Abstract Background Heart failure with preserved ejection fraction (HFpEF) and atrial fibrillation (AF) frequently co-exist. There is a limited understanding on whether this coexistence is associated with distinct alterations in myocardial remodelling and mechanics. We aimed to determine if patients with atrial fibrillation (AF) and heart failure with preserved ejection fraction (HFpEF) represent a distinct phenotype. Methods In this secondary analysis of adults with HFpEF (NCT03050593), participants were comprehensively phenotyped with stress cardiac MRI, echocardiography and plasma fibroinflammatory biomarkers, and were followed for the composite endpoint (HF hospitalisation or death) at a median of 8.5 years. Those with AF were compared to sinus rhythm (SR) and unsupervised cluster analysis was performed to explore possible phenotypes. Results 136 subjects were included (SR = 75, AF = 61). The AF group was older (76 ± 8 vs. 70 ± 10 years) with less diabetes (36% vs. 61%) compared to the SR group and had higher left atrial (LA) volumes (61 ± 30 vs. 39 ± 15 mL/m 2 , p < 0.001), lower LA ejection fraction (EF) (31 ± 15 vs. 51 ± 12%, p < 0.001), worse left ventricular (LV) systolic function (LVEF 63 ± 8 vs. 68 ± 8%, p = 0.002; global longitudinal strain 13.6 ± 2.9 vs. 14.7 ± 2.4%, p = 0.003) but higher LV peak early diastolic strain rates (0.73 ± 0.28 vs. 0.53 ± 0.17 1/s, p < 0.001). The AF group had higher levels of syndecan-1, matrix metalloproteinase-2, proBNP, angiopoietin-2 and pentraxin-3, but lower level of interleukin-8. No difference in clinical outcomes was observed between the groups. Three distinct clusters were identified with the poorest outcomes (Log-rank p = 0.029) in cluster 2 (hypertensive and fibroinflammatory) which had equal representation of SR and AF. Conclusions Presence of AF in HFpEF is associated with cardiac structural and functional changes together with altered expression of several fibro-inflammatory biomarkers. Distinct phenotypes exist in HFpEF which may have differing clinical outcomes.
Liver fatty-acid-binding protein (L-FABP) is a cytoplasmic polypeptide that binds with strong affinity especially to long-chain fatty acids (LCFAs). It is highly expressed in both the liver and small intestine, where it is thought to have an essential role in the control of the cellular fatty acid (FA) flux. Because expression of the gene encoding L-FABP is increased by both fibrate hypolipidaemic drugs and LCFAs, it seems to be under the control of transcription factors, termed peroxisome-proliferator-activated receptors (PPARs), activated by fibrate or FAs. However, the precise molecular mechanism by which these regulations take place remain to be fully substantiated. Using transfection assays, we found that the different PPAR subtypes (α, γ and δ) are able to mediate the up-regulation by FAs of the gene encoding L-FABP in vitro. Through analysis of LCFA- and fibrate-mediated effects on L-FABP mRNA levels in wild-type and PPARα-null mice, we have found that PPARα in the intestine does not constitute a dominant regulator of L-FABP gene expression, in contrast with what is known in the liver. Only the PPARδ/α agonist GW2433 is able to up-regulate the gene encoding L-FABP in the intestine of PPARα-null mice. These findings demonstrate that PPARδ can act as a fibrate/FA-activated receptor in tissues in which it is highly expressed and that L-FABP is a PPARδ target gene in the small intestine. We propose that PPARδ contributes to metabolic adaptation of the small intestine to changes in the lipid content of the diet.
