1.3–6.3-fold, 10 separate experiments, with seven different patient cell samples) and up to 16-fold following IL-1β (data not shown), which is consistent with published results (23Singh P.K. Jia H.P. Wiles K. Hesselberth J. Liu L. Conway B.A.D. Greenberg E.P. Valore E.V. Welsh M.J. Ganz T. Tack B.F. McCray Jr P.B. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 14961-14966Crossref PubMed Scopus (525) Google Scholar, 30Mathews M. Jia H.P. Guthmiller J.M. Losh G. Graham S. Johnson G.K. Tack B.F. McCray Jr., P.B. Infect. Immun. 1999; 67: 2740-2745Crossref PubMed Google Scholar). The LPS dose-response relationship for hBD2 induction in hTBE cells is shown in Fig. 2 A, which is a graphical representation of the results from a Northern blot with triplicate samples. An LPS dose of 10 ng/ml, which typically induces strong responses in monocyte-derived cells, did not alter hBD2 expression in hTBE cells, but hBD2 mRNA increased following 100 ng/ml to 1 μg/ml of LPS. As shown in Fig. 2 B, we examined LPS stimulation of the proinflammatory cytokine IL-8 in the same cultures. The basal expression of IL-8 is approximately 10-fold higher in the presence of serum than in cultures with media alone (data not shown). However, ≥1 μg/ml LPS induced a significant increase over this elevated base line. The time course of hBD2 mRNA induction is shown in Fig.3 A. LPS increased hBD2 mRNA at 12 and 24 h, but not 6 h, following challenge. Basal hBD2 expression declined over 24 h, possibly in response to the serum added to the medium as a source of LPS-binding protein. Subsequent analyses were performed 24 h following LPS addition. Fig. 3 B demonstrates a corresponding LPS-induced increase in hBD2 protein as detected by Western blot. The GPI-linked cell surface protein, CD14, is known to participate in LPS responsiveness in bovine tracheal epithelial cells (14Diamond G. Russell J.P. Bevins C.L. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 5156-5160Crossref PubMed Scopus (231) Google Scholar). We examined hTBE cells for the expression and production of CD14, as well as its involvement in the up-regulation of hBD2. Immunoprecipitation of biotinylated surface proteins reveals that membrane-bound CD14 is found on both the apical and basolateral surfaces of hTBE cells (Fig.4 A). The Northern blot shown in Fig. 4 B indicates that mRNA for CD14 is present in hTBE cells, and the levels of CD14 are not altered in response to LPS. To test the role of CD14 in the stimulation of hBD2 gene expression, we challenged cultures with LPS in the presence of either My4, a neutralizing monoclonal antibody to CD14, or an IgG2b isotype control. The Northern blot in Fig. 4 B and the corresponding graphical representation in Fig. 4 C are representative of three experiments and show that My4 blocks the up-regulation of hBD2 by LPS. Thus, CD14, either membrane-bound or the soluble form, is necessary for the LPS-induced increase in hBD2 mRNA. As a GPI-linked protein without a cytoplasmic domain, CD14 cannot act alone as a classical signal transduction molecule. As noted above, recent studies suggest that CD14-TLR complexes may function to initiate a signal transduction event. We examined hTBE cells for the expression of TLR genes by RT-PCR (Fig.5 A). Our results show that mRNA for all six published hTLRs is expressed in these cultures. Based on published results (10Yang R.B. Mark M.R. Gurney A.L. Godowski P.J. J. Immunol. 1999; 163: 639-643PubMed Google Scholar, 11Kirschning C.J. Wesche H. Merrill Ayres T. Rothe M. J. Exp. Med. 1998; 188: 2091-2097Crossref PubMed Scopus (658) Google Scholar, 31Chow J.C. Young D.W. Golenbock D.T. Christ W.J. Gusovsky F. J. Biol. Chem. 1999; 274: 10689-10692Abstract Full Text Full Text PDF PubMed Scopus (1645) Google Scholar) TLRs 2 and 4 are probable LPS-signaling intermediates. Northern blot analysis shown in Fig. 5 B indicates that hTLR2 is abundantly expressed in hTBE cells and that there is no induction by LPS. Human TLR4 expression is also detectable by Northern blot but is much less abundant than TLR2 and is also not regulated by LPS (Fig. 5 C). The promoter region of the hBD2 gene has three NF-κB consensus binding sites, suggesting a role for this family of transcription factors as a mechanism for gene regulation. Using electrophoretic mobility shift assays, we determined whether LPS-induced hBD2 