The deposition of extracellular β-amyloid peptide (Aβ) in the brain is a pathologic feature of Alzheimer's disease. The β-site amyloid precursor protein cleaving enzyme 1 (BACE1), an integral membrane aspartyl protease responsible for cleavage of amyloid precursor protein (APP) at the β-site, promotes Aβ production. A second integral membrane aspartyl protease related to BACE1, referred to as β-site amyloid precursor protein cleaving enzyme 2 (BACE2) has also been demonstrated to cleave APP at the β-cleavage site in transfected cells. The role of endogenous BACE2 in Aβ production remains unresolved. We investigated the role of endogenous BACE2 in Aβ production in cells by selective inactivation of its transcripts using RNA interference. We are able to reduce steady state levels for mRNA for each enzyme by >85%, and protein amounts by 88–94% in cells. Selective inactivation of BACE1 by RNA interference results in decreased β-cleaved secreted APP and Aβ peptide secretion from cells, as expected. Selective inactivation of BACE2 by RNAi results in increased β-cleaved secreted APP and Aβ peptide secretion from cells. Simultaneous targeting of both enzymes by RNA interference does not have any net effect on Aβ released from cells. Our observations of changes in APP metabolism and Aβ are consistent with a role of BACE2 in suppressing Aβ production in cells that co-express both enzymes. The deposition of extracellular β-amyloid peptide (Aβ) in the brain is a pathologic feature of Alzheimer's disease. The β-site amyloid precursor protein cleaving enzyme 1 (BACE1), an integral membrane aspartyl protease responsible for cleavage of amyloid precursor protein (APP) at the β-site, promotes Aβ production. A second integral membrane aspartyl protease related to BACE1, referred to as β-site amyloid precursor protein cleaving enzyme 2 (BACE2) has also been demonstrated to cleave APP at the β-cleavage site in transfected cells. The role of endogenous BACE2 in Aβ production remains unresolved. We investigated the role of endogenous BACE2 in Aβ production in cells by selective inactivation of its transcripts using RNA interference. We are able to reduce steady state levels for mRNA for each enzyme by >85%, and protein amounts by 88–94% in cells. Selective inactivation of BACE1 by RNA interference results in decreased β-cleaved secreted APP and Aβ peptide secretion from cells, as expected. Selective inactivation of BACE2 by RNAi results in increased β-cleaved secreted APP and Aβ peptide secretion from cells. Simultaneous targeting of both enzymes by RNA interference does not have any net effect on Aβ released from cells. Our observations of changes in APP metabolism and Aβ are consistent with a role of BACE2 in suppressing Aβ production in cells that co-express both enzymes. The production and deposition of insoluble Aβ 1The abbreviations used are: Aβ, β-amyloid peptide; APP, amyloid precursor protein; APPsw, Swedish mutant allele of APP; BACE, β-site APP cleaving enzyme; CTFs, carboxyl-terminal fragments; GFP, green fluorescent protein; RNAi, RNA interference; sAPP, secreted APP; sAPPβ, β-cleaved sAPP; sAPPα, α-cleaved sAPP; siRNA, small interfering RNA; wt, wild type; 293sw, HEK293 cells overexpressing APPsw; ELISA, enzyme-linked immunosorbent assay; RT, reverse transcription; sAPPtot, total sAPP.1The abbreviations used are: Aβ, β-amyloid peptide; APP, amyloid precursor protein; APPsw, Swedish mutant allele of APP; BACE, β-site APP cleaving enzyme; CTFs, carboxyl-terminal fragments; GFP, green fluorescent protein; RNAi, RNA interference; sAPP, secreted APP; sAPPβ, β-cleaved sAPP; sAPPα, α-cleaved sAPP; siRNA, small interfering RNA; wt, wild type; 293sw, HEK293 cells overexpressing APPsw; ELISA, enzyme-linked immunosorbent assay; RT, reverse transcription; sAPPtot, total sAPP. peptide in the brain results in the hallmark pathological feature of Alzheimer's disease (1Selkoe D.J. Podlisny M.B. Annu. Rev. Genomics Hum. Genet. 2002; 3: 67-99Crossref PubMed Scopus (253) Google Scholar). The cellular enzymes responsible for production of Aβ peptide are molecular targets for therapeutic intervention in Alzheimer's disease (2Vassar R. J. Mol. Neurosci. 2001; 17: 157-170Crossref PubMed Scopus (170) Google Scholar, 3De Strooper B. Konig G. Nature. 1999; 402: 471-472Crossref PubMed Scopus (49) Google Scholar). BACE1 (β-site APP cleaving enzyme, ASP2, Memapsin 2, β-secretase), the enzyme responsible for cleavage of the amyloid precursor protein (APP) resulting in the amino terminus of Aβ peptide, is a novel integral membrane aspartyl protease (4Hussain I. Powell D. Howlett D.R. Tew D.G. Meek T.D. Chapman C. Gloger I.S. Murphy K.E. Southan C.D. Ryan D.M. Smith T.S. Simmons D.L. Walsh F.S. Dingwall C. Christie G. Mol. Cell Neurosci. 1999; 14: 419-427Crossref PubMed Scopus (997) Google Scholar, 5Sinha S. Anderson J.P. Barbour R. Basi G.S. Caccavello R. Davis D. Doan M. Dovey H.F. Frigon N. Hong J. Jacobson-Croak K. Jewett N. Keim P. Knops J. Lieberburg I. Power M. Tan H. Tatsuno G. Tung J. Schenk D. Seubert P. Suomensaari S.M. Wang S. Walker D. John V. et al.Nature. 1999; 402: 537-540Crossref PubMed Scopus (1473) Google Scholar, 6Vassar R. Bennett B.D. Babu-Khan S. Kahn S. Mendiaz E.A. Denis P. Teplow D.B. Ross S. Amarante P. Loeloff R. Luo Y. Fisher S. Fuller J. Edenson S. Lile J. Jarosinski M.A. Biere A.L. Curran E. Burgess T. Louis J.C. Collins F. Treanor J. Rogers G. Citron M. Science. 1999; 286: 735-741Crossref PubMed Scopus (3268) Google Scholar, 7Yan R. Bienkowski M.J. Shuck M.E. Miao H. Tory M.C. Pauley A.M. Brashier J.R. Stratman N.C. Mathews W.R. Buhl A.E. Carter D.B. Tomasselli A.G. Parodi L.A. Heinrikson R.L. Gurney M.E. Nature. 1999; 402: 533-537Crossref PubMed Scopus (1328) Google Scholar, 8Lin X. Koelsch G. Wu S. Downs D. Dashti A. Tang J. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 1456-1460Crossref PubMed Scopus (738) Google Scholar). Cellular antisense (6Vassar R. Bennett B.D. Babu-Khan S. Kahn S. Mendiaz E.A. Denis P. Teplow D.B. Ross S. Amarante P. Loeloff R. Luo Y. Fisher S. Fuller J. Edenson S. Lile J. Jarosinski M.A. Biere A.L. Curran E. Burgess T. Louis J.C. Collins F. Treanor J. Rogers G. Citron M. Science. 1999; 286: 735-741Crossref PubMed Scopus (3268) Google Scholar, 7Yan R. Bienkowski M.J. Shuck M.E. Miao H. Tory M.C. Pauley A.M. Brashier J.R. Stratman N.C. Mathews W.R. Buhl A.E. Carter D.B. Tomasselli A.G. Parodi L.A. Heinrikson R.L. Gurney M.E. Nature. 1999; 402: 533-537Crossref PubMed Scopus (1328) Google Scholar) and knock-out mouse models (9Cai H. Wang Y. McCarthy D. Wen H. Borchelt D.R. Price D.L. Wong P.C. Nat. Neurosci. 2001; 4: 233-234Crossref PubMed Scopus (946) Google Scholar, 10Roberds S.L. Anderson J. Basi G. Bienkowski M.J. Branstetter D.G. Chen K.S. Freedman S.B. Frigon N.L. Games D. Hu K. Johnson-Wood K. Kappenman K.E. Kawabe T.T. Kola I. Kuehn R. Lee M. Liu W. Motter R. Nichols N.F. Power M. Robertson D.W. Schenk D. Schoor M. Shopp G.M. Shuck M.E. Sinha S. Svensson K.A. Tatsuno G. Tintrup H. Wijsman J. Wright S. McConlogue L. Hum. Mol. Genet. 2001; 10: 1317-1324Crossref PubMed Google Scholar, 11Luo Y. Bolon B. Kahn S. Bennett B.D. Babu-Khan S. Denis P. Fan W. Kha H. Zhang J. Gong Y. Martin L. Louis J.C. Yan Q. Richards W.G. Citron M. Vassar R. Nat. Neurosci. 2001; 4: 231-232Crossref PubMed Scopus (943) Google Scholar) have unambiguously confirmed the role of BACE1 in promoting Aβ production. A second integral membrane aspartyl protease related to BACE1, referred to as BACE2 (ASP1, Memapsin 1) has also been demonstrated to cleave APP at the β-cleavage site (7Yan R. Bienkowski M.J. Shuck M.E. Miao H. Tory M.C. Pauley A.M. Brashier J.R. Stratman N.C. Mathews W.R. Buhl A.E. Carter D.B. Tomasselli A.G. Parodi L.A. Heinrikson R.L. Gurney M.E. Nature. 1999; 402: 533-537Crossref PubMed Scopus (1328) Google Scholar, 8Lin X. Koelsch G. Wu S. Downs D. Dashti A. Tang J. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 1456-1460Crossref PubMed Scopus (738) Google Scholar, 12Saunders A.J. Kim T.-W. Tanzi R.E. Science. 1999; 286: 1255Crossref Google Scholar, 13Bennett B.D. Babu-Khan S. Loeloff R. Louis J.C. Curran E. Citron M. Vassar R. J. Biol. Chem. 2000; 275: 20647-20651Abstract Full Text Full Text PDF PubMed Scopus (254) Google Scholar, 14Hussain I. Powell D.J. Howlett D.R. Chapman G.A. Gilmour L. Murdock P.R. Tew D.G. Meek T.D. Chapman C. Schneider K. Ratcliffe S.J. Tattersall D. Testa T.T. Southan C. Ryan D.M. Simmons D.L. Walsh F.S. Dingwall C. Christie G. Mol. Cell Neurosci. 2000; 16: 609-619Crossref PubMed Scopus (143) Google Scholar, 15Acquati F. Accarino M. Nucci C. Fumagalli P. Jovine L. Ottolenghi S. Taramelli R. FEBS Lett. 2000; 468: 59-64Crossref PubMed Scopus (121) Google Scholar, 16Farzan M. Schnitzler C.E. Vasilieva N. Leung D. Choe H. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 9712-9717Crossref PubMed Scopus (345) Google Scholar). Both enzymes also cleave APP at a second site within the Aβ region. This second cleavage site for BACE1 is between Aβ residues 10 and 11 and between Aβ residues 19 and 20 for BACE2. Cleavage of APP by BACE1 at either site is amyloidogenic, whereas the second cleavage site for BACE2 on APP precludes formation of Aβ. Overexpression of BACE2 in transfected cells produces intracellular carboxyl-terminal fragments (CTFs), as well as release of β-cleaved secreted APP (sAPPβ) from cells, consistent with cleavage of APP at the β-site by this enzyme (14Hussain I. Powell D.J. Howlett D.R. Chapman G.A. Gilmour L. Murdock P.R. Tew D.G. Meek T.D. Chapman C. Schneider K. Ratcliffe S.J. Tattersall D. Testa T.T. Southan C. Ryan D.M. Simmons D.L. Walsh F.S. Dingwall C. Christie G. Mol. Cell Neurosci. 2000; 16: 609-619Crossref PubMed Scopus (143) Google Scholar, 16Farzan M. Schnitzler C.E. Vasilieva N. Leung D. Choe H. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 9712-9717Crossref PubMed Scopus (345) Google Scholar, 17Ehehalt R. Michel B. De Pietri Tonelli D. Zacchetti D. Simons K. Keller P. Biochem. Biophys. Res. Commun. 2002; 293: 30-37Crossref PubMed Scopus (53) Google Scholar, 18Fluhrer R. Capell A. Westmeyer G. Willem M. Hartung B. Condron M.M. Teplow D.B. Haass C. Walter J. J. Neurochem. 