Proprotein convertase subtisilin kexin type 9 (PCSK9) promotes LDL receptor (LDLR) degradation and its absence confers life-long low LDL-cholesterol, protection against coronary artery disease. Afro-americans patients with nonsense PCSK9 mutations are less prone to hypertension and plasma PCSK9 is weakly associated to blood pressure (BP) in large cohorts. Recent evidences suggest that PCSK9 degrades the VLDLR in the adipose tissue. This receptor has been involved in hypoxia-induced lipotoxicity following myocardial infarction. Objectives: We aimed at verifying whether PCSK9 affects heart VLDLR content, myocardial function and BP. Methods: We used PCSK9 -/- and PCSK9+/+ mouse littermates (n = 4-6 per group, 3 to 4 month-old males). Two-dimensional LV long-axis and M-mode images were obtained by echocardiography. Mice were also chronically treated with L-NAME (2 mg/kg/d), angiotensin II (minipump, 1 mg/kg/d ) or DOCA-Salt following unilateral nephrectomy.". BP was measured under a 12:12-hour light/dark schedule using a radiotelemetry system or by computerized tail cuff plethysmography. Results: Hearts from random-fed PCSK9 -/- mice didn’t have more VLDLR content (protein and mRNA) than those of PCSK9+/+ mice and had equal TG contents. Fasting (12h) increased myocardial TG contents to the same extent in both genotypes (+ 100%, fed PCSK9++, PCSK9 -/- vs fasted PCSK9++, PCSK9-/-: 18±5,4 microg/mg, 18,5± 11 microg/mg vs 36±3,5 microg/mg, 38± 5,1 microg/mg, n=3). Despite a ∼6-fold increase in plasma PCSK9 concentrations compared to C57Bl6J mice, hearts from LDLR knockout mice had equal quantities of VLDLR protein. Injecting (i.v.) 125 μg of hPCSK9 in PCSK9+/+ mice (>300 times the physiological concentration) led to an 83% (p<0.05) decrease in mature VLDLR, in the heart and to a >90% decrease of hepatic LDLR, as measured by western blot 1h after the injection. Thus, supra-physiological concentrations of PCSK9 can acutely degrade the VLDLR in mouse heart. The dimensions of the ventricular cavity and the thickness of the septal and the posterior walls as well as LV systolic and diastolic functions were unchanged in PCSK9 -/- mice. In addition, PCSK9-deficiency did not alter either basal BP or the elevated BP in several models of hypertension. Collectively these results show that PCSK9 deficiency is neutral on blood pressure or myocardium function at a young age in mice. Plasma PCSK9 at physiological or pathophysiological concentrations do not decrease VLDLR content in the heart.
Mutations in Proprotein Convertase Subtilisin Kexin 9 (PCSK9) have been associated with autosomal dominant hypercholesterolemia. In vivo kinetic studies indicate that LDL catabolism was impaired and apolipoprotein B (apoB)-containing lipoprotein synthesis was enhanced in two patients presenting with the S127R mutation on PCSK9. To understand the physiological role of PCSK9, we overexpressed human PCSK9 in mouse and cellular models as well as attenuated the endogenous expression of PCSK9 in HuH7 hepatoma cells using RNA interference. Here, we show that PCSK9 dramatically impairs the expression of the low density lipoprotein receptor (LDLr) and, in turn, LDL cellular binding as well as LDL clearance from the plasma compartment in C57BL6/J mice but not in LDLr-deficient mice, establishing a definitive role for PCSK9 in the modulation of the LDLr metabolic pathway. In contrast to data obtained in S127R-PCSK9 patients presenting with increased apoB production, our study indicates that wild-type PCSK9 does not significantly alter the production and/or secretion of VLDL apoB in either cultured cells or mice.Finally, we show that unlike PCSK9 overexpression in mice, the S127R mutation in patients led to increased VLDL apoB levels, suggesting a potential gain of function for S127R-PCSK9 in humans. Mutations in Proprotein Convertase Subtilisin Kexin 9 (PCSK9) have been associated with autosomal dominant hypercholesterolemia. In vivo kinetic studies indicate that LDL catabolism was impaired and apolipoprotein B (apoB)-containing lipoprotein synthesis was enhanced in two patients presenting with the S127R mutation on PCSK9. To understand the physiological role of PCSK9, we overexpressed human PCSK9 in mouse and cellular models as well as attenuated the endogenous expression of PCSK9 in HuH7 hepatoma cells using RNA interference. Here, we show that PCSK9 dramatically impairs the expression of the low density lipoprotein receptor (LDLr) and, in turn, LDL cellular