expression was associated with activation of NF-κB. Upon induction with LPS for varying time periods, we isolated nuclear extracts from hTBE cells. THP-1 cells were used as a positive control (32Schottelius A.J. Mayo M.W. Sartor R.B. Baldwin Jr., A.S. J. Biol. Chem. 1999; 274: 31868-31874Abstract Full Text Full Text PDF PubMed Scopus (462) Google Scholar). Fig.6 A indicates that NF-κB is activated after a 1-h incubation with LPS in hTBE cells and persists through 8 h. A stronger and more persistent shift is seen in response to IL-1β. Preincubation of the extracts with unlabeled NF-κB consensus oligonucleotide, but not with unlabeled mutant oligonucleotide, effectively competes for binding to the labeled oligonucleotide demonstrating specificity (Fig. 6 B). The airway epithelium comprises an important barrier against invasion by airborne pathogens. We show that epithelial cells lining the respiratory tract induce the host defense gene hBD2 at both the mRNA and protein level in response to LPS, a pathogen-associated pattern molecule. Human β-defensin-2 mRNA also is increased by IL-1β (23Singh P.K. Jia H.P. Wiles K. Hesselberth J. Liu L. Conway B.A.D. Greenberg E.P. Valore E.V. Welsh M.J. Ganz T. Tack B.F. McCray Jr P.B. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 14961-14966Crossref PubMed Scopus (525) Google Scholar, 30Mathews M. Jia H.P. Guthmiller J.M. Losh G. Graham S. Johnson G.K. Tack B.F. McCray Jr., P.B. Infect. Immun. 1999; 67: 2740-2745Crossref PubMed Google Scholar), suggesting that a similar protective effect accompanies inflammation even when not directly induced by bacterial products. High levels of β-defensin gene expression have been observed at sites of inflammation in the bovine tongue (33Schonwetter B.S. Stolzenberg E.D. Zasloff M.A. Science. 1995; 267: 1645-1648Crossref PubMed Scopus (372) Google Scholar) and airway (34Stolzenberg E.D. Anderson G.M. Ackermann M.R. Whitlock R.H. Zasloff M. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 8686-8690Crossref PubMed Scopus (197) Google Scholar). There are several examples of β-defensin induction in response to infection and inflammation by human tissues that provide barrier functions, including the oral mucosa (30Mathews M. Jia H.P. Guthmiller J.M. Losh G. Graham S. Johnson G.K. Tack B.F. McCray Jr., P.B. Infect. Immun. 1999; 67: 2740-2745Crossref PubMed Google Scholar, 35Krisanaprakornkit S. Weinberg A. Perez C.N. Dale B.A. Infect. Immun. 1998; 66: 4222-4228Crossref PubMed Google Scholar), occular epithelium (36McNamara N. Van R. Tuchin O.S. Fleiszig S.M. Exp. Eye Res. 1999; 69: 483-490Crossref PubMed Scopus (111) Google Scholar), and intestinal epithelium (37O'Neil D.A. Porter E.M. Elewaut D. Anderson G.M. Eckmann L. Ganz T. Kagnoff M.F. J. Immunol. 1999; 163: 6718-6724PubMed Google Scholar). Together these data suggest that a peptide-based antimicrobial host response during infection and inflammation is intrinsic to mucosal surfaces. The molecular pathway for the induction of antimicrobial peptides in the airway is both similar to and different from circulating professional phagocytes, such as monocytes. While initially discovered and extensively studied in myeloid-derived cells, CD14 is also expressed by bovine and murine epithelial cells (14Diamond G. Russell J.P. Bevins C.L. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 5156-5160Crossref PubMed Scopus (231) Google Scholar, 38Fearns C. Kravchenko V.V. Ulevitch R.J. Loskutoff D.J. J. Exp. Med. 1995; 181: 857-866Crossref PubMed Scopus (143) Google Scholar). Our results demonstrate both CD14 mRNA and cell surface protein in human airway epithelial cells. We found that CD14 mRNA was not increased in response to LPS, whereas it is in monocytes (39Marchant A. Duchow J. Delville J.P. Goldman M. Eur. J. Immunol. 1992; 22: 1663-1665Crossref PubMed Scopus (94) Google Scholar). The CD14-specific antibody, My4, inhibited LPS-induced hBD2 expression in hTBE cells, which suggests a critical role for CD14 in the mechanism by which airway epithelial cells recognize and respond to bacterial products. Induction of hBD2 or IL-8 in hTBE requires relatively high concentrations (1–5 μg/ml) of LPS, whereas phagocytic cells or bovine epithelial cells are activated by 10–20 ng/ml concentrations. Thus, while CD14 is an important mediator of LPS responsiveness in hTBE cells, initiation and coupling to downstream signal transduction events appears to be much less efficient than in monocyte-derived cells. Primary cultures of bovine tracheal epithelial cells respond to lower levels of LPS than passaged hTBE cells. 