2002; 81: 1011-1020Crossref PubMed Scopus (97) Google Scholar, 19Yan R. Munzner J.B. Shuck M.E. Bienkowski M.J. J. Biol. Chem. 2001; 276: 34019-34027Abstract Full Text Full Text PDF PubMed Scopus (147) Google Scholar). We have also observed decreased Aβ production from cells transfected with BACE2 (not shown), consistent with published observations (14Hussain I. Powell D.J. Howlett D.R. Chapman G.A. Gilmour L. Murdock P.R. Tew D.G. Meek T.D. Chapman C. Schneider K. Ratcliffe S.J. Tattersall D. Testa T.T. Southan C. Ryan D.M. Simmons D.L. Walsh F.S. Dingwall C. Christie G. Mol. Cell Neurosci. 2000; 16: 609-619Crossref PubMed Scopus (143) Google Scholar, 16Farzan M. Schnitzler C.E. Vasilieva N. Leung D. Choe H. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 9712-9717Crossref PubMed Scopus (345) Google Scholar, 17Ehehalt R. Michel B. De Pietri Tonelli D. Zacchetti D. Simons K. Keller P. Biochem. Biophys. Res. Commun. 2002; 293: 30-37Crossref PubMed Scopus (53) Google Scholar, 18Fluhrer R. Capell A. Westmeyer G. Willem M. Hartung B. Condron M.M. Teplow D.B. Haass C. Walter J. J. Neurochem. 2002; 81: 1011-1020Crossref PubMed Scopus (97) Google Scholar, 19Yan R. Munzner J.B. Shuck M.E. Bienkowski M.J. J. Biol. Chem. 2001; 276: 34019-34027Abstract Full Text Full Text PDF PubMed Scopus (147) Google Scholar). Hence, the reduction in secreted Aβ occurs in spite of the concomitant increased secretion of sAPPβ from cells overexpressing BACE2. The decrease in Aβ production from BACE2 transfected cells has been attributed to the second cleavage site for BACE2 on APP (14Hussain I. Powell D.J. Howlett D.R. Chapman G.A. Gilmour L. Murdock P.R. Tew D.G. Meek T.D. Chapman C. Schneider K. Ratcliffe S.J. Tattersall D. Testa T.T. Southan C. Ryan D.M. Simmons D.L. Walsh F.S. Dingwall C. Christie G. Mol. Cell Neurosci. 2000; 16: 609-619Crossref PubMed Scopus (143) Google Scholar, 16Farzan M. Schnitzler C.E. Vasilieva N. Leung D. Choe H. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 9712-9717Crossref PubMed Scopus (345) Google Scholar, 17Ehehalt R. Michel B. De Pietri Tonelli D. Zacchetti D. Simons K. Keller P. Biochem. Biophys. Res. Commun. 2002; 293: 30-37Crossref PubMed Scopus (53) Google Scholar, 18Fluhrer R. Capell A. Westmeyer G. Willem M. Hartung B. Condron M.M. Teplow D.B. Haass C. Walter J. J. Neurochem. 2002; 81: 1011-1020Crossref PubMed Scopus (97) Google Scholar, 19Yan R. Munzner J.B. Shuck M.E. Bienkowski M.J. J. Biol. Chem. 2001; 276: 34019-34027Abstract Full Text Full Text PDF PubMed Scopus (147) Google Scholar). The observations on the cleavage specificity of BACE2 on APP substrate are derived from transfected cells that overexpress the enzyme. The role of BACE2 in Aβ production in cells expressing endogenous levels of the enzyme remains an unanswered question. Many tissues (including brain) and cell types co-express BACE1 and BACE2 mRNA (8Lin X. Koelsch G. Wu S. Downs D. Dashti A. Tang J. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 1456-1460Crossref PubMed Scopus (738) Google Scholar, 13Bennett B.D. Babu-Khan S. Loeloff R. Louis J.C. Curran E. Citron M. Vassar R. J. Biol. Chem. 2000; 275: 20647-20651Abstract Full Text Full Text PDF PubMed Scopus (254) Google Scholar, 14Hussain I. Powell D.J. Howlett D.R. Chapman G.A. Gilmour L. Murdock P.R. Tew D.G. Meek T.D. Chapman C. Schneider K. Ratcliffe S.J. Tattersall D. Testa T.T. Southan C. Ryan D.M. Simmons D.L. Walsh F.S. Dingwall C. Christie G. Mol. Cell Neurosci. 2000; 16: 609-619Crossref PubMed Scopus (143) Google Scholar, 16Farzan M. Schnitzler C.E. Vasilieva N. Leung D. Choe H. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 9712-9717Crossref PubMed Scopus (345) Google Scholar). The therapeutic relevance of inhibiting one, the other, or both enzymes for Aβ production in cells/tissues that co-express the two enzymes also remains an unanswered question. RNA interference (RNAi) is the process whereby double-stranded RNA mediates the sequence specific destruction of its cognate mRNA (20Hannon G.J. Nature. 2002; 478: 244-251Crossref Scopus (3497) Google Scholar, 21Sharp P.A. Genes Dev. 2001; 15: 485-490Crossref PubMed Scopus (657) Google Scholar, 22Zamore P.D. Nat. Struct. Biol. 2001; 8: 746-750Crossref PubMed Scopus (333) Google Scholar). RNAi is triggered by 21–23-nucleotide synthetic double-stranded RNAs termed small interfering RNA (siRNAs, we use “oligonucleotide” synonymously with siRNA in this report for convenience) in mammalian cells (23Elbashir S.M. Harborth J. Lendeckel W. Yalcin A. Weber K. Tuschl T. Nature. 2001; 411: 494-498Crossref PubMed Scopus (8105) Google Scholar, 24Caplen N.J. Parrish S. Imani F. Fire A. Morgan R.A. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 9742-9747Crossref PubMed Scopus (924) Google Scholar, 25Paddison P.J. Caudy A.A. Hannon G.J. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 1443-1448Crossref PubMed Scopus (497) Google Scholar). We report here the selective knock-down of endogenous BACE1 or BACE2 message as well as protein by RNAi in HEK293 cell lines stably overexpressing APP695wt (wild type allele) or APPsw, the familial Alzheimer's disease allele of APP (the K595M,N596L Swedish double mutant). The selective knock-down of either enzyme leads to complementary alterations in APP metabolites and Aβ peptide secreted from cells. Our studies suggest that BACE2 inhibition elevates secretion of Aβ in cells co-expressing BACE1 and BACE2 and are of significance for amyloid-based therapeutics targeting these enzymes. Quantitative PCR—For RNA analysis, total RNA was prepared from cells at various time points post-transfection using Qiagen RNAeasy total RNA extraction kits. Total RNA was treated with DNase and quantitated by absorbance before quantitative PCR assay. Absence of contaminating DNA in the final RNA preparations was confirmed by a PCR assay with input RNA as template, omitting the reverse transcriptase. Quantitative RT-PCR was performed using an ABI 7700 Sequence Detector. All of the samples were assayed in triplicate. BACE1 primers, 5′-CCCGAAAACGAATTGGCTTT and 3′-GCTGCCGTCCTGAACTCATC, and probe, CTGTCAGCGCTTGCCATGTGCA; and BACE2 primers, 5′-CGTTTTCTCCATGCAGATGTGT and 3′-CCTCCGTTGGTCCCAGATC, and probe, AGCCGGCTTGCCCGTTGCT. Standard curves for BACE1 and 2 in HEK293 cells treated with siRNAs, as well as in primary brain cultures, were obtained using serial dilution of total RNA from untreated HEK293 cells. BACE message values per ng of input RNA were normalized to GAPDH message per ng of input RNA for each sample. BACE1 and 2 mRNA levels in cell lines were determined with standard curves using an in vitro synthesized RNA transcript as the standard. RNAi-mediated Knock-down of BACE1 and BACE2 in HEK293 Cells—The synthetic siRNAs to BACE1 used in this study are: B1 sense, CAGGAUCUGAAAAUGGACUGtt; B1 anti-sense, CAGUCCAUUUUCAGAUCCUGtt; B2 sense, UCUACGUUGUCUUUGAUCGGtt; B2 antisense, CCGAUCAAAGACAACGUAGAtt; B3 sense, CAGACGCUCAACAUCCUGGUtt; and B3 antisense, ACCAGGAUGUUGAGCGUCUGtt. The siRNAs to BACE2 used in this study are: C1 sense, GUGGGCAUGGGCGCACUGGtt; C1 antisense, CCAGUGCGCCCAUGCCCACtt; C3 sense, ACAGAGAGGUCUAGCACAUtt; C3 antisense, AUGUGCUAGACCUCUCUGUtt; C4 sense, UUGAAUCAGAGAAUUUCUUtt; and C4 antisense, AAGAAAUUCUCUGAUUCAAtt. These siRNA were synthesized and used essentially as described (23Elbashir S.M. Harborth J. Lendeckel W. Yalcin A. Weber K. Tuschl T. Nature. 2001; 411: 494-498Crossref PubMed Scopus (8105) Google Scholar). HEK293 cells stably transfected with wild type APP695 (Amy5) (26Selkoe D.J. Podlisny M.B. Joachim C.L. Vickers E.A. Lee G. Fritz L.C. Oltersdorf T. Proc. Natl. Acad. Sci. U. S. A. 1988; 85: 7341-7345Crossref PubMed Scopus (539) Google Scholar) or APP695sw (293sw) were plated at a density of 200,000 cells/well in 24-well plates the morning of transfection and allowed to settle for 5 h prior to transfection. The Cells were transfected overnight with 200 ng of double-stranded RNA/well using Lipofectamine 2000® (Invitrogen) per the manufacturer's instructions. For quantitative analysis of APP metabolites and Aβ production in cells, all of the transfections were performed in triplicate, and the samples were assayed independently. For the experiment shown in Fig. 5, transfections with a combination of BACE1 and BACE2 oligonucleotides were conducted with 100 ng of each oligonucleotide, for a total of 200 ng of oligonucleotide/transfection (standard conditions) or 20 ng of total oligonucleotide (0.1× condition). No additional carrier nucleic acid was added for the 0.1× transfections. BACE1 and 2 protein knock-down was confirmed by co-transfecting siRNAs with 0.8-μg plasmid expression vectors encoding BACE1 or BACE2-Fc. Western Blot Analysis and Aβ Measurement in Transfected Cells— For protein knock-down studies, the cell lysates and conditioned media were collected at 48 h post-transfection. The cells were lysed in phosphate-buffered saline with 0.5% Nonidet P-40 supplemented with complete protease inhibitor mixture (Roche Applied Science) and analyzed by Western blot with the antibodies as noted below. Protein concentration in lysates was determined by BCA assay (Pierce). Fresh conditioned medium was collected from cells for 4 h at 2 days post-transfection by replacing transfection medium, and 10–20 μl/lane (normalized for protein concentration of the cognate lysate) were loaded onto gels for Western blot analysis. APP metabolites were detected with the antibodies previously described. Briefly, we used 8E5 for total sAPP (27Games D. Adams D. Alessandrini R. Barbour R. Berthelette P. Blackwell C. Carr T. Clemens J. Donaldson T. Gillespie F. Guido T. Hagopian S. Johnson-Wood K. Khan K. Lee M. Leibowitz P. Lieberburg I. Little S. Masliah E. McConlogue L. Montoya-Zavala M. Mucke L. Paganini L. Penniman E. Nature. 1995; 373: 523-527Crossref PubMed Scopus (2227) Google Scholar), anti-6 for intracellular mature APP, as well as intracellular CTFs (28Oltersdorf T. Ward P.J. Henriksson T. Beattie E.C. Neve R.L. Lieberburg I. Fritz L.C. J. Biol. Chem. 1990; 265: 4492-4497Abstract Full Text PDF PubMed Google Scholar), and 192wt and 192sw for sAPPβ species produced from APPwt and APPsw, respectively (29Seubert P. Oltersdorf T. Lee M.G. Barbour R. Blomquist C. Davis D.L. Bryant K. Fritz L.C. Galasko D. Thal L.J. Lieberburg I. Schenk D.B. Nature. 1993; 361: 260-263Crossref PubMed Scopus (499) Google Scholar). The mouse monoclonal 7A6, preferentially recognizing the sAPPα neoepitope, was produced using peptide CEVHHQK (residues 607–612 from APP695/Aβ residues 11–16), coupled via the amino-terminal cysteine residue to sheep anti-mouse IgG as immunogen. Hybridomas from mice immunized with this peptide were screened for reactivity to peptide sequence CGGYEVHHQK (Aβ residues 10–16). Hybridoma clone 7A6 showed stronger reactivity toward the Aβ10–16 peptide than to a peptide spanning the α-secretase cleavage site (Aβ residues 1–28). A quantitation of the difference in reactivity of 7A6 toward the two peptides, presented in the supplemental figure, shows that 7A6 reactivity toward sAPP in conditioned medium is competed 100% by the immunizing peptide at 100 μg/ml but only partially by the overlapping peptide at 100 μg/ml. Competition by 10 μg/ml Aβ 11–16 is approximately equal to the level of competition seen with 100 μg/ml Aβ 1–28. The result presented in the supplemental figure indicates that 7A6 binds with ∼10 times greater preference to the sAPPα neo-epitope (ending at Aβ residue 16) than it does to a peptide which spans this site. Hence, although 7A6 is not expected to detect the sAPP species from BACE2 cleavage at Aβ residues 19 and 20 by virtue of the immunogen against which it was raised, it can potentially detect sAPP species extending beyond Aβ residue 16 because of a 10-fold weaker reactivity for residues between Aβ11 and Aβ16. Further characterization of monoclonal 7A6 included the ability to capture iodinated Aβ10–16 peptide. Total Aβ was quantitated by sandwich ELISA using monoclonal antibody 266-coated microtiter plates followed by biotinylated 3D6 as secondary reporter (30Johnson-Wood K. Lee M. Motter R. Hu K. Gordon G. Barbour R. Khan K. Gordon M. Tan H. Games D. Lieberburg I. Schenk D. Seubert P. McConlogue L. Proc. Natl. Acad. Sci. Usa. 1997; 94: 1550-1555Crossref PubMed Scopus (582) Google Scholar). This assay measures all Aβ species starting at position 1 and extending beyond position 28 (i.e. Aβ 1–x). Statistical analysis of Aβ values was performed using StatView software package (SAS, Cary, NC). All of the samples were analyzed by analysis of variance, followed by post-hoc analysis using Fischer's protected least significant difference test to determine p values, comparing the means of the normalized Aβ values of each treatment group to the mean of the normalized Aβ value from the no treatment control group and also to the mean of the normalized Aβ value from the lamin and GFP control groups. BACE1 protein expression was detected by rabbit polyclonal antisera 264 (immunized with a peptide corresponding to BACE1 residues 48–66 of the nascent polypeptide). BACE2 protein was detected as a chimeric Fc construct (residues 1–465 of BACE2 extracellular domain fused to H-CH2-CH3 domains of human Cγ1) followed by an horseradish peroxidase-conjugated goat anti-human IgG (Jackson Immunoresearch) to detect and quantify suppression of transfected BACE2. Parallel blots from equivalently loaded gels were probed with antibody to β-tubulin (Sigma) to confirm specificity of siRNAs for the targeted protein, as well as equal sample loading. BACE1 and BACE2 mRNA Are Co-expressed in Cells—A quantitative RT-PCR survey of different cell types reveals the co-expression of mRNA for BACE1 and BACE2 enzymes in a variety of cell lines (Fig. 1A). Of the brain cell types surveyed, we observed co-expression of the mRNA for both enzymes in astrocytes, whereas BACE1 was exclusively expressed in neurons and microglia (Fig. 1B). Oligodendrocyte precursor cells (purified from rat optic nerve) do not express detectable levels of either message (not shown). Although a discrepancy has been noted with regard to message and activity distribution of BACE1 (5Sinha S. Anderson J.P. Barbour R. Basi G.S. Caccavello R. Davis D. Doan M. Dovey H.F. Frigon N. Hong J. Jacobson-Croak K. Jewett N. Keim P. Knops J. Lieberburg I. Power M. Tan H. Tatsuno G. Tung J. Schenk D. Seubert P. Suomensaari S.M. Wang S. Walker D. John V. et al.Nature. 1999; 402: 537-540Crossref PubMed Scopus (1473) Google Scholar, 6Vassar R. Bennett B.D. Babu-Khan S. Kahn S. Mendiaz E.A. Denis P. Teplow D.B. Ross S. Amarante P. Loeloff R. Luo Y. Fisher S. Fuller J. Edenson S. Lile J. Jarosinski M.A. Biere A.L. Curran E. Burgess T. Louis J.C. Collins F. Treanor J. Rogers G. Citron M. Science. 1999; 286: 735-741Crossref PubMed Scopus (3268) Google Scholar), we note that mRNA degradation is directly linked with protein expression, as well as with APP metabolite production, in our experiments using RNAi (see below) in HEK293 cells. siRNAs to BACE1 and BACE2 Reduce Expression of the Cognate Protein and mRNA in a Sequence-specific Manner—A detailed comparison of residue specificity between 8 substrate subsites spanning P4–P4′ revealed a very high degree of similarity between BACE1 and 2 (31Turner 3rd, R.T. Loy J.A. Nguyen C. Devasamudram T. Ghosh A.K. Koelsch G. Tang J. Biochemistry. 2002; 41: 8742-8746Crossref PubMed Scopus (56) Google Scholar, 32Turner III, R.T. Koelsch G. Hong L. Castanheira P. Ermolieff J. Ghosh A.K. Tang J. Castenheira P. Ghosh A. Biochemistry. 2001; 40: 10001-10006Crossref PubMed Scopus (196) Google Scholar), underscoring the challenge in obtaining selective small molecule inhibitors. Hence, we addressed the role of BACE1 and BACE2 in Aβ production in HEK293 cells (a cell type that expresses message for both enzymes, labeled as A293 in Fig. 1A) by selective degradation of mRNA for each enzyme using RNAi. Synthetic siRNAs to BACE1 and BACE2 (“Experimental Procedures”) were tested for activity in an overexpression paradigm by co-transfecting HEK293 cells with the double-stranded RNAs along with BACE1 or BACE2-Fc expression vectors. Expression of BACE1 and BACE2-Fc in lysates from transfected cells was assessed by Western blot analysis. The results, shown in Fig. 2, indicate that BACE1 expression is reduced specifically by oligonucleotide B3, and BACE2-Fc expression is reduced specifically by oligonucleotide C3. Expression of BACE1 is not affected by an irrelevant lamin A/C oligonucleotide (23Elbashir S.M. Harborth J. Lendeckel W. Yalcin A. Weber K. Tuschl T. Nature. 2001; 411: 494-498Crossref PubMed Scopus (8105) Google Scholar) nor any of the BACE2 oligonucleotides tested. Likewise, BACE2 expression is not affected by any of the BACE1 oligonucleotides tested nor by irrelevant oligonucleotides targeting lamin A/C or GFP. We further characterized the specificity as well as the kinetics of the active siRNAs B3 (anti-BACE1) and C3 (anti-BACE2) for degradation of the cognate mRNA in 293sw cells. Total RNA was isolated from 293sw cells (expressing endogenous levels of BACE1 and BACE2) at varying time points following transfection with oligonucleotides B3, C3, or B3+C3, and mRNA levels were measured by quantitative RT-PCR. Lamin siRNA was used as a specificity control. The results from this experiment, shown in Fig. 3, confirm the specificity and reveal the kinetics of message degradation mediated by the siRNAs. The lamin A/C oligonucleotide does not affect BACE1 message over the 72-h time course surveyed (Fig. 3A). BACE2 message is likewise unaffected by the lamin oligonucleotide up to 48 h (Fig. 3B). Although BACE2 mRNA is reduced 50% at 72 h post-transfection by the lamin oligonucleotide, we note that our experiments assayed the effect of RNAi against BACE2 at 48 h post-transfection. BACE1 message is not affected by the active C3 oligonucleotide targeting BACE2 (Fig. 3A), nor is BACE2 message affected by the active BACE1 oligonucleotide B3 (Fig. 3D). Degradation of both transcripts by the respective oligonucleotides is evident within 6 h post-transfection (Fig. 3, B and C). BACE2 mRNA is suppressed 90% by 12 h post-transfection and remains suppressed for at least 72 h (3B, 3D). BACE1 message suppression appears less robust (∼60% suppression at 12 h) and more transient in comparison (return to base line by 72 h; Fig. 3C). In cells transfected simultaneously with both oligonucleotides, suppression of BACE1 mRNA at time points earlier than 48 h is attenuated when compared with BACE2 mRNA suppression (Fig. 3, C and D). Furthermore, the overall potency of the RNAi response to each target appeared to be attenuated when cells were treated with both oligonucleotides (see legend to Fig. 3). Extracts from cells transiently transfected with B3 siRNA plus BACE1 expression plasmid or C3 siRNA plus BACE2-Fc expression plasmid were analyzed by quantitative Western blots to determine the magnitude of protein suppression in an overexpression paradigm. Our results, shown in Fig. 4, indicate that BACE1 expression is reduced at least 8–16-fold (Fig. 4, A and B), whereas BACE2 is suppressed at least 16-fold (Fig. 4C). In summary, RNAi mediated suppression of BACE1 by oligonucleotide B3 and that of BACE2 by oligonucleotide C3 are highly sequence-specific. In addition, mRNA degradation correlates with a suppression of the cognate overexpressed protein. BACE1 and BACE2 Knock-down Alters APP Metabolites Released from Cells—The consequence of knocking down endogenous BACE2 or BACE1 on APP metabolism and Aβ production was studied in stably transfected cells overexpressing APPsw (293sw cells; Fig. 5) or APP695wt (Amy5 cells; Fig. 6). The high level of APP expression in these cells facilitates detection of metabolites produced by the two enzym