binding as well as LDL clearance from the plasma compartment in C57BL6/J mice but not in LDLr-deficient mice, establishing a definitive role for PCSK9 in the modulation of the LDLr metabolic pathway. In contrast to data obtained in S127R-PCSK9 patients presenting with increased apoB production, our study indicates that wild-type PCSK9 does not significantly alter the production and/or secretion of VLDL apoB in either cultured cells or mice. Finally, we show that unlike PCSK9 overexpression in mice, the S127R mutation in patients led to increased VLDL apoB levels, suggesting a potential gain of function for S127R-PCSK9 in humans. Autosomal dominant hypercholesterolemia is associated with mutations in genes involved in the regulation of LDL homeostasis. The most common and severe form of monogenic hypercholesterolemia is familial hypercholesterolemia (FH), caused by mutations in the low density lipoprotein receptor (LDLr) (1Brown M.S. Goldstein J.L. A receptor-mediated pathway for cholesterol homeostasis.Science. 1986; 232: 34-47Crossref PubMed Scopus (4307) Google Scholar). FH is characterized by increased plasma LDL-cholesterol levels and premature cardiovascular disease (2Rader D.J. Cohen J. Hobbs H.H. Monogenic hypercholesterolemia: new insights in pathogenesis and treatment.J. Clin. Invest. 2003; 111: 1795-1803Crossref PubMed Scopus (467) Google Scholar). Another form of this disease, familial defective apoB-100, is caused by mutations in the LDLr binding domain of apolipoprotein B-100 (apoB-100) (3Soria L.F. Ludwig E.H. Clarke H.R. Vega G.L. Grundy S.M. McCarthy B.J. Association between a specific apolipoprotein B mutation and familial defective apolipoprotein B-100.Proc. Natl. Acad. Sci. USA. 1989; 86: 587-591Crossref PubMed Scopus (463) Google Scholar). ApoB-100 is synthesized by the liver and is the major protein component of VLDL and LDL (4Yang C.Y. Chen S.H. Gianturco S.H. Bradley W.A. Sparrow J.T. Tanimura M. Li W.H. Sparrow D.A. DeLoof H. Rosseneu M. Sequence, structure, receptor-binding domains and internal repeats of human apolipoprotein B-100.Nature. 1986; 323: 738-742Crossref PubMed Scopus (269) Google Scholar). Recently, Proprotein Convertase Subtilisin Kexin 9 (PCSK9) has been identified as the third gene involved in autosomal dominant hypercholesterolemia (5Abifadel M. Varret M. Rabes J.P. Allard D. Ouguerram K. Devillers M. Cruaud C. Benjannet S. Wickham L. Erlich D. et al.Mutations in PCSK9 cause autosomal dominant hypercholesterolemia.Nat. Genet. 2003; 34: 154-156Crossref PubMed Scopus (2134) Google Scholar). PCSK9 encodes a proprotein convertase known as Neural Apoptosis-Regulated Convertase-1 (6Seidah N.G. Benjannet S. Wickham L. Marcinkiewicz J. Jasmin S.B. Stifani S. Basak A. Prat A. Chretien M. The secretory proprotein convertase neural apoptosis-regulated convertase 1 (NARC-1): liver regeneration and neuronal differentiation.Proc. Natl. Acad. Sci. USA. 2003; 100: 928-933Crossref PubMed Scopus (896) Google Scholar). Proprotein convertases are proteolytic enzymes involved in the regulation of biological activities of a wide variety of proteins synthesized as inactive precursors, such as matrix metalloproteases, adhesion molecules, prohormones, and growth factors (7Seidah N.G. Chretien M. Proprotein and prohormone convertases: a family of subtilases generating diverse bioactive polypeptides.Brain Res. 1999; 848: 45-62Crossref PubMed Scopus (682) Google Scholar, 8Steiner D.F. The proprotein convertases.Curr. Opin. Chem. Biol. 1998; 2: 31-39Crossref PubMed Scopus (577) Google Scholar, 9Zhou A. Webb G. Zhu X. Steiner D.F. Proteolytic processing in the secretory pathway.J. Biol. Chem. 1999; 274: 20745-20748Abstract Full Text Full Text PDF PubMed Scopus (409) Google Scholar). PCSK9 is the ninth member of the mammalian subtilisin serine protease family (6Seidah N.G. Benjannet S. Wickham L. Marcinkiewicz J. Jasmin S.B. Stifani S. Basak A. Prat A. Chretien M. The secretory proprotein convertase neural apoptosis-regulated convertase 1 (NARC-1): liver regeneration and neuronal differentiation.Proc. Natl. Acad. Sci. USA. 2003; 100: 928-933Crossref PubMed Scopus (896) Google Scholar, 10Naureckiene S. Ma L. Sreekumar K. Purandare U. Lo C.F. Huang Y. Chiang L.W. Grenier J.M. Ozenberger B.A. Jacobsen J.S. et al.Functional characterization of Narc 1, a novel proteinase related to proteinase K.Arch. Biochem. Biophys. 