2G. Diamond, unpublished observations. Surface CD14 in passage 1 hTBE cells was detected by immunoprecipitation, but expression was much less than in the vitamin D3-differentiated HL60 cells used as a positive control. Further studies are necessary to determine CD14 protein levels in normal and diseased human airways in vivo. The low sensitivity of the hTBE cells to LPS could be due to desensitization during culture. The medium for hTBE cells contains several biologicals including albumin, EGF, transferrin, and bovine pituitary extract. The practical limit of endotoxin reduction was 100 pg/ml. Thus, desensitization by basal endotoxin levels in the medium could have contributed to the apparent resistance of hTBE cells to LPS. However, polymyxin B addition did not reduce basal levels of IL-8 production (data not shown). As demonstrated by others, LPS desensitization of monocytic cell lines and murine macrophages appears to require 20–100 ng of LPS/ml (40Ziegler-Heitbrock H.W. Wedel A. Schraut W. Strobel M. Wendelgass P. Sternsdorf T. Bauerle P.A. Haas J.G. Riethmuller G. J. Biol. Chem. 1994; 269: 17001-17004Abstract Full Text PDF PubMed Google Scholar, 41Kastenbauer S. Ziegler-Heitbrock H.W. Infect. Immun. 1999; 67: 1553-1559Crossref PubMed Google Scholar, 42Nomura F. Akashi S. Sakao Y. Sato S. Kawai T. Matsumoto M. Nakanishi K. Kimoto M. Miyake K. Takeda K. Akira S. J. Immunol. 2000; 164: 3476-3479Crossref PubMed Scopus (663) Google Scholar). In LPS-tolerant cells, DNA binding activity in NF-κB gel shift assays consists mostly of p50 homodimers in LPS-tolerant cells (40Ziegler-Heitbrock H.W. Wedel A. Schraut W. Strobel M. Wendelgass P. Sternsdorf T. Bauerle P.A. Haas J.G. Riethmuller G. J. Biol. Chem. 1994; 269: 17001-17004Abstract Full Text PDF PubMed Google Scholar, 41Kastenbauer S. Ziegler-Heitbrock H.W. Infect. Immun. 1999; 67: 1553-1559Crossref PubMed Google Scholar). The NF-κB gel shift assays in our studies are consistent with those seen in LPS-sensitive Mono Mac 6 cells, where the low mobility upper band representing the p50/p65 heterodimer is more prominent. We hypothesize that the low LPS responsiveness of hTBE cells reflects the low level of CD14 expression compared with monocytic cells. In support of this hypothesis are the findings that the response to LPS in THP-1 cells correlates inversely with the level of CD14 expression (43Pugin J. Kravchenko V.V. Lee J.D. Kline L. Ulevitch R.J. Tobias P.S. Infect. Immun. 1998; 66: 1174-1180Crossref PubMed Google Scholar). The lack of a cytoplasmic domain in GPI-anchored CD14 implies that it acts in concert with other proteins to transduce signals. Several lines of evidence suggest that TLRs contribute transmembrane signaling functions. Recent reports indicate that TLR2 mediates both LPS sensitivity (44Yang R.-B. Mark M.R. Gray A. Huang A. Xie M.H. Zhang M. Goddard A. Wood W.I. Gurney A.L. Godowski P.J. Nature. 1998; 395: 284-288Crossref PubMed Scopus (1111) Google Scholar) and responsiveness to Gram-positive bacteria (45Schwandner R. Dziarski R. Wesche H. Rothe M. Kirschning C.J. J. Biol. Chem. 1999; 274: 17406-17409Abstract Full Text Full Text PDF PubMed Scopus (1451) Google Scholar) in transfected 293 cells. However, TLR2 null hamster macrophages still respond to LPS (46Heine H. Kirschning C.J. Lien E. Monks B.G. Rothe M. Golenbock D.T. J. Immunol. 1999; 162: 6971-6975PubMed Google Scholar), suggesting a complementary function for other TLRs including TLR4. It is now known that mouse TLR4 is equivalent to the mouse LPS gene conferring LPS sensitivity (12Poltorak A. He X. Smirnova I. Liu M.-Y. Van Huffel C. Du X. Birdwell D. Alejos E. Silva M. Galanos C. Freudenberg M. Ricciardi-Castagnoli P. Layton B. Beutler B. Science. 