Elżbieta Pędziwiatr‐Werbicka

University of Łódź

Author Statistics

Papers

Citation

H-Index

i-10 index

Research Trends

Author Order

Document Type

Co-Authors

Maria Bryszewska

University of Łódź

F. Javier de la Mata

Universidad de Alcalá

Rafael Gómez

Universidad de Alcalá

Dzmitry Shcharbin

Institute of Biophysics and Cell Engineering

Barbara Klajnert‐Maculewicz

University of Łódź

MÁ

María Ángeles Muñoz‐Fernández

Hospital General Universitario Gregorio Marañón

Jean‐Pierre Majoral

Laboratoire de Chimie de Coordination

МЙ

Максим Йонов

University of Łódź

Volha Dzmitruk

Czech Academy of Sciences, Institute of Biotechnology

Javier Sánchez‐Nieves

Universidad de Alcalá

Cooperative Institutions

University of Łódź

Universidad de Alcalá

Biomedical Research Networking Center in Bioengineering, Biomaterials and Nanomedicine

Centre National de la Recherche Scientifique

National Academy of Sciences of Belarus

Institute of Biophysics and Cell Engineering

Instituto de Salud Carlos III

Instituto Ramón y Cajal de Investigación Sanitaria

Hospital General Universitario Gregorio Marañón

Laboratoire de Chimie de Coordination

Author Statistics

Papers

Citation

H-Index

i-10 index

Research Field

Nanoparticles in Combating Cancer: Opportunities and Limitations: A Brief Review

Current Medicinal Chemistry (2020)

Elżbieta Pędziwiatr‐Werbicka Katarzyna Horodecka Dzmitry Shcharbin Maria Bryszewska

Nanomedicine is a good alternative to traditional methods of cancer treatment but does not solve all the limitations of oncology. Nanoparticles used in anticancer therapy can work as carriers of drugs, nucleic acids, imaging agents or they can sensitize cells to radiation. The present review focuses on the application of nanoparticles to treating cancer, as well as on its problems and limitations. Using nanoparticles as drug carriers, significant improvement in the efficiency of transport of compounds and their targeting directly to the tumour has been achieved; it also reduces the side effects of chemotherapeutic drugs on the body. However, nanoparticles do not significantly improve the effectiveness of the chemotherapeutic agent itself. Most nanodrugs can reduce the toxicity of chemotherapy, but do not significantly affect the effectiveness of treatment. Nanodrugs should be developed that can be effective as an anti-metastatic treatment, e.g. by enhancing the ability of nanoparticles to transport chemotherapeutic loads to sentinel lymph nodes using the immune system and developing chemotherapy in specific metastatic areas. Gene therapy, however, is the most modern method of treating cancer, the cause of cancer being tackled by altering genetic material. Other applications of nanoparticles for radiotherapy and diagnostics are discussed.

10.2174/0929867327666200130101605

Cite

Citations (45)

Analysis of Interaction between Dendriplexes and Bovine Serum Albumin

Biomacromolecules (2007)

Dzmitry Shcharbin Elżbieta Pędziwiatr‐Werbicka Louis Chonco Jesús F. Bermejo-Martín Paula Ortega

Dendrimers are new nanotechnological carriers for gene delivery. Short oligodeoxynucleotides (ODNs) are a new class of antisense therapy drugs for cancer and infectious or metabolic diseases. The interactions between short oligodeoxynucleotides (GEM91, CTCTCGCACCCATCTCTCTCCTTCT; SREV, TCGTCGCTGTCTCCGCTTCTTCCTGCCA; unlabeled or fluorescein-labeled), novel water-soluble carbosilane dendrimers, and bovine serum albumin were studied by fluorescence and gel electrophoresis. The molar ratios of the dendrimer/ODN dendriplexes ranged from 4 to 7. The efficiency of formation and stability of the dendriplexes depended on electrostatic interactions between the dendrimer and the ODNs. Dendriplex formation significantly decreased the interactions between ODNs and albumin. Thus, the formation of dendriplexes between carbosilane dendrimers and ODNs may improve ODN delivery.