2003; 420: 55-67Crossref PubMed Scopus (132) Google Scholar).The negative regulation of PCSK9 expression in mice fed a high-fat/high-cholesterol diet suggests a direct role for PCSK9 in cholesterol metabolism (11Maxwell K.N. Soccio R.E. Duncan E.M. Sehayek E. Breslow J.L. Novel putative SREBP and LXR target genes identified by microarray analysis in liver of cholesterol-fed mice.J. Lipid Res. 2003; 44: 2109-2119Abstract Full Text Full Text PDF PubMed Scopus (302) Google Scholar). It has been shown that adenovirus-mediated expression of murine PCSK9 in control but not in LDLr-knockout (KO) mice results in increased plasma LDL-cholesterol, which is associated with decreased hepatic LDLr expression. Furthermore, PCSK9 overexpression decreases the expression of the LDLr and, in turn, LDL uptake in cultured cells (12Benjannet S. Rhainds D. Essalmani R. Mayne J. Wickham L. Jin W. Asselin M.C. Hamelin J. Varret M. Allard D. et al.NARC-1/PCSK9 and its natural mutants: zymogen cleavage and effects on the low density lipoprotein (LDL) receptor and LDL cholesterol.J. Biol. Chem. 2004; 279: 48865-48875Abstract Full Text Full Text PDF PubMed Scopus (496) Google Scholar, 13Maxwell K.N. Breslow J.L. Adenoviral-mediated expression of Pcsk9 in mice results in a low-density lipoprotein receptor knockout phenotype.Proc. Natl. Acad. Sci. USA. 2004; 101: 7100-7105Crossref PubMed Scopus (497) Google Scholar). Our laboratory recently published a series of kinetic studies of apoB-100 in patients carrying the S127R mutation in PCSK9. These studies indicate that the S127R mutation in PCSK9 is associated with higher production rates of VLDL apoB-100 as well as decreased LDL apoB-100 fractional catabolic rate (FCR) (14Ouguerram K. Chetiveaux M. Zair Y. Costet P. Abifadel M. Varret M. Boileau C. Magot T. Krempf M. Apolipoprotein B100 metabolism in autosomal-dominant hypercholesterolemia related to mutations in PCSK9.Arterioscler. Thromb. Vasc. Biol. 2004; 24: 1448-1453Crossref PubMed Scopus (163) Google Scholar), suggesting that PCSK9 may act on both apoB synthesis and catabolism in vivo.To gain further insight into the role of PCSK9, we overexpressed human PCSK9 in mice as well as transiently overexpressed or attenuated PCSK9 expression in cultured HuH7 hepatoma cells and measured the catabolism of LDL particles and the endogenous synthesis of VLDL and/or apoB in both experimental models. We show that PCSK9 overexpression does not significantly alter apoB production and that PCSK9 directly inhibits LDLr expression and activity in mice and cultured cells.METHODSRecombinant adenovirus and animal proceduresHuman PCSK9 cDNA with a C-terminal V5 tag (6Seidah N.G. Benjannet S. Wickham L. Marcinkiewicz J. Jasmin S.B. Stifani S. Basak A. Prat A. Chretien M. The secretory proprotein convertase neural apoptosis-regulated convertase 1 (NARC-1): liver regeneration and neuronal differentiation.Proc. Natl. Acad. Sci. USA. 2003; 100: 928-933Crossref PubMed Scopus (896) Google Scholar) was subcloned into pAdTrack-CMV (15He T.C. Zhou S. da Costa L.T. Yu J. Kinzler K.W. Vogelstein B. A simplified system for generating recombinant adenoviruses.Proc. Natl. Acad. Sci. USA. 1998; 95: 2509-2514Crossref PubMed Scopus (3230) Google Scholar). The adenovirus vectors coding human PCSK9 cDNA and a sham control adenovirus (Ad-PCSK9 and Ad-Null, respectively) were generated by the Vector Core of the University Hospital of Nantes (16Fromes Y. Salmon A. Wang X. Collin H. Rouche A. Hagege A. Schwartz K. Fiszman M.Y. Gene delivery to the myocardium by intrapericardial injection.Gene Ther. 1999; 6: 683-688Crossref PubMed Scopus (108) Google Scholar). Male controls and LDLr-KO