Neurofilaments, the major intermediate filaments in large myelinated neurons, are essential for specifying proper axonal caliber. Mammalian neurofilaments are obligate heteropolymers assembled from three polypeptides, neurofilament (NF)-H, NF-M, and NF-L, each of which undergoes phosphorylation at multiple sites. NF-M and NF-L are known to be modified by O-linked N-acetylglucosamine (O-GlcNAc) (Dong, D. L.-Y., Xu, Z.-S., Chevrier, M. R., Cotter, R. J., Cleveland, D. W., and Hart, G. W. (1993) J. Biol. Chem. 268, 16679-16687). Here we further report that NF-H is extensively modified by O-GlcNAc at Thr53, Ser54, and Ser56 in the head domain and, somewhat surprisingly, at multiple sites within the Lys-Ser-Pro repeat motif in the tail domain, a region in assembled neurofilaments known to be nearly stoichiometrically phosphorylated on each of the approximately 50 KSP repeats. Beyond the earlier identified sites on NF-M and NF-L, O-GlcNAc sites on Thr19 and Ser34 of NF-M and Ser34 and Ser48 of NF-L are also determined here, all of which are localized in head domain sequences critical for filament assembly. The proximity of O-GlcNAc and phosphorylation sites in both head and tail domains of each subunit indicates that these modifications may influence one another and play a role in filament assembly and network formation.
The most consistent neurochemical abnormality in Parkinson's disease is degeneration of dopaminergic neurons in the substantia nigra, leading to a reduction of striatal dopamine levels. The rate-limiting step in the biosynthesis of dopamine, noradrenalin, and adrenalin is catalyzed by tyrosine 3-monooxygenase (=tyrosine hydroxylase), which catalyzes the formation of L-DOPA. In earlier studies, we demonstrated that the novel synthetic sialic acid precursor N-propanoylmannosamine is a potent stimulator of axonal growth and promotes reestablishment of the perforant pathway from layer II of cortical neurons to the outer molecular layer of the dentate gyrus. Here we show that application of N-propanoylmannosamine leads to increased biosynthesis and secretion of dopamine. This increased biosynthesis of dopamine is due to decreased expression of O-linked N-acetylglucosamine on tyrosine 3-monooxygenase. Intracellular attachment of O-linked N-acetylglucosamine to serine and threonine residues hinders phosphorylation, thereby regulating the activity of the proteins concerned. We therefore propose a model in which the application of ManNProp leads to increased phosphorylation and activation of tyrosine 3-monooxygenase, which in turn leads to an increased synthesis of dopamine.
The O-GlcNAc transferase (OGT) is a unique nuclear and cytosolic glycosyltransferase that contains multiple tetratricopeptide repeats. We have begun to characterize the mechanisms regulating OGT using a combination of deletion analysis and kinetic studies. Here we show that the p110 subunit of the enzyme forms both homo- and heterotrimers that appear to have different binding affinities for UDP-GlcNAc. The multimerization domain of OGT lies within the tetratricopeptide repeat domain and is not necessary for activity. Kinetic analyses of the full-length trimer and the truncated monomer forms of OGT suggest that both forms function through a random bi-bi kinetic mechanism. Both the monomer and trimer have similar specific activities and similar Km values for peptide substrates. However, they differ in their binding affinities for UDP-GlcNAc, indicating that subunit interactions affect enzyme activity. The findings that recombinant OGT has three distinctKm values for UDP-GlcNAc and that UDP-GlcNAc concentrations modulates the affinity of OGT for peptides suggest that OGT is exquisitely regulated by the levels of UDP-GlcNAc within the nucleus and cytoplasm. The O-GlcNAc transferase (OGT) is a unique nuclear and cytosolic glycosyltransferase that contains multiple tetratricopeptide repeats. We have begun to characterize the mechanisms regulating OGT using a combination of deletion analysis and kinetic studies. Here we show that the p110 subunit of the enzyme forms both homo- and heterotrimers that appear to have different binding affinities for UDP-GlcNAc. The multimerization domain of OGT lies within the tetratricopeptide repeat domain and is not necessary for activity. Kinetic analyses of the full-length trimer and the truncated monomer forms of OGT suggest that both forms function through a random bi-bi kinetic mechanism. Both the monomer and trimer have similar specific activities and similar Km values for peptide substrates. However, they differ in their binding affinities for UDP-GlcNAc, indicating that subunit interactions affect enzyme activity. The findings that recombinant OGT has three distinctKm values for UDP-GlcNAc and that UDP-GlcNAc concentrations modulates the affinity of OGT for peptides suggest that OGT is exquisitely regulated by the levels of UDP-GlcNAc within the nucleus and cytoplasm. O-GlcNAc is an abundant intracellular posttranslational modification consisting of a single N-acetylglucosamineO-linked to serine/threonine residues. Unlike other carbohydrate modifications, O-GlcNAc is not further modified and is found almost exclusively in the nucleus and cytoplasm. Since it was first described in lymphocytes (1Torres C.R. Hart G.W. J. Biol. Chem. 1984; 259: 3308-3317Abstract Full Text PDF PubMed Google Scholar) O-GlcNAc has been found on an ever increasing number of proteins, including RNA polymerase II and its transcription factors, nuclear pore proteins, tumor suppressor proteins, intermediate filaments, viral proteins, and oncoproteins (reviewed in Refs. 2Hart G.W. Kreppel L.K. Comer F.C. Arnold C.S. Snow D.S. Ye Z. Chen X. DellaManna D. Caine D.S. Earles B.J. Akimoto Y. Cole R.N. Hayes B.K. Glycobiology. 1996; 6: 711-716Crossref PubMed Scopus (125) Google Scholar, 3Hart G.W. Annu. Rev. Biochem. 1997; 66: 315-335Crossref PubMed Scopus (455) Google Scholar, 4Snow D.M. Hart G.W. Int. Rev. Cytol. 1998; 181: 43-74Crossref PubMed Google Scholar, 5Kreppel L.K. Hart G.W. Fukuda M. Hindsgaul O. Molecular and Cellular Glycobiology: Frontiers in Molecular Biology. Oxford University Press, Oxford1999Google Scholar). O-GlcNAc is an abundant and dynamic modification exhibiting properties more like phosphorylation than typical N- and O-linked glycosylation (2Hart G.W. Kreppel L.K. Comer F.C. Arnold C.S. Snow D.S. Ye Z. Chen X. DellaManna D. Caine D.S. Earles B.J. Akimoto Y. Cole R.N. Hayes B.K. Glycobiology. 1996; 6: 711-716Crossref PubMed Scopus (125) Google Scholar, 3Hart G.W. Annu. Rev. Biochem. 1997; 66: 315-335Crossref PubMed Scopus (455) Google Scholar). The O-GlcNAc modification (termedO-GlcNAcylation) has been suggested to play a direct role in regulating a number of cellular functions including protein synthesis (6Datta B. Ray M.K. Chakrabarti D. Wylie D.E. Gupta N.K. J. Biol. Chem. 1989; 264: 20620-20624Abstract Full Text PDF PubMed Google Scholar, 7Chakraborty A. Saha D. Bose A. Chatterjee M. Gupta N.K. Biochemistry. 1994; 33: 6700-6706Crossref PubMed Scopus (50) Google Scholar), neurofilament assembly (8Dong D.L.-Y. Xu Z.-S. Hart G.W. Cleveland D.W. J. Biol. Chem. 1996; 271: 20845-20852Abstract Full Text Full Text PDF PubMed Scopus (99) Google Scholar), and transcription (9Kelly W.G. Dahmus M.E. Hart G.W. J. Biol. Chem. 1993; 268: 10416-10424Abstract Full Text PDF PubMed Google Scholar, 10Shaw P. Freeman J. Bovey R. Iggo R. Oncogene. 1996; 12: 921-930PubMed Google Scholar, 11Roos M.D., K., S. Baker J.R. Kudlow J.E. Mol. Cell. Biol. 1997; 17: 6472-6480Crossref PubMed Scopus (199) Google Scholar). In our laboratory, we have purified and characterized both a UDP-N-acetylglucosamine:peptideN-acetylglucosaminyl-transferase (O-GlcNAc transferase) (12Haltiwanger R.S. Holt G.D. Hart G.W. J. Biol. Chem. 1990; 265: 2563-2568Abstract Full Text PDF PubMed Google Scholar) specific for the attachment of O-GlcNAc to proteins and a solubleN-acetyl-β-d-glucosaminidase (O-GlcNAcase) (13Dong D.L.-Y. Hart G.W. J. Biol. Chem. 1994; 269: 19321-19330Abstract Full Text PDF PubMed Google Scholar) specific for the removal ofO-GlcNAc from proteins. These enzymes may work together to regulate the attachment and removal of O-GlcNAc in response to cellular signals in much the same way that kinases and phosphatases regulate protein phosphorylation. Although significant progress has been made in our understanding of the distribution of O-GlcNAc in the cell, little is known about how the attachment of O-GlcNAc to proteins is regulated. The problem is significant because numerous proteins areO-GlcNAcylated, many at more then one site. A further complexity is added by the lack of a canonical consensus site for the attachment of O-GlcNAc to proteins (4Snow D.M. Hart G.W. Int. Rev. Cytol. 1998; 181: 43-74Crossref PubMed Google Scholar, 5Kreppel L.K. Hart G.W. Fukuda M. Hindsgaul O. Molecular and Cellular Glycobiology: Frontiers in Molecular Biology. Oxford University Press, Oxford1999Google Scholar). Additionally, theO-GlcNAc modification turns over more rapidly then the protein backbone (14Chou C.-F. Smith A.J. Omary M.B. J. Biol. Chem. 1992; 267: 3901-3906Abstract Full Text PDF PubMed Google Scholar, 15Roquemore E.P. Chevrier M.R. Cotter R.J. Hart G.W. Biochemistry. 1996; 35: 3578-3586Crossref PubMed Scopus (153) Google Scholar) and is responsive to cellular stimuli (16Kearse K.P. Hart G.W. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 1701-1705Crossref PubMed Scopus (192) Google Scholar,17Chou C.F. Omary M.B. J. Biol. Chem. 1993; 268: 4465-4472Abstract Full Text PDF PubMed Google Scholar). Thus the cell must regulate not only which proteins to modify withO-GlcNAc but also which site(s) on a protein to modify in response to specific cellular signals. The gene encoding the catalytic subunit of an O-GlcNAc transferase (OGT) 1The abbreviations used are:OGTO-GlcNAc transferaseTPRtetratricopeptide repeatPAGEpolyacrylamide gel electrophoresis was recently cloned and characterized from rat (18Kreppel L.K. Blomberg M.A. Hart G.W. J. Biol. Chem. 1997; 272: 9308-9315Abstract Full Text Full Text PDF PubMed Scopus (612) Google Scholar), human, and nematode (19Lubas W.A. Frank D.W. Krause M. Hanover J.A. J. Biol. Chem. 1997; 272: 9316-9324Abstract Full Text Full Text PDF PubMed Scopus (421) Google Scholar). The protein (p110) encoded by this gene represents a novel glycosyltransferase that has a unique cellular distribution and shares no sequence or structural similarity to any previously described secretory glycosyltransferase (20Field M.C. Wainwright L.J. Glycobiology. 1995; 5: 463-472Crossref PubMed Scopus (98) Google Scholar, 21Paulson J.C. Colley K.J. J. Biol. Chem. 1989; 264: 17615-17618Abstract Full Text PDF PubMed Google Scholar). The gene encoding OGT is found in all higher eukaryotes examined and has been highly conserved throughout evolution. It is modified by O-GlcNAc and tyrosine phosphorylation, which may play a role in the regulation of the OGT. Further examination of the protein sequence indicate that p110 can be divided into two distinct domains, the amino-terminal half of the protein containing multiple tetratricopeptide repeats (TPRs) and the carboxyl-terminal half of the protein representing a novel polypeptide believed to contain the catalytic portion of the enzyme. TPRs are found in a large number of proteins of diverse function and play a role in modulating a variety of cellular processes, including cell cycle (22Hirano T. Kinoshita N. Morikawa K. Yanagida M. Cell. 1990; 60: 319-328Abstract Full Text PDF PubMed Scopus (239) Google Scholar, 23Lamb J.R. Michaud W.A. Sikorski R.S. Hieter P.A. EMBO J. 1994; 13: 4321-4328Crossref PubMed Scopus (214) Google Scholar, 24Tugendreich S. Tomkiel J. Earnshaw W. Hieter P. Cell. 1995; 81: 261-268Abstract Full Text PDF PubMed Scopus (315) Google Scholar), transcription regulation (25Schultz J. Marshall-Carlson L. Carlson M. Mol. Cell. Biol. 1990; 10: 4744-4756Crossref PubMed Scopus (93) Google Scholar, 26Rameau G. Puglia K. Crowe A. Sethy I. Willis I. Mol. Cell. Biol. 1994; 14: 822-830Crossref PubMed Scopus (45) Google Scholar, 27Tzamarias D. Struhl K. Genes Dev. 1995; 9: 821-831Crossref PubMed Scopus (242) Google Scholar), and protein transport (28Haucke V. Horst M. Schatz G. Lithgow T. EMBO J. 1996; 15: 1231-1237Crossref PubMed Scopus (73) Google Scholar) by mediating specific protein-protein interactions (reviewed in Refs. 29Goebl M. Yanagida M. Trends Biochem. Sci. 1991; 16: 173-177Abstract Full Text PDF PubMed Scopus (377) Google Scholar and 30Lamb J.R. Tugendreich S. Hieter P. Trends Biochem. Sci. 1995; 20: 257-259Abstract Full Text PDF PubMed Scopus (556) Google Scholar). Thus, the TPR domain of p110 may represent a protein interaction domain that facilitates protein-protein interactions that regulate enzymatic activity. O-GlcNAc transferase tetratricopeptide repeat polyacrylamide gel electrophoresis In this paper, we begin to address the question of how the cell regulates the attachment of O-GlcNAc by further characterizing the p110 subunit of the OGT cloned from rat liver. Using the insect cell baculovirus system to overexpress p110, we show that it is the catalytic subunit of the enzyme and that different portions of the TPR domain are required for multimerization of the OGT and for enzymatic activity. We also find that recombinant p110 contains the same posttranslational modifications as p110 purified from rat. Kinetic studies suggest that OGT functions through a random bi-bi kinetic mechanism and that the protein has three distinct binding constants for the UDP-GlcNAc sugar donor. In addition we find that binding of UDP-GlcNAc is regulated by multimerization of the enzyme. These data suggest that multimerization and the intracellular concentration as well as binding of UDP-GlcNAc are among the mechanisms regulating OGT activity in vivo. Peptides were synthesized on a Perseptive Biosystems (Framingham, MA) automated peptide synthesizer and purified by reverse phase high performance liquid chromatography. Prepacked Superose 12 PC 3.2/30, and Hi-Trap Chelating columns were from Amersham Pharmacia Biotech. Uridine diphospho-N-acetyl[6-3H]glucosamine (50 Ci/mmol) was from American Radiolabeled Chemicals (St. Louis, MO). Uridine diphospho-N-acetylglucosamine was from Oxford Glycosystems (Oxford, UK). Ultrafree Centrifugal Filter Devices were from Millipore Inc. All other reagents were of the highest quality available. Restriction endonuclease digestions and ligations were carried out as described (31Ausubel F.M. Brent R. Kingston R.E. Moore D.D. Smith J.A. Seidman J.G. Struhl K. Current Protocols in Molecular Biology. John Wiley & Sons, New York1989Google Scholar). Plasmids were isolated using Wizard Prep Kits (Promega) according to the manufacturer's directions. Sequence information of the various fusion clones was obtained by automated DNA sequencing on an Applied Biosystems (Foster City, CA) model 373A automated DNA sequencer. The 5′-untranslated region of the previously cloned full-length cDNA fragment (18Kreppel L.K. Blomberg M.A. Hart G.W. J. Biol. Chem. 1997; 272: 9308-9315Abstract Full Text Full Text PDF PubMed Scopus (612) Google Scholar) was removed by digestion withBsaHI and replaced with a linker adaptor (CGCGATCCGCGATGG), which adds a BamHI linker upstream of the restored ATG. The full coding region was excised by digestion with BamHI andHindIII and ligated into pBlueBacHis A (Invitrogen). The resulting plasmid (pLK59) was recombined in vivo into baculovirus using the Bac-N-Blue Transfection kit (Invitrogen) as per the manufacturer's protocol resulting in the viral strain VLK59. Five oligonucleotides were synthesized (GGATCCGCAATTGAGACGCAACCAAACTTT = Δ3 forward, GGATCCGCTATAGAACTGCAGCCTCATTTC=Δ6 forward, GGATCCGCCATAAGAATCAGTCCTACATT =Δ9 forward, GGATCCCCTGATGCTTATTGTAACTTGGCT = Δ11 forward, and GTGTACCCATTCATATTGACAAGG = TPR domain reverse), and polymerase chain reaction was carried out in 50-μl reactions containing 2 ηg of plasmid pLK36, 1.5 mmMgCl2, 50 mm KCl, 10 mm Tris, pH 9.0, 200 μm dNTPs, 0.8 μm each primer, and 2.5 units of Taq DNA polymerase (Promega). The DNA was amplified in a DNA Thermal Cycler (MJ Research Inc.) for 30 cycles using a denaturation temperature of 92 °C (1 min), an annealing temperature of 63 °C (2 min), and an elongation temperature of 72 °C (2 min). The polymerase chain reaction products were resolved on a 1% agarose gel containing ethidium bromide (0.5 μg/ml) gel purified using a silica suspension (32Boyle J.S. Lew A.M. Trends Genet. 1995; 11: 8Abstract Full Text PDF PubMed Scopus (184) Google Scholar). The polymerase chain reaction fragments were double digested withBamHI and BsrBI or BglI andBsrBI and ligated into pLK59 that had been prepared by double digesting with BamHI and BsrBI and gel purifying the large fragment containing the vector and carboxyl-terminal portion of the p110 protein. The resulting plasmids (pLK72, pLK73, pLK74, and pLK75) were used to prepare recombinant baculovirus as described above resulting in viral strains VLK72, VLK73, VLK74, and VLK75, respectively. High Five (Invitrogen) insect cells were grown in TNH-FH medium, which consists of Graces's insect medium (Life Technologies, Inc.) supplemented with 10% heat-inactivated fetal bovine serum, to midlog (∼5 × 105 cells/ml) and infected at an multiplicity of infection of 5–10 plaque-forming units/cell and incubated for 40–48 h. Cells were harvested by centrifugation, and cell pellets were frozen at −20 °C. Infected cell pellets were resuspended in Buffer A (20 mm Tris, pH 7.9, 0.5 m NaCl) and lysed by sonication (2 × 30 s pulses power 3.5 with a 550 Sonic Dismembrator; Fisher Scientific). Lysates were spun for 30 min at 30,000 × g, and the supernatant was filtered through a 0.45-μm filter and loaded at a flow rate of 1 ml/min onto a 1-ml Hi-Trap chelating column precharged with NiSO4 as per the manufacturer's instructions and pre-equilibrated with buffer A. The column was washed with ∼20 column volumes buffer A, followed by a 10-ml wash at 5% buffer B and then eluted with a 25-min linear gradient 5–100% buffer B (20 mm Tris, pH 7.9, 0.5 m NaCl, 100 mmimidazole) at 1 ml/min. Fractions (1 ml) were collected throughout the separation were assayed for activity as described below. The fractions were also examined by SDS-PAGE followed by visualization with Coomassie G-250 staining (33Neuhoff V. Electrophoresis. 1988; 9: 255-262Crossref PubMed Scopus (2355) Google Scholar) or by Western blot analysis (see below). The most pure active fractions were pooled and concentrated using an ultra-free 15 concentrator as per manufacturer's directions. Buffer was exchanged by resuspending the concentrate in 12 ml of buffer F (20 mmTris, pH 7.5, 20% glycerol, 1 mm dithiothreitol) and concentrating again. The concentrate was removed, and the concentrator was rinsed with 0.5 ml of buffer. The pooled concentrate (∼600 μl) was brought to 40% glycerol, 1 mm dithiothreitol and stored at −20 °C. Activity assays were performed as described previously (34Haltiwanger R.S. Blomberg M.A. Hart G.W. J. Biol. Chem. 1992; 267: 9005-9013Abstract Full Text PDF PubMed Google Scholar) with minor modifications. Because the nickel affinity purified enzyme is concentrated in a salt-free buffer, the enzyme is assayed directly without desalting. For the assays described here the enzyme was diluted 1:25 with cold desalt buffer (20 mm Tris, pH 8, 20% glycerol, 0.02% NaN3) just prior to use, and the reactions were started with the addition of 25 μl of the diluted enzyme mix. In addition to the previously described peptide substrate YSDSPSTST (9-mer peptide), an additional peptide PGGSTPVSSANMM (CKII peptide) was used for kinetic analysis. A number of other peptides were also used (see Fig.6 A). All peptides were used at a final concentration of 3 mm unless otherwise noted. The peptides were eluted from the SP-Sephadex (SP-C25–120, Sigma) with 1 ml of 1 m NaCl. When noted the peptides were cleaned up after the reaction on a Sep-pak C18 cartridge (Waters Corp.) as follows: cartridge was washed with 10 ml of methanol, 10 ml of 50 mm formic acid, the reaction was then loaded onto the cartridge, and the cartridge was washed with 10 ml of 50 mm formic acid, 10 ml of 50 mmformic acid containing 0.5 m NaCl, and 10 ml of distilled H2O. The peptides were eluted from the cartridge directly into scintillation vials with 2 × 1.5 ml of methanol. Units are defined as micromoles of GlcNAc transferred per min. The proteins were separated by SDS-PAGE and transferred to polyvinylidene difluoride membrane (Millipore). Purified rabbit polyclonal IgG AL-25 (1:5000) (18Kreppel L.K. Blomberg M.A. Hart G.W. J. Biol. Chem. 1997; 272: 9308-9315Abstract Full Text Full Text PDF PubMed Scopus (612) Google Scholar) or monoclonal anti-phosphotyrosine (1:500) (Transduction Laboratories) was used as a primary antibody with anti-rabbit or anti-mouse IgG coupled to horseradish peroxidase (Amersham Pharmacia Biotech) as the secondary antibody (1:20,000 dilution). Detection of the horseradish peroxidase activity was by enhanced chemiluminescence and fluorography as described by the manufacturer (Amersham Pharmacia Biotech). Nickel affinity purified recombinant enzyme (described above) was probed for terminal GlcNAc using Galβ(1–4)galactosyl-transferase and UDP-[3H]galactose as described (35Roquemore E.P. Chou T.-Y. Hart G.W. Methods Enzymol. 1994; 230: 443-460Crossref PubMed Scopus (130) Google Scholar). The labeled protein was brought to 1 ml with RIPA buffer (10 mm Tris, pH 8.15, 50 mm NaCl, 0.5% Nonidet P-40, 0.1% SDS, 0.5% NaDOC) and incubated with AL-25 IgG (18Kreppel L.K. Blomberg M.A. Hart G.W. J. Biol. Chem. 1997; 272: 9308-9315Abstract Full Text Full Text PDF PubMed Scopus (612) Google Scholar) on ice for 3 h. The IgGs were then precipitated with protein A-Sepharose CL4-B (Amersham Pharmacia Biotech). The resin was washed extensively in RIPA buffer followed by a wash in 50 mm Tris, pH 6.8. The resin was then resuspended to equivalent volumes in either SDS-PAGE sample buffer and resolved on a 7.5% SDS-acrylamide gel, and proteins tagged with [3H]galactose were detected by fluorography of the gel treated with 1 m sodium salicylate. A portion (50 μl) of the nickel affinity purified recombinant enzyme was further concentrated by centrifugation in an Ultrafree-0.5 concentrator and exchanged into buffer F containing either 150 mm NaCl or 1 m NaCl. The concentrate was then loaded onto a Superose 12 column using a Amersham Pharmacia Biotech Smart fast protein liquid chromatography system equilibrated in buffer F containing either 150 mm NaCl or 1 m NaCl using a Amersham Pharmacia Biotech Smart fast protein liquid chromatography system, and the protein was eluted at 15 μl/min. The absorbance at 280 nm was followed, and 25-μl fractions were collected that were assayed for activity, and analyzed by SDS-PAGE followed by visualization with Coomassie G-250 staining (33Neuhoff V. Electrophoresis. 1988; 9: 255-262Crossref PubMed Scopus (2355) Google Scholar) or by Western blot analysis (see above). In separate runs standards were loaded onto the column to calculate the apparent molecular weight values. The Km values for both the CKII and 9-mer peptides were performed at 2.5 μm UDP-GlcNAc, and concentrations of peptide were varied from 5 μm to 15 mm, and the Km values were determined by Eadie-Scatchard analysis (data not shown). Further kinetic studies were performed using only the CKII peptide. To determine theKm for UDP-GlcNAc across the full spectrum of concentrations from 0.05 μm to 4.8 mm, similar analysis were performed using the CKII peptide at 3 mm final concentration. The UDP-[6-3H]GlcNAc was cold diluted from 50 Ci/mmol to either 0.2 Ci/mmol for the lower concentration of UDP-GlcNAc or to 0.02 Ci/mmol at the higher concentrations of UDP-GlcNAc. Addition kinetic studies were performed to obtain the true Km, Vmax, and Kd values for both UDP-GlcNAc (at low concentrations) and the CKII peptide. In these studies one substrate was varied while the other was held constant. The UDP-[6-3H]GlcNAc was cold diluted from 50 Ci/mmol to 2 Ci/mmol for these studies. The Km andVmax values were then determined with the aid of the computer program KaleidaGraph (Synergy Software) that uses a linear regression method. The Vmax andKm numbers were then reploted as both reciprocal and double reciprocal plots to give the true Vmaxand Km numbers as well as the Kd values and the constant α. All assays were performed in duplicate, and each experiment was performed at least twice. Photolabeling studies on the OGT purified from rat liver cytosol (34Haltiwanger R.S. Blomberg M.A. Hart G.W. J. Biol. Chem. 1992; 267: 9005-9013Abstract Full Text PDF PubMed Google Scholar) suggested that the p110 subunit was the catalytic subunit of the enzyme. To confirm this hypothesis a His6 tag was added to the amino-terminal end of the p110 cDNA, and the tagged p110 subunit (His-p110) was overexpressed in insect cells using the baculovirus expression system (see "Experimental Procedures"). The His-tagged protein was purified by nickel affinity chromatography. A typical purification is shown in Fig. 1. The purification of a band at 117 kDa (the size of the p110 subunit with the addition of the His6 tag) can be followed by Coomassie R-250 staining (asterisk in Fig. 1 A). The purified band at 117 kDa is recognized by the anti-OGT antibody, AL-25 (Fig. 1 B), confirming the identity of the 117-kDa protein as the p110 subunit of the OGT and demonstrating that the highly related p78 subunit is not present. OGT activity co-purifies with the 117-kDa band (Fig. 1 C), demonstrating that the p110 subunit of the enzyme is the catalytic subunit of the enzyme and is active in the absence of the p78 subunit. A typical purification yielded ∼150–300 μg of total protein giving a 5000–8000-fold purification. Note that the band visible in Fig. 1 A at ∼70 kDa is an unrelated protein that is not recognized by the AL-25 antibody. This 70-kDa band is also purified from mock or wild type baculovirus-infected cells and has no OGT activity (data not shown), indicating that it is not an insect cell OGT and that it interacts directly with the nickel affinity column and not with the His-p110 protein. The specific activity (1.23 nmol/min/mg) of the purified His-p110 is comparable with OGT purified from liver (1.11 nmol/min/mg), and theKm for the YSDSPSTST (9-mer) peptide is the same (10 mm) for both enzymes. In addition the recombinant p110, like the liver OGT, exists as a trimer (described below) and bears the same posttranslational modifications present on liver purified OGT (described below). These data indicate that the His-p110 subunit expressed and purified from insect cells is a good model for studying the mechanism(s) regulating OGT activity. OGT purified from liver is a heterotrimer composed of two p110 subunits and one highly related p78 subunit with an apparent molecular weight of 340 kDa (34Haltiwanger R.S. Blomberg M.A. Hart G.W. J. Biol. Chem. 1992; 267: 9005-9013Abstract Full Text PDF PubMed Google Scholar). The apparent molecular weight of His-p110 was determined by gel filtration chromatography at both physiological salt concentrations (150 mm) and high salt concentrations (1 m). At both salt concentrations the apparent molecular weight was ∼360 kDa, indicating that the His-p110 is a homotrimer and that the subunits are tightly associated. The absorbance at A280 and activity profiles at 1 m NaCl are shown in Fig.2 A. Although the homotrimer is not found in liver it may represent the subunit composition of native OGT in tissues that do not contain the p78 subunit (18Kreppel L.K. Blomberg M.A. Hart G.W. J. Biol. Chem. 1997; 272: 9308-9315Abstract Full Text Full Text PDF PubMed Scopus (612) Google Scholar). Note that the contaminating 70-kDa band separates from the His-p110 under these conditions and that no other protein co-migrates with the His-p110 protein by G-250 Coomassie staining (data not shown). The amino-terminal half of the p110 subunit contains 11 tandem TPRs (18Kreppel L.K. Blomberg M.A. Hart G.W. J. Biol. Chem. 1997; 272: 9308-9315Abstract Full Text Full Text PDF PubMed Scopus (612) Google Scholar). TPRs are involved in modulating specific protein-protein interactions, suggesting that the TPR domain of p110 is responsible for the subunit interactions. To address this possibility and to determine whether the TPR domain is required for OGT activity, a series of amino-terminal deletion constructs removing 3, 6, 9, or all 11 TPRs were made. These constructs (referred to as pΔ3 pΔ6, pΔ9, and pΔ11 respectively) were expressed in insects cells and purified as described for the His-p110 construct (data not shown). The specific activity and size of each construct was determined as described above (summarized in Fig. 3). The specific activities of pΔ3 and pΔ6 were similar (1.17 and 1.06 nmol/min/mg, respectively) to His-p110 (1.23 nmol/min/mg) indicating that only five TPRs are required for activity. pΔ9 and pΔ11 had no detectable activity (<0.002 nmol/min/mg); however, neither of the inactive constructs were expressed well in our system, and the large amounts of degraded protein present indicate that these truncated proteins are unstable and may not be folded correctly. Further studies were done only on the pΔ9 protein as it was slightly more stable then the pΔ11 protein. pΔ3 runs as a trimer (apparent molecular weight, ∼290 kDa) at physiological salt concentrations (Fig. 2 B). However, at high salt concentrations (1 m NaCl) pΔ3 runs as a dimer (apparent molecular weight, ∼175) (indicated by theasterisk in Fig. 2 B), indicating that the full complement of TPRs play a role in stabilizing subunit interactions. Interestingly both the active pΔ6 and the inactive pΔ9 are monomers (apparent molecular weights, ∼90 and ∼70 kDa, respectively) at both high salt (data not shown) and at physiological salt concentrations (Fig. 2, C and D). Thus, trimerization is not necessary for OGT activity in our standard assay. The purified p110 is modified by both tyrosine phosphorylation and byO-GlcNAc. We wanted to examine the posttranslational modification state of the His-p110 as well as several of the deletion constructs. Western blot analysis of the nickel affinity purified proteins using an anti-phosphotyrosine antibody shows that both the His-p110 and pΔ6 but not the inactive pΔ9 are immunoreactive. This reactivity is blocked by the addition of 10 mmphosphotyrosine (Fig. 4 A) but not 10 mm tyrosine (data not shown). Similar experiments using antibodies against phosphoserine and phosphothreonine showed no immunoreactivity (data not shown). Densitometry analysis indicates that His-p110 and pΔ6 are phosphorylated to a similar degree (data not shown); however, exact quantitation of the modification is not possible using this methodology. We also probed these proteins with galactosyltransferase (see "Experimental Procedures"). Galactosyltransferase is a specific probe for terminal GlcNAc resides (35Roquemore E.P. Chou T.-Y. Hart G.W. Methods Enzymol. 1994; 230: 443-460Crossref PubMed Scopus (130) Google Scholar, 36Haltiwanger R.S. Hart G.W. Methods Mol. Biol. 1993; 14: 175-187PubMed Google Scholar) that is commonly used to detect O-GlcNAc by covalently labeling the GlcNAc with UDP-[3H]galactose. Following the galactosyltransferase labeling the proteins were further purified by immuoprecipitation with the AL-25 antibody. All three recombinant proteins are labeled with [3H]galactose (Fig. 4 B, lanes 1–3), indicating that they are modified by GlcNAc. The level ofO-GlcNAc modification detected here is substoichiometric with approximately 0.1 O-GlcNAc residue/protein molecule for each construct examined. However, exact quantitation of theO-GlcNAc modification is complicated by many factors including the ability of the modification during purification and accessibility to the galactosyltransferase (35Roquemore E.P. Chou T.-Y. Hart G.W. Methods Enzymol. 1994; 230: 443-460Crossref PubMed Scopus (130) Google Scholar). Thus, it is important to keep in mind that this value reflects a lower limit and the exact level of O-GlcNAcylation may be somewhat higher. It was previously reported that the Km for UDP-GlcNAc of the purified liver enzyme was 0.5 μm. However, these studies were conducted using UDP-GlcNAc concentrations only in the low micromolar range (0.05 μm to 10 μm) and used the 9-mer acceptor peptide, which do
Dynamic posttranslational modification of serine and threonine residues of nucleocytoplasmic proteins by β- N -acetylglucosamine (O-GlcNAc) is a regulator of cellular processes such as transcription, signaling, and protein–protein interactions. Like phosphorylation, O-GlcNAc cycles in response to a wide variety of stimuli. Although cycling of O-GlcNAc is catalyzed by only two highly conserved enzymes, O-GlcNAc transferase (OGT), which adds the sugar, and β- N -acetylglucosaminidase (O-GlcNAcase), which hydrolyzes it, the targeting of these enzymes is highly specific and is controlled by myriad interacting subunits. Here, we demonstrate by multiple specific immunological and enzymatic approaches that histones, the proteins that package DNA within the nucleus, are O-GlcNAcylated in vivo. Histones also are substrates for OGT in vitro. We identify O-GlcNAc sites on histones H2A, H2B, and H4 using mass spectrometry. Finally, we show that histone O-GlcNAcylation changes during mitosis and with heat shock. Taken together, these data show that O-GlcNAc cycles dynamically on histones and can be considered part of the histone code.
O-GlcNAc is a dynamic post-translational modification on myriad nucleocytoplasmic proteins, ranging from transcription factors, signaling proteins, to cytoskeletal proteins. O-GlcNAc is a nutrient sensor involved in the regulation of cellular activity, including transcription, response to stress, and protein-protein interactions. O-GlcNAcase, the O-GlcNAc removal enzyme, has been shown to be a substrate of caspase-3 in vitro. Here we identify the cleavage site of O-GlcNAcase by caspase-3. Using recombinant O-GlcNAcase and recombinant caspase-3, we have mapped the cleavage site by Edman sequencing. We find that the cleavage site is a non-canonical recognition site that occurs after Asp-413 of the tetrapeptide sequence SVVD in the human O-GlcNAcase. A point mutation, D413A, abrogates cleavage by caspase-3 in vitro. We also show that O-GlcNAcase is a substrate of caspase-3 during Fas-mediated apoptosis in vivo separating the two functional domains of this bi-functional enzyme These data suggest that O-GlcNAc cycling is affected by apoptosis induction and that O-GlcNAc and O-GlcNAcase itself are involved in the regulation of apoptosis. Supported by NIH grants CA42486 and HD13563 and G.W. H. receives a share of royalty received by the university on sales of the CTD 110.6 antibody. The terms of this arrangement are being managed by The Johns Hopkins University in accordance with its conflict of interest policies.
Partial Table of Content CHEMICAL SYNTHESIS OF GLYCOSIDES Trichloroacetimidates (R. Schmidt & K. - H. Jung) Iterative Assembly of Glycals and Glycal Derivatives: The Synthesis of Glycosylated Natural Products and Complex Oligosaccharides (L. Williams, et al.) Thioglycosides (S. Oscarson) Glycosylation Methods: Alkylations of Reducing Sugars (J. Tamura) Other Methods of Glycosylation (L. Panza & L. Lay) Glycolipid Synthesis (H. Ishida) Special Problems in Glycosylation Reactions: 2 - Deoxy Sugars (A. Veyrieres) Orthogonal Strategy in Oligosaccharide Synthesis (O. Kanie) Intramolecular Glycosidation Reactions (J. Madsen & M. Bols) SYNTHESIS OF OLIGOSACCHARIDE MIMICS Saccharide - Peptide Hybrids (H. Wessel) Index.
Carbohydrate Composition Analysis of Glycoconjugates By Gas-Liquid Chromatography. Mass Spectrometry. Metabolic Radiolabeling of Glycoconjugates. Nonmetabolic Radiolabeling and Tagging of Glyconconjugates. Enzymatic Deglycosylation of Asparagine-Linked Glycans: Purification, Properties and Specificity of Oligosaccharide-Cleaving Enzymes from Flavobacterium Meningosepticum. Release of Oligosaccharides from Glycoproteins By Hydrazinolysis. Use of Lectins in Analysis of Clycoconjugates. Saccharide Linkage Analysis Using Methylation and Other Techniques. Mass Spectrometry of Carbohydrates-Containing Bipolymers. 1H Nuclear Magnetic Resonance Spectroscopy of Carbohydrate Chains of Glycoproteins. Determination of Sialic Acids. Size Fractionation of Oligosaccharides. High-Ph Anion-Exchange Chromatography of Glycoprotein-Derived Carbohydrates. High-Performance Liquid Chromatography of Pyridylaminated Saccharides. High-Performance Liquid Chromatography of Oligosaccharides. High-Resolution Polycrylamide Gel Electro-Phoresis of Oligosaccharides. Glycosidases in Structural Analysis. Glycosyltransferases in Glycosidase Inhibitors in Study of Glycoconjugates. Synthesis and Use of Azido-Substituted Nucleoside Diphosphate Sugar Photoaffinity Analogs. Glycoform Analysis of Glycoproteins. Isolation of Glycosphingolipids. Thin-Layer Chromatography of Glycosphingolids. Isolation and Characterization of Proteoglycans. Structural Analysis of Glycosylphosphatidylinositol Anchors. Detection of O-Linked N-Acetylglucosamine (O-Glcnac) on Cytoplasmic and Nuclear Proteins. Identification of Polysialic Acids in Glycoconjugates. Neoglycolipds: Probes of Oligosaccharide Structure, Antigenicity, And Function. Author Index. Subject Index.
β‐O‐Linked N‐acetylglucosamine(O‐GlcNAc) modification (O‐GlcNAcylation) is a dynamic posttranslational modification on Ser/Thr residues and increased O‐GlcNAc is associated with insulin resistance. Insulin receptor substrate 1(IRS1) acts as an adaptor protein transferring signals from insulin to downstream PI3K and Akt. It is O‐GlcNAcylated and highly phosphorylated. Here we mainly focused on how O‐GlcNAcylation affects insulin signaling on IRS1 level. We found that insulin signaling is regulated through pharmacologically modifying the two key enzymes’ activity: O‐GlcNAc transferase (OGT) and O‐GlcNAcase (OGA). In addition, we showed phosphorylation status of IRS1 changed accordingly by vertical isoelectrical focusing and two‐dimensional gel electrophoresis. We are performing Stable Isotopic Labeling by Amino Acids in Cell Culture (SILAC) on 3T3‐L1 to detect phosphorylation changes on IRS1 as well as other signaling proteins. In addition, We mapped two O‐GlcNAc sites by CID/ETD‐MS/MS, Ser635 and Ser1001. Ser635 is a main phosphorylation site associated with type II diabetes. We found Cycling rate of O‐GlcNAc on Ser635 is fast, phosphorylation and O‐GlcNAcylation compete at Ser635 in an insulin‐responsive manner. Ongoing studies are testing how O‐GlcNAc on Ser635 affects insulin signaling in 3T3‐L1 and whether O‐GlcNAc of Ser635 affects phosphorylation level of nearby sites. These data suggests O‐GlcNAcylation on IRS1 plays an important role in regulating insulin signaling. Grant Funding Source : NIH R01CA42486, R01DK61671; N01‐HV‐00240; P01HL107153, R24DK084949
Heart failure is a leading cause of death and is associated with increased O-GlcNAcylation (OGN). However, it is unknown if excessive OGN is a direct contributor to cardiomyopathy. OGN modifies pro...