Bovine serum albumin

Serum Albumin

Human serum albumin

10.1021/bm070333p

Cite

Citations (53)

Antibacterial and antifungal properties of dendronized silver and gold nanoparticles with cationic carbosilane dendrons

International Journal of Pharmaceutics (2017)

Cornelia E. Peña‐González Elżbieta Pędziwiatr‐Werbicka Tania Martín‐Pérez Eligia M. Szewczyk José Luis Copa-Patiño

Cationic polymerization

Silver nanoparticle

Zeta potential

Thermogravimetric analysis

10.1016/j.ijpharm.2017.05.067

Cite

Citations (55)

Oleochemical‐Tethered SBA‐15‐Type Silicates with Tunable Nanoscopic Order, Carboxylic Surface, and Hydrophobic Framework: Cellular Toxicity, Hemolysis, and Antibacterial Activity

Chemistry - A European Journal (2014)

Elżbieta Pędziwiatr‐Werbicka Katarzyna Miłowska Marta Podlas Monika Marcinkowska Małgorzata Ferenc

Novel silicates were prepared by using silylated natural fatty acids (derived from triglyceride renewable oils) as co-condensing reagents in presence of tetraethyl orthosilicate (TEOS) and the triblock copolymer, pluronic P123, as a structure directing agent. A series of carboxylic acid functionalized SBA-15-type mesoporous silicates were obtained with tunable nanoscopic order and reactive functional groups that allow the conjugation of amino probes by peptide coupling. Photophysical studies of the covalently linked aminopyrene substantiated that the internal framework of these materials have pronounced hydrophobicity. Moreover, phase separation that can emanate from the bulkiness of the starting fatty silanes has been ruled out owing to the absence of excimers after aminopyrene grafting. The hemotoxicity, cytotoxicity, and antimicrobial activity of these novel silicates were then evaluated. Without discrimination, the functionalized silicates show a significant decrease of red blood cell hemolysis as compared to bare SBA-15-silica material. Within the modified silicate series, germanium-free mesoporous silicates induce only a slight decrease in cell viability and, more interestingly, they exhibit negligible hemolytic effect. Moreover, increasing their concentration in the medium reduces the concentration of released hemoglobin as a result of Hb adsorption. Promising antimicrobial properties were also observed for these silicates with a slight dependency on whether phenylgermanium fragments were present within the silicate framework.

10.1002/chem.201402583

Cite

Citations (17)

siRNA carriers based on carbosilane dendrimers affect zeta potential and size of phospholipid vesicles

Biochimica et Biophysica Acta (BBA) - Biomembranes (2012)

Максим Йонов Zuzana Garaiová Iveta Waczulı́ková Dominika Wróbel Elżbieta Pędziwiatr‐Werbicka

Zeta potential

10.1016/j.bbamem.2012.04.019

Cite

Citations (36)

Dendronized Gold Nanoparticles as Carriers for gp160 (HIV-1) Peptides: Biophysical Insight into Complex Formation

Langmuir (2021)

Zuzana Garaiová Sopio Melikishvili Sylwia Michlewska Максим Йонов Elżbieta Pędziwiatr‐Werbicka

The unavailability of effective and safe human immunodeficiency virus (HIV) vaccines incites several approaches for development of the efficient antigen/adjuvant vaccination composite. In this study, three different dendronized gold nanoparticles (AuNPs 13–15) were investigated for a complexation ability with gp160 synthetic peptides derived from an HIV envelope. It has been shown that HIV peptides interacted with nanoparticles as evident from the changes in their secondary structures, restricted the mobility of the attached fluorescence dye, and enhanced peptide helicity confirmed by the fluorescence polarization and circular dichroism results. Transmission electron microscopy visualized complexes as cloud-like structures with attached nanoparticles. AuNP 13–15 nanoparticles bind negatively charged peptides depending on the number of functional groups; the fastest saturation and peptide retardation were observed for the most dendronized nanoparticle as indicated from dynamic light scattering, laser Doppler velocimetry, and agarose gel electrophoresis experiments. Dendronized gold nanoparticles can be considered one of the potential HIV peptide-based vaccination platforms.