Inhibition of gamma-secretase presents a direct target for lowering Aβ production in the brain as a therapy for Alzheimer's disease (AD). However, gamma-secretase is known to process multiple substrates in addition to amyloid precursor protein (APP), most notably Notch, which has limited clinical development of inhibitors targeting this enzyme. It has been postulated that APP substrate selective inhibitors of gamma-secretase would be preferable to non-selective inhibitors from a safety perspective for AD therapy.In vitro assays monitoring inhibitor potencies at APP γ-site cleavage (equivalent to Aβ40), and Notch ε-site cleavage, in conjunction with a single cell assay to simultaneously monitor selectivity for inhibition of Aβ production vs. Notch signaling were developed to discover APP selective gamma-secretase inhibitors. In vivo efficacy for acute reduction of brain Aβ was determined in the PDAPP transgene model of AD, as well as in wild-type FVB strain mice. In vivo selectivity was determined following seven days x twice per day (b.i.d.) treatment with 15 mg/kg/dose to 1,000 mg/kg/dose ELN475516, and monitoring brain Aβ reduction vs. Notch signaling endpoints in periphery.The APP selective gamma-secretase inhibitors ELN318463 and ELN475516 reported here behave as classic gamma-secretase inhibitors, demonstrate 75- to 120-fold selectivity for inhibiting Aβ production compared with Notch signaling in cells, and displace an active site directed inhibitor at very high concentrations only in the presence of substrate. ELN318463 demonstrated discordant efficacy for reduction of brain Aβ in the PDAPP compared with wild-type FVB, not observed with ELN475516. Improved in vivo safety of ELN475516 was demonstrated in the 7d repeat dose study in wild-type mice, where a 33% reduction of brain Aβ was observed in mice terminated three hours post last dose at the lowest dose of inhibitor tested. No overt in-life or post-mortem indications of systemic toxicity, nor RNA and histological end-points indicative of toxicity attributable to inhibition of Notch signaling were observed at any dose tested.The discordant in vivo activity of ELN318463 suggests that the potency of gamma-secretase inhibitors in AD transgenic mice should be corroborated in wild-type mice. The discovery of ELN475516 demonstrates that it is possible to develop APP selective gamma-secretase inhibitors with potential for treatment for AD.
In addition to parenchymal amyloid-beta (Abeta) plaques, Alzheimer's disease (AD) is characterized by Abeta in the cerebral vasculature [cerebral amyloid angiopathy (CAA)] in the majority of patients. Recent studies investigating vascular Abeta (VAbeta) in amyloid precursor protein transgenic mice have suggested that passive immunization with anti-Abeta antibodies may clear parenchymal amyloid but increase VAbeta and the incidence of microhemorrhage. However, the influences of antibody specificity and exposure levels on VAbeta and microhemorrhage rates have not been well established, nor has any clear causal relationship been identified. This report examines the effects of chronic, passive immunization on VAbeta and microhemorrhage in PDAPP mice by comparing antibodies with different Abeta epitopes (3D6, Abeta(1-5); 266, Abeta(16-23)) and performing a 3D6 dose-response study. VAbeta and microhemorrhage were assessed using concomitant Abeta immunohistochemistry and hemosiderin detection. 3D6 prevented or cleared VAbeta in a dose-dependent manner, whereas 266 was without effect. Essentially complete absence of VAbeta was observed at the highest 3D6 dose, whereas altered morphology suggestive of ongoing clearance was seen at lower doses. The incidence of microhemorrhage was increased in the high-dose 3D6 group and limited to focal, perivascular sites. These colocalized with Abeta deposits having altered morphology and apparent clearance in the lower-dose 3D6 group. Our results suggest that passive immunization can reduce VAbeta levels, and modulating antibody dose can significantly mitigate the incidence of microhemorrhage while still preventing or reducing VAbeta. These observations raise the possibility that Abeta immunotherapy can potentially slow or halt the course of CAA development in AD that is implicated in vascular dysfunction.
The biopharmaceutical industry is transitioning from currently deployed batch-mode bioprocessing to a highly efficient and agile next-generation bioprocessing with the adaptation of continuous bioprocessing, which reduces capital investment and operational costs. Continuous bioprocessing, aligned with FDA's quality-by-design platform, is designed to develop robust processes to deliver safe and effective drugs. With the deployment of knowledge-based operations, product quality can be built into the process to achieve desired critical quality attributes (CQAs) with reduced variability. To facilitate next-generation continuous bioprocessing, it is essential to embrace a fundamental shift-in-paradigm from "quality-by-testing" to "quality-by-design," which requires the deployment of process analytical technologies (PAT). With the adaptation of PAT, a systematic approach of process and product understanding and timely process control are feasible. Deployment of PAT tools for real-time monitoring of CQAs and feedback control is critical for continuous bioprocessing. Given the current deficiency in PAT tools to support continuous bioprocessing, we have integrated Infinity 2D-LC with a post-flow-splitter in conjunction with the SegFlow autosampler to the bioreactors. With this integrated system, we have established a platform for online measurements of titer and CQAs of monoclonal antibodies as well as amino acid analysis of bioreactor cell culture.
The biopharmaceutical industry is transitioning from currently deployed batch-mode bioprocessing to a highly efficient and agile next generation bioprocessing with the adaptation of continuous bioprocessing, which reduces the capital investment and operational costs. Continuous bioprocessing, aligned with FDA’s quality-by-design (QbD) platform, is designed to develop robust processes to deliver safe and effective drugs. With the deployment of knowledge based operations, product quality can be built into the process to achieve desired critical quality attributes (CQAs) with reduced variability. To facilitate next generation continuous bio-processing, it is essential to embrace a fundamental shift-in-paradigm from “quality-by-testing” to “quality-by-design”, which requires the deployment of process analytical technologies (PAT). With the adaptation of PAT, a systematic approach of process and product understanding and timely process control are feasible. Deployment of PAT tools for real-time monitoring of CQAs and feedback control is critical for continuous bioprocessing. Given the current deficiency in PAT tools to support continuous bioprocessing, we have integrated Agilent 2D-LC with a post-flow-splitter in conjunction with the SegFlow automated sampler to the bioreactors. With this integrated system, we have established a platform for online measurements of titer and CQAs of monoclonal antibodies (mAbs) as well as amino acid concentrations of bioreactor cell culture.
Currently, there is no biochemical marker clinically available to test for the presence of Alzheimer's disease (AD). Recent studies suggest that the core component of AD-associated neurofibrillary tangles (NFTs), the microtubule-associated protein tau, might be present in CSF. This study focuses on establishing both the presence of tau in CSF and its potential utility in the diagnosis of AD. We obtained CSF from 181 individuals; 71 of these were diagnosed as having probable AD by NINCDS-ADRDA criteria. The remaining 110 individuals were divided into three groups: (1) age-matched demented non-AD patients (n = 25), (2) neurologic controls (n = 59), and (3) other controls (n = 26). We developed a sensitive enzyme-linked immunosorbent tau assay using monoclonal antibodies prepared against recombinant human tau. We confirmed specificity of the antibodies by a combination of immunoprecipitation and immunoblot results. By this assay we measured that the AD population has a mean level of tau 50% greater than the non-AD dementia patients. Comparing AD patients with all other groups, the difference in tau levels as analyzed by one-way ANOVA is highly statistically significant (p < 0.001). Postmortem analysis of two AD patients with high levels of CSF tau revealed a high density of NFTs in the hippocampus. There was no significant correlation between tau and age in the non-AD groups. This study suggests that CSF tau is elevated in AD and might be a useful aid in antemortem diagnosis.
Neurodegenerative disorders such as Parkinson's Disease (PD), PD dementia (PDD) and Dementia with Lewy bodies (DLB) are characterized by progressive accumulation of α-synuclein (α-syn) in neurons. Recent studies have proposed that neuron-to-neuron propagation of α-syn plays a role in the pathogenesis of these disorders. We have previously shown that antibodies against the C-terminus of α-syn reduce the intra-neuronal accumulation of α-syn and related deficits in transgenic models of synucleinopathy, probably by abrogating the axonal transport and accumulation of α-syn in in vivo models. Here, we assessed the effect of passive immunization against α-syn in a new mouse model of axonal transport and accumulation of α-syn. For these purpose, non-transgenic, α-syn knock-out and mThy1-α-syn tg (line 61) mice received unilateral intra-cerebral injections with a lentiviral (LV)-α-syn vector construct followed by systemic administration of the monoclonal antibody 1H7 (recognizes amino acids 91-99) or control IgG for 3 months. Cerebral α-syn accumulation and axonopathy was assessed by immunohistochemistry and effects on behavior were assessed by Morris water maze. Unilateral LV-α-syn injection resulted in axonal propagation of α-syn in the contra-lateral site with subsequent behavioral deficits and axonal degeneration. Passive immunization with 1H7 antibody reduced the axonal accumulation of α-syn in the contra-lateral side and ameliorated the behavioral deficits. Together this study supports the notion that immunotherapy might improve the deficits in models of synucleinopathy by reducing the axonal propagation and accumulation of α-syn. This represents a potential new mode of action through which α-syn immunization might work.
The monoclonal antibody 2A4 binds an epitope derived from a cleavage site of serum amyloid protein A (sAA) containing a -Glu-Asp- amino acid pairing. In addition to its reactivity with sAA amyloid deposits, the antibody was also found to bind amyloid fibrils composed of immunoglobulin light chains. The antibody binds to synthetic fibrils and human light chain (AL) amyloid extracts with high affinity even in the presence of soluble light chain proteins. Immunohistochemistry with biotinylated 2A4 demonstrated positive reaction with ALκ and ALλ human amyloid deposits in various organs. Surface plasmon resonance analyses using synthetic AL fibrils as a substrate revealed that 2A4 bound with a K(D) of ∼10 nM. Binding was inhibited in the presence of the -Glu-Asp- containing immunogen peptide. Radiolabeled 2A4 specifically localized with human AL amyloid extracts implanted in mice (amyloidomas) as evidenced by single photon emission (SPECT) imaging. Furthermore, co-localization of the radiolabeled mAb with amyloid was shown in biodistribution and micro-autoradiography studies. Treatment with 2A4 expedited regression of ALκ amyloidomas in mice, likely mediated by the action of macrophages and neutrophils, relative to animals that received a control antibody. These data indicate that the 2A4 mAb might be of interest for potential imaging and immunotherapy in patients with AL amyloidosis.