1998; 282: 2085-2088Crossref PubMed Scopus (6576) Google Scholar). Using RT-PCR, we demonstrate mRNA for the six published hTLR sequences in hTBE cells and have established that hTLR2 and -4 are present at levels detectable by Northern blot of whole RNA. Further studies are needed to clearly elucidate the specific roles of TLR2 and/or -4 in initiating signal transduction responses in the airway. This will require the development of tools including neutralizing antibodies analogous to My4, successful strategies to generate dominant negative phenotypes in difficult to transfect polarized hTBE cells, and genetically engineered animals. Studies of the Drosophila Toll pathway for antimicrobial factor induction and the discovery of inducible antimicrobial peptide expression in mammals suggest an evolutionarily conserved activation pathway. MUC2 mucin, which can be considered an innate immune molecule, increases in response to Psuedomonas aeruginosa through NF-κB activation (47Li J.-D. Feng W. Gallup M. Kim J.-H. Gum J. Kim Y. Basbaum C. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 5718-5723Crossref PubMed Scopus (294) Google Scholar). We demonstrate that hTBE cells activate the NF-κB pathway in response to LPS similarly to bovine epithelial cells (16Diamond G. Kaiser V. Rhodes J. Russell J.P. Bevins C.L. Infect. Immun. 2000; 68: 113-119Crossref PubMed Scopus (192) Google Scholar). Interestingly, hTBE activation of NF-κB is of a lower magnitude and more transient following LPS compared with IL-1β, which is consistent with the typically lower -fold induction of hBD2 mRNA that we observed. It will be interesting to compare and contrast the function of components in the IL-1β and LPS signal transduction pathways to discover the basis for this difference. In summary, the human airway epithelium responds to products from infectious microorganisms by inducing antimicrobial peptides. The activation pathway shares elements with cells of the myeloid lineage in that the epithelium expresses pathogen-associated recognition receptors. These receptors identify and transduce a signal ultimately activating NF-κB, which in turn up-regulates antimicrobial peptide genes. Taken together with studies in other organ systems, this innate immune mechanism is probably intrinsic to most if not all epithelia, providing a barrier function. Although in vitro studies such as ours introduce a level of uncertainty, it appears that hTBE cells require much higher doses of LPS than blood monocytes. This is perhaps not surprising in view of the potential for very high LPS aerosol exposure in certain environments (48Young R.S. Jones A.M. Nicholls P.J. J. Pharm. Pharmacol. 1998; 50: 11-17Crossref PubMed Scopus (23) Google Scholar). It will be important to determine the mechanisms, possibly involving CD14 and hTLRs, by which the organism balances defense against inhaled microbes with the potential pathophysiology inherent to chronic airway inflammation. We gratefully acknowledge Diana Walstad and Ron Kim for cell isolations; Dr. Marty W. Mayo for help with electrophoretic mobility shift assays; Erika Valore and Dr. Alex Cole for advice about acid urea-polyacrylamide gel electrophoresis Western blots; and Dr. Lawrence Ostrowski and Dr. Larry Johnson for invaluable scientific discussions.
Seven murine anti-H-2 and three nonimmune mouse sera were tested for cytotoxicity toward B and T lymphocytes from a panel of human donors. One group of sera, including two anti-H-2.33 sera, exhibited cytotoxicity directed exclusively toward human B but not T cells from all donors. Absorption studies on human lymphoblastoid cell lines (LCLs) of B or T cell origin corroborated these findings. Some nonimmune sera showed similar characteristics, indicating that the observed reactions were not attributable to cross-reactivities between mouse H-2K or D specificities and human antigens coded by the HLA-A, B, or C locus. Another set of mouse sera (anti-H-2.28b and anti-H-2.31) was highly cytotoxic to both B and T cells of some donors but not of others, suggesting that activity in these sera may arise from cross-reactions between mouse and human specifities. A third set of anti-H-2 as well as normal mouse sera showed only background cytotoxicity when tested on human cells. The ability of the B cell cytotoxic mouse sera to block the human mixed lymphocyte culture reaction (MLR) was compared to that of appropriate human alloantisera with exclusive B cell activity or a rabbit serum raised against human B cells. None of the mouse sera resulted in a significant reduction in the human MLR, whereas the human alloantisera as well as the rabbit antiserum caused a significant amount of blocking at several dilutions beyond their highest cytolytic titer.
Abstract Cystic fibrosis (CF) lung disease is characterized by persistent lung infection. Thickened (concentrated) mucus in the CF lung impairs airway mucus clearance, which initiates bacterial infection. However, airways have other mechanisms to prevent bacterial infection, including neutrophil-mediated killing. Therefore, we examined whether neutrophil motility and bacterial capture and killing functions are impaired in thickened mucus. Mucus of three concentrations, representative of the range of normal (1.5 and 2.5% dry weight) and CF-like thickened (6.5%) mucus, was obtained from well-differentiated human bronchial epithelial cultures and prepared for three-dimensional studies of neutrophil migration. Neutrophil chemotaxis in the direction of gravity was optimal in 1.5% mucus, whereas 2.5% mucus best supported neutrophil chemotaxis against gravity. Lateral chemokinetic movement was fastest on airway epithelial surfaces covered with 1.5% mucus. In contrast, neutrophils exhibited little motility in any direction in thickened (6.5%) mucus. In in vivo models of airway mucus plugs, neutrophil migration was inhibited by thickened mucus (CF model) but not by normal concentrations of mucus (“normal” model). Paralleling the decreased neutrophil motility in thickened mucus, bacterial capture and killing capacity were decreased in CF-like thickened mucus. Similar results with each mucus concentration were obtained with mucus from CF cultures, indicating that inhibition of neutrophil functions was mucus concentration dependent not CF source dependent. We conclude that concentrated (“thick”) mucus inhibits neutrophil migration and killing and is a key component in the failure of defense against chronic airways infection in CF.
Previous studies demonstrated that oligopeptide chemoattractant receptors on PMN and macrophages exist in high and low affinity states which are interconvertible by guanosine di- and triphosphates. These observations suggest that guanine nucleotide regulatory (N) proteins play a role in phagocyte activation by chemotactic factors. The data presented here indicate that chemotactic factor receptors on monocytes utilize an N protein to activate phospholipase C and subsequent biologic responses by the cells. This conclusion is based on the findings that inactivation of an N protein of 41,000 m.w. by Bordetella pertussis toxin (PT) treatment abolishes monocyte responsiveness to chemoattractants but not to lectins, PMA, or the Ca2+ ionophore A23187. Treatment with PT inhibited IP3 production, Ca2+ mobilization, and cellular activation as assessed by chemotaxis and changes in forward light scattering in response to the chemoattractants by at least 80%. Therefore, a PT-sensitive N protein plays an important role in the activation of monocytes by chemoattractants.
Many macrophage functions such as chemotaxis, phagocytosis, enzyme secretion, and cytotoxicity are influenced by intracellular cyclic nucleotide levels, but the regulatory mechanisms involved are poorly defined. We have developed methods that allowed us to study the activation of AC in isolated guinea pig (g.p.) macrophage membranes. AC in these membrane preparations could be stimulated approximately twofold by guanine nucleotides. We could not obtain any hormonal activation of membrane-bound AC in the absence of guanine nucleotides. In the presence of GTP, however, the hormones isoproterenol and PGE1 elicited an additional threefold rise in AC activity, which subsided after approximately 15 min. As little as 10(-8) M concentrations of these two hormones induced significant elevations of AC activity. Replacement of GTP by its nonhydrolyzable analogue Gpp(NH)p resulted in a persistent hormone-independent activation of AC, and addition of hormones enhanced this level of activation. Thus, GTP-ase activity is present in macrophage membrane preparations and serves to regulate AC activation. Hormonal stimulation of AC was receptor mediated, because the effect of the beta-adrenergic agonist isoproterenol, but not PGE1, was inhibited by the beta-adrenergic blocker propranolol. In addition, the potency series of PG corresponded to that observed for stimulation of cAMP production in intact g.p. macrophages, i.e., PGE1 = PGE2 greater than PGA1 greater than PGF2 alpha. AC activation by PG in the membrane preparation was inhibited by an alpha-adrenergic agonist, thus demonstrating one means for down regulating cAMP production in g.p. macrophages. Our studies also showed that certain hormones (e.g., beta-adrenergic agonists, PG) can exert their effect on cAMP production by stimulation of membrane-bound AC, whereas other agents such as lectins or arachidonic acid require additional intracellular components to elevate cAMP levels in macrophages. The mechanism of activation of AC by hormones in g.p. macrophage membranes appears to fit the model of a ternary complex, the components of which include the hormone receptor, AC, and guanine nucleotide regulatory protein, which transmits the signal from the receptor to AC.
The metabolism of the calcium mobilizing inositol-1,4,5-trisphosphate (IP3) isomer was studied in myo- [3H]inositol labeled, chemoattractant-stimulated human polymorphonuclear neutrophils (PMNs), and in PMN lysates.It was determined that 1,4,5-IP3 is metabolized in vitro by two distinct pathways: 1) by sequential dephosphorylation to 1,4-IP2, 4-IP1, and inositol or 2) by ATP dependent conversion to 1,3,4,5-IP,, followed by dephosphorylation to form 1,3,4-IP3, 3,4-IPz, 3-IP1, and inositol.In PMNs stimulated with 0.1 PM N-formyl-methionyl-leucyl-phenylalanine (met-Leu-Phe), 1,4-IP2, 1,4,5-IP3, and IP,, were elevated by 5 s; whereas production of 1,3,4-IP3, 3,4-IPz, and IPI occurred only after an initial lag (-15 8).The predominant IP1 isomer formed in met-Leu-Phe-stimulatedcells was 4-IP1.Production of 1,3,4-IP3 and 3,4-IP2 was markedly reduced (17 and 35% of control, respectively) in met-Leu-Phe-stimulated cells pretreated to prevent a rise in intracellular calcium ([Ca2+Ii).PMNs were also stimulated with leukotriene B, (LTB,) since this agent is a poor activator of the respiratory burst compared to Met-Leu-Phe.Peak levels (5 s) of 1,4,5-IP3 were equivalent after stimulation with 0.1 p~ met-Leu-Phe versus 0.1 p~ LTB, (320 f 38% versus 378 2 38% of control values, respectively; n = 5); however, at 30 s, 1,4,5-IP3 remained elevated only in Met-Leu-Phe-stimulated cells.Similarly, elevation of [Ca2+Ii was more prolonged in re- sponse to 0.1 p~ met-Leu-Phe (>3 min) versus LTB, (1 min).Thus, signal transduction in PMNs may be modulated by both the duration of the initial 1,4,5-IP3 signal and by the metabolic pathway(s) utilized to convert this IP3 isomer to other, potentially active inositol phosphate products. Stimulation of polymorphonuclear leukocytes (PMNs)' by
Elevation of cAMP downregulates certain functions of inflammatory cells, including the release of TNF alpha and IL-1 beta by macrophages. Intracellular cAMP levels can be modulated pharmacologically by adding cell-permeable cAMP analogs, by stimulating adenylate cyclase or by inhibiting degradation of cAMP by cAMP-phosphodiesterases (cAMP-PDE). Multiple forms of cAMP-PDEs have been identified in various tissues and cells using both biochemical characterization and selective inhibitors. Therefore, we wanted to determine which of these different PDE isoforms was present in human monocytes and whether this isoform could regulate cytokine release from human monocytes by a mechanism similar to that seen with dbcAMP or PGE1. Our results demonstrate that selective inhibitors of type IV cAMP-PDE, such as rolipram and Ro20-1724, are clearly the most effective compounds at enhancing cAMP levels and inhibiting the release of TNF alpha and IL-1 beta in these cells. The type III cAMP-PDE-selective inhibitors C1930 and cilostamide and the nonselective PDE inhibitors IBMX and pentoxifylline were significantly less potent. In agreement with these data, cAMP-PDE activity in cytosolic extracts from human monocytes was also much more sensitive to inhibition by rolipram than by cilostamide. Additionally, rolipram dramatically reduced TNF alpha mRNA accumulation, which supports previous findings that cAMP regulates TNF alpha at the transcriptional level. Surprisingly, rolipram, rolipram, dbcAMP or PGE1 increased IL-1 beta was reduced, which indicates that cAMP can have both positive and negative effects on the regulation of IL-1 beta.(ABSTRACT TRUNCATED AT 250 WORDS)