10.1021/acs.langmuir.0c03159

Cite

Citations (14)

Shielding siRNA by peptide-based nanofibers: An efficient approach for turning off EGFR gene in breast cancer

International Journal of Biological Macromolecules (2024)

Rosa Bellavita Simone Braccia Marialuisa Piccolo Piotr Białecki Maria Grazia Ferraro

10.1016/j.ijbiomac.2024.139219

Cite

Citations (0)

Binding of poly(amidoamine), carbosilane, phosphorus and hybrid dendrimers to thrombin—Constants and mechanisms

Colloids and Surfaces B Biointerfaces (2017)

Dzmitry Shcharbin Elżbieta Pędziwiatr‐Werbicka A. V. Vcherashniaya Anna Janaszewska Monika Marcinkowska

10.1016/j.colsurfb.2017.03.053

Cite

Citations (10)

Carbosilane Dendrimers are a Non-Viral Delivery System for Antisense Oligonucleotides: Characterization of Dendriplexes

Journal of Biomedical Nanotechnology (2012)

Elżbieta Pędziwiatr‐Werbicka Dzmitry Shcharbin Jan Malý Marek Malý Marian Zaborski

The success of gene therapy depends on the development of suitable carriers, and because of their architecture dendrimers are promising tools for gene delivery. This research concerns the use of second generation carbosilane dendrimers as carriers for anti-HIV oligodeoxynucleotides (ODNs). The aim was to characterize complexes formed by positively charged dendrimers and negatively charged oligonucleotides using a fluorescence method, laser Doppler electrophoresis, dynamic light scattering (DLS), atomic force microscopy (AFM), transmission electron microscopy (TEM) and molecular modeling. The zeta-potential of ODNs increased from -25 mV to positive values after the addition of dendrimers. DLS and TEM revealed that the diameters of dendriplexes ranged from 75 to 240 nm and from 50 to 260 nm, respectively, and this was dependent on the type of dendrimer and the molar ratios of the complexes formed; complexes were stable for between 100 and 300 minutes. AFM measurements and molecular modeling studies were carried out to determine the structure and size of dendriplexes. The physicochemical properties of the dendriplexes studied and data from previous research suggest that carbosilane dendrimers are good candidates for nucleic acid delivery.

Zeta potential

Hydrodynamic radius

10.1166/jbn.2012.1369

Cite

Citations (36)

Silver Nanoparticles Surface-Modified with Carbosilane Dendrons as Carriers of Anticancer siRNA

International Journal of Molecular Sciences (2020)

Elżbieta Pędziwiatr‐Werbicka Michał Gorzkiewicz Katarzyna Horodecka Viktar Abashkin Barbara Klajnert‐Maculewicz

Gene therapy is a promising approach in cancer treatment; however, current methods have a number of limitations mainly due to the difficulty in delivering therapeutic nucleic acids to their sites of action. The application of non-viral carriers based on nanomaterials aims at protecting genetic material from degradation and enabling its effective intracellular transport. We proposed the use of silver nanoparticles (AgNPs) surface-modified with carbosilane dendrons as carriers of anticancer siRNA (siBcl-xl). Using gel electrophoresis, zeta potential and hydrodynamic diameter measurements, as well as transmission electron microscopy, we characterized AgNP:siRNA complexes and demonstrated the stability of nucleic acid in complexes in the presence of RNase. Hemolytic properties of free silver nanoparticles and complexes, their effect on lymphocyte proliferation and cytotoxic activity on HeLa cells were also examined. Confocal microscopy proved the effective cellular uptake of complexes, indicating the possible use of this type of silver nanoparticles as carriers of genetic material in gene therapy.

HeLa

Zeta potential

Ethidium bromide

Silver nanoparticle

Nanomaterials

Surface Modification

10.3390/ijms21134647

Cite

Citations (22)