Influenza A virus (IAV) infections continue to cause substantial morbidity and mortality despite the availability of seasonal vaccines. The extensive genetic variability in seasonal and potentially pandemic influenza strains necessitates new vaccine strategies that can induce universal protection by focusing the immune response on generating protective antibodies against conserved targets within the influenza virus hemagglutinin and neuraminidase proteins.
ABSTRACT Vaccine and antiviral development against SARS-CoV-2 infection or COVID-19 disease currently lacks a validated small animal model. Here, we show that transgenic mice expressing human angiotensin converting enzyme 2 (hACE2) by the human cytokeratin 18 promoter (K18 hACE2) represent a susceptible rodent model. K18 hACE2-transgenic mice succumbed to SARS-CoV-2 infection by day 6, with virus detected in lung airway epithelium and brain. K18 ACE2-transgenic mice produced a modest TH1/2/17 cytokine storm in the lung and spleen that peaked by day 2, and an extended chemokine storm that was detected in both lungs and brain. This chemokine storm was also detected in the brain at day 4. K18 hACE2-transgenic mice are, therefore, highly susceptible to SARS-CoV-2 infection and represent a suitable animal model for the study of viral pathogenesis, and for identification and characterization of vaccines (prophylactic) and antivirals (therapeutics) for SARS-CoV-2 infection and associated severe COVID-19 disease.
Abstract The severe acute respiratory syndrome coronavirus-2 (SARS-CoV-2), the causative agent of COVID-19 illness, has caused millions of infections worldwide. In SARS coronaviruses, the non-structural protein 16 (nsp16), in conjunction with nsp10, methylates the 5′-end of virally encoded mRNAs to mimic cellular mRNAs, thus protecting the virus from host innate immune restriction. We report here the high-resolution structure of a ternary complex of SARS-CoV-2 nsp16 and nsp10 in the presence of cognate RNA substrate analogue and methyl donor, S-adenosyl methionine (SAM). The nsp16/nsp10 heterodimer is captured in the act of 2′-O methylation of the ribose sugar of the first nucleotide of SARS-CoV-2 mRNA. We observe large conformational changes associated with substrate binding as the enzyme transitions from a binary to a ternary state. This induced fit model provides mechanistic insights into the 2′-O methylation of the viral mRNA cap. We also discover a distant (25 Å) ligand-binding site unique to SARS-CoV-2, which can alternatively be targeted, in addition to RNA cap and SAM pockets, for antiviral development.
Equid herpesvirus 1 (EHV-1) is a viral pathogen of horse populations worldwide spread by the respiratory route and is known for causing outbreaks of neurologic syndromes and abortion storms. Previously, we demonstrated that an EHV-1 strain of the neuropathogenic genotype, T953, downregulates the beta interferon (IFN-β) response
Equine herpesvirus-1 (EHV-1) is one of the most important and prevalent viral pathogens of horses and a major threat to the equine industry throughout most of the world. EHV-1 primarily causes respiratory disease but viral spread to distant organs enables the development of more severe sequelae; abortion and neurologic disease. The virus can also remain latent in horses and recrudesce at any time. Recently, there has been a trend of increasing numbers of outbreaks of a devastating form of EHV-1, equine herpesviral myeloencephalopathy. This review presents detailed information on EHV-1, from the discovery of the virus to latest developments on treatment and control of the diseases it causes. We also provide updates on recent EHV-1 research with particular emphasis on viral biology which enables pathogenesis in the natural host. The information presented herein will be useful in understanding EHV-1 and formulating policies that would help limit the spread of EHV-1 within horse populations.
Abstract Dermatophilus congolensis, the aetiological agent of dermatophilosis, is a pleomorphic, Gram‐positive actinomycete, which infects animals and humans. Often, there is a wrong diagnosis of the infection in animals because of the close resemblance of the organism with other members of the family Actinomycetaceae . In this study, molecular tools were applied to suspected isolates of D . congolensis obtained from naturally infected cattle in Nigeria for confirmation of dermatophilosis. DNA extraction from 54 suspected pure colonies of D . congolensis was carried out using the QIA amp ® DNA Mini extraction kit. PCR targeted at the 16S rRNA gene was employed for the confirmation of D . congolensis using 5′‐ ACATGCAAGTCGAACGATGA ‐3′ and 5′‐ ACGCTCGCACCCTACGTATT ‐3′ as forward and reverse primers, respectively. Positive amplicons were then sequenced directly using Big Dye Terminator Cycle Sequencing Kit with the forward primers and AmpliTaq‐ FS DNA Polymerase. Nucleotide sequences were aligned using bioedit (Ibis Biosciences Carlsbad, CA USA) and the phylogenetic analysis was carried out using mega 5.2 (Center for Evolutionary Medicine and Informatics, The Biodesign Institute, Tempe, Arizona, USA) software programme. The aligned nucleotide sequences of 10 positive D . congolensis isolates had between 94% to 99% homology with the sequences of D . congolensis satellite DNA in GenBank. This result also revealed that the sequenced D . congolensis are of different strains. Phylogenetic analysis revealed that D . congolensis , though closely related to Nocardia brasiliensis ( NR 074743.01) and Streptomyces sp. ( JN 400114.1), belongs to different genus. In conclusion, molecular tools employed in the study were able to confirm the identity of the test organisms as D . congolensis . It can also be concluded that two strains of D . congolensis obtained from the study can still be accommodated within the previously listed strains available in GenBank while the remaining eight may be different strains of D . congolensis not yet listed in GenBank.