mice (Charles River, l'Arbresle, France) on a pure C57BL6/J background (8–12 weeks old) were housed in a pathogen-free facility under a standard 12 h light/12 h dark cycle and fed standard rodent chow and water ad libitum. Mice were anesthetized with isoflurane (Abbott, Rungis, France) and injected with 5 × 108 plaque-forming units via the penis vein. Blood samples were collected from the retro-orbital plexus and centrifuged at 2,500 g for 20 min at 4°C for plasma isolation. Five days after infusion, a subset of mice was killed and their livers harvested, frozen in liquid nitrogen, and stored at −80°C.LDL (1.019 < d < 1.006) was isolated from 2 ml of pooled LDLr-KO mouse plasma by sequential ultracentrifugation in KBr at 5°C and 95,000 rpm for 4 h. The 125I-labeled apoB-LDL was prepared by a modification of the iodine monochloride method (17S. Mc Farlane, A. Efficient trace-labeling of proteins with iodine.Nature. 1958; 182: 53-57Crossref Scopus (1491) Google Scholar), then reisolated by ultracentrifugation and dialyzed overnight against 1× PBS and 0.01% EDTA. The preparation was analyzed by fast-protein liquid chromatography (FPLC) and agarose gel electrophoresis to ensure the integrity and purity of the particle. Mice were injected with 125I-labeled apoB-LDL (106 dpm) and sequentially bled over 2 days. The 125I-labeled apoB remaining in the plasma compartment was measured in plasma using a γ counter (Packard Instruments, Downers Grove, IL). We ascertained that more than 98% of the radioactivity remained associated with apoB by SDS-PAGE. The FCR was determined from the area under the apoB radioactivity curves using a multiexponential curve-fitting technique with the WinSAAM program (version 3.0.1) (18Greif P. Wastney M. Linares O. Boston R. Balancing needs, efficiency, and functionality in the provision of modeling software: a perspective of the NIH WinSAAM Project.Adv. Exp. Med. Biol. 1998; 445: 3-20Crossref PubMed Scopus (36) Google Scholar). Alternatively, mice were injected with tyloxapol (Sigma; 500 μg/g body weight). Plasma VLDL/chylomicron-triglyceride (TG) clearance in mice is completely inhibited under these conditions. Blood samples were taken from each mouse at 0, 45, 90, and 180 min after injection (19Boisfer E. Lambert G. Atger V. Tran N.Q. Pastier D. Benetollo C. Trottier J.F. Beaucamps I. Antonucci M. Laplaud M. et al.Overexpression of human apolipoprotein A-II in mice induces hypertriglyceridemia due to defective very low density lipoprotein hydrolysis.J. Biol. Chem. 1999; 274: 11564-11572Abstract Full Text Full Text PDF PubMed Scopus (82) Google Scholar). The accumulation of newly synthesized VLDL/chylomicron-TG was measured in plasma aliquots. The accumulation of apoB was quantified by Western blot.Plasma collection, chemistry, and lipase activityFasting plasma from a normolipemic individual, from a representative heterozygous FH subject (20Maugeais C. Ouguerram K. Frenais R. Maugere P. Charbonnel B. Magot T. Krempf M. Effect of low-density lipoprotein apheresis on kinetics of apolipoprotein B in heterozygous familial hypercholesterolemia.J. Clin. Endocrinol. Metab. 2001; 86: 1679-1686PubMed Google Scholar), and from two patients with the S127R PCSK9 mutation (14Ouguerram K. Chetiveaux M. Zair Y. Costet P. Abifadel M. Varret M. Boileau C. Magot T. Krempf M. Apolipoprotein B100 metabolism in autosomal-dominant hypercholesterolemia related to mutations in PCSK9.Arterioscler. Thromb. Vasc. Biol. 2004; 24: 1448-1453Crossref PubMed Scopus (163) Google Scholar) was collected for apoB FPLC analysis. Plasma total cholesterol (TC), TGs, cholesteryl esters, and high density lipoprotein-cholesterol (HDL-C) were measured using commercial kits, and plasma lipoproteins from either pooled mouse samples (150 μl) or from patients (200 μl) were resolved by FPLC as described elsewhere (21Lambert G. Chase M.B. Dugi K. Bensadoun A. Brewer Jr., H.B. Santamarina-Fojo S. Hepatic lipase promotes the selective uptake of high density lipoprotein-cholesteryl esters via the scavