Preadaptation is suggested as the best method of accounting for the existing distribution of the Cladoeera; this method involves a change in the organization of the body relative to its resistance to extremes of temperature. Several of the types of genetical changes which may occur in these animals are discussed in relation to preadaptation to new temperature ranges
A 41-year-old Asian woman with bilateral renal angiomyolipomas (AML) was incidentally identified to have a balanced translocation, 46,XX,t(11;12)(p15.4;q15). She had no other features or family history to suggest a diagnosis of tuberous sclerosis. Her healthy daughter had the same translocation and no renal AML at the age of 3 years. Whole-genome sequencing was performed on genomic maternal DNA isolated from blood. A targeted de novo assembly was then conducted with ABySS for chromosomes 11 and 12. Sanger sequencing was used to validate the translocation breakpoints. As a result, genomic characterization of chromosomes 11 and 12 revealed that the 11p breakpoint disrupted the NUP98 gene in intron 1, causing a separation of the promoter and transcription start site from the rest of the gene. The translocation breakpoint on chromosome 12q was located in a gene desert. NUP98 has not yet been associated with renal AML pathogenesis, but somatic NUP98 alterations are recurrently implicated in hematological malignancies, most often following a gene fusion event. We also found evidence for complex structural events involving chromosome 12, which appear to disrupt the TDG gene. We identified a TDGP1 partially processed pseudogene at 12p12.1, which adds complexity to the de novo assembly. In conclusion, this is the first report of a germline constitutional structural chromosome rearrangement disrupting NUP98 that occurred in a generally healthy woman with bilateral renal AML.
An analysis of the growth curves of a cladoceran for one adult instar at each of two temperatures is made by comparing the apparent gains or losses in time when the animals are transferred from one of these temperatures to the other during the course of the developmental period. Since the curves for the two temperatures when brought together at their end-point do not coincide, the equation used to describe growth must have at least two velocity constants unequally affected by changes in temperature.
In spite of obvious possible sources of disturbance, the "velocity of killing" of organisms at supranormal temperatures, properly determined, tends to adhere to the Arrhenius equation for relation to temperature. Over certain ranges of temperature the relationship between log velocity of killing and 1/T degrees abs. is linear. Interpreted as due to the thermal denaturing of protein, it is possible that differences between the temperature characteristics for the killing process in closely related forms may be suggestive in regard to the mechanism of the denaturing. The temperature limits within which the linear relationships appear may be classed among those temperature levels which are critical temperatures for protoplasmic organization.
We have previously described a newborn infant girl with severe factor VII (FVII) deficiency that was caused by the compounding effects of two novel mutations (Hewitt et al, 2005). The proband inherited a new missense mutation (F7 g.3907G>A) from her father together with a previously undetected deletion from her mother. Real time polymerase chain reaction (PCR) analysis of the proband’s genomic DNA revealed that both F7 and F10 were deleted on this allele. Because of the maternal deletion, DNA sequence analysis of the proband’s genomic DNA was restricted to the paternal allele resulting in apparent pseudo-homozygosity in this region. In the past, it has been difficult to map allelic deletions at the nucleotide level because of the lack of flanking DNA sequence information. However, using sequence data from the Human Genome Project, we have determined the molecular breakpoints of the maternal chromosome 13 deletion in this family to the exact nucleotide. Initially, we used fluorescence in situ hybridization (FISH) to estimate the extent of the maternal chromosomal deletion. Bacterial artificial chromosomes and P1-derived artificial chromosomes were obtained from the BACPAC Resource Center (Children’s Hospital Oakland Research Institute, Oakland, CA, USA) and labelled with Spectrum Green or Spectrum Orange by nick translation using a commercially available kit (Vysis, Downer’s Grove, IL, USA). These DNA fragments were used as hybridization probes on slides containing maternal blood leucocytes. This analysis indicated that the deleted region was approximately 140 000–320 000 bp in length containing 5–9 genes including the F7 and F10 that were identified previously (Hewitt et al, 2005). However, the resolution of the FISH analysis was too low to allow the design of PCR primers that would amplify the deleted region. To determine the location of the deletion break points precisely, quantitative real time PCR (QrtPCR) was used in the presence of SYBR green dye. Primer pairs were designed using the computer program OLIGO v4·0 (created by Piotr and Wojciech Rychlik; Molecular Biology Insights, Inc., Cascade, CO, USA), such that the PCR typically generated DNA fragments of 200–300 bp. The dye SYBR green was included in the PCR reactions to label the newly synthesized DNA. A primer pair directed against exon 2 of the human prothrombin gene [located on chromosome 11 (Royle et al, 1987)] was used as a control for the presence of two gene copies. QrtPCR and quantification through the continuous monitoring of SYBR green fluorescence was carried out in a Bio-Rad DNA Engine Opticon 2 Real-Time PCR Detection System (Bio-Rad, Mississauga, ON, Canada), and analysed using the accompanying software. By comparing the fluorescent signal to the signal obtained with the control primers, the presence of one or two gene copies in the original DNA sample could be calculated. Eventually, the primers AL356740RT4FA (CACCCGGCTTGGCCGTCACACAT) and AL137002RT4CR2 (GCCCTTTCATAAGGACGCTCTGGCTTT) (Fig 1A) were used in a PCR to amplify across the maternal chromosomal breakpoint resulting in a fragment of c. 2000 bp from the deleted chromosome 13; these primers were unable to amplify a fragment from the paternal chromosome (Fig 1A) because of the large distance (>160 000 bp) between the primers. Molecular characterization of the deleted region of chromosome 13q34 in the affected family. (A) Schematic representation of the paternal (top) and maternal (bottom) alleles of chromosome 13. The locations of the deleted genes are indicated, and the telomeric side is indicated by tel. The sequence is not drawn to scale. The deleted region in the maternal allele is indicated by the dashed line. The locations of the PCR primers used to amplify across the breakpoint are indicated below the maternal allele. (B) DNA sequence analysis across the break points. Only one strand of DNA sequence is shown together with the automated DNA sequence electrophoretogram. The lines show the location of the breakpoint on the maternal allele. (C) Comparison of the patient sequence with the wild type sequences of the chromosome 13 regions that flank the deleted region. The patient sequence corresponding to the centromeric contig is highlighted in blue; the sequence corresponding to the telomeric contig is highlighted in yellow. DNA sequence analysis was performed on the PCR product containing the break point (Fig 1B). A single, homogeneous sequence was obtained on both strands of DNA; comparison with the wild type chromosome 13 sequence allowed the identification of the break points at the nucleotide level. On the centromeric side, the break point was located at nucleotide 112 723 403 of chromosome 13 [Fig 1C, blue highlighted sequence – all numbering of genomic DNA sequences in this study are based on Build 36 of the Human Genome Sequence on the National Center for Biotechnology Information (NCBI) web site, http://www.ncbi.nlm.nih.gov/mapview/maps.cgi?taxid=9606&chr=13]. On the telomeric side, the break point was located at nucleotide 112 884 959 of chromosome 13 (Fig 1C, yellow highlighted sequence). Based on these break points, the maternal chromosome 13 deletion in this family is 161 556 bp in size. This region contains all of F7, F10, PROZ and parts of MCF2L and PCID2. The same PCR was carried out on the proband’s DNA, and confirmed the presence of the same deletion; thus, the deletion can be diagnosed within this family by using a simple PCR test. Although the patient’s mother and maternal grandmother had the deletion (Hewitt et al, 2005), neither displayed a bleeding phenotype. When combined with a missense mutation in F7, however, the resulting FVII deficiency resulted in a life-threatening cerebral haemorrhage during the neonatal period. Thus, phenotypic display of the deletion only arises in combination with a loss of function mutation in one of the deleted genes. A study of mutations in the Duchenne Muscular Dystrophy gene revealed that most deletions arise in oogenesis and most point mutations result from events during spermatogenesis (Grimm et al, 1994). This is the same genetic inheritance pattern that is observed in the FVII deficient family described in the current study. Chromosomal deletions are often associated with recombination between homologous sequences. For example, deletion of DNA between the δ-globin and β-globin genes via homologous recombination results in the δ/β globin fusion gene found in hemoglobin Lepore (Seward et al, 1993). In addition, deletions in the dystrophin gene have occurred via non-homologous recombination mediated by Alu and LINE 1, sequences leading to the suggestion that gene deletion in eukaryotes may be sequence-dependent (McNaughton et al, 1998). When the two break point sequences in the current study were examined, no sequence homology was found between them. As with other deletions that have no obvious genomic mechanism (Inoue et al, 2002; Venturin et al, 2004), we suggest that two double-stranded breaks must have occurred in a germ line cell. The two new ends were rejoined incorrectly by non-homologous end joining (Moore & Haber, 1996). Although some small deletions have been characterized that cause thrombotic and bleeding disorders (Asselta et al, 2006; Hsu et al, 2007), the current study represents the first molecular characterization of a large deletion that causes a haemostatic disorder. This work was supported in part by a grant from the Canadian Blood Services – Canadian Institutes of Health Research (CIHR) Blood Utilization and Conservation Initiative (to R.T.A.M.) and an Infrastructure Grant from the Michael Smith Foundation for Health Research (to the CBR-LMB). M.R.B. was supported by a Graduate Fellowship from the Strategic Training Program in Transfusion Science supported by the CIHR and the Heart and Stroke Foundation of Canada.
The writers, , have extended the earlier observations of Grosvenor and Smith and others on the association between crowding of Moina macrocopa mothers and the production of male offspring. We also noted an association between retardation in the time of production of the parthenogenetic young and the percentage of male young produced. Within limits the percentage of male young produced is roughly proportional both to the degree of crowding and to the amount of retardation in the time of their production. Excessive retardation, however, whether induced by crowding or by other treatments, is accompanied by a reduced percentage of male young. We have interpreted this retardation and this male production as due to the accumulation of the mothers' excretory products. Stuart and Banta have shown that quantity of bacteria available as food for Moina mothers appears, under certain appropriate experimental set-ups, to be the determining factor in sex control in this species. This finding might raise the question as to whether quantity of available food is the principal or sole influential factor involved in male causation in crowding or other experiments, by Moina mothers. In certain experiments involving aeration of mothers during the critical period male production was reduced or eliminated, in which case quantity of food apparently cannot be considered the determining factor in sex control. But the results of crowding might seem readily interpretable on this basis. This note records the results of experiments designed to differentiate between (1) the quantity of available food and (2) some other factor associated with crowding (presumably “the accumulation of excretory products”) as factors in influencing male production.
'/%3e%3cpath d='M200 752.362h200v300H200z' style='fill:%23fff;fill-opacity:1;stroke:none' transform='translate(0 -752.362)'/%3e%3cpath d='M400 752.362h200v300H400z' style='fill:%23ff883e;fill-opacity:1;stroke:none' transform='translate(0 -752.362)'/%3e%3c/svg%3e)
'%3e%3cpath fill='%23012169' d='M0 0v30h60V0z'/%3e%3cpath stroke='%23fff' stroke-width='6' d='m0 0 60 30m0-30L0 30'/%3e%3cpath stroke='%23C8102E' stroke-width='4' d='m0 0 60 30m0-30L0 30' clip-path='url(%23b)'/%3e%3cpath stroke='%23fff' stroke-width='10' d='M30 0v30M0 15h60'/%3e%3cpath stroke='%23C8102E' stroke-width='6' d='M30 0v30M0 15h60'/%3e%3c/g%3e%3c/svg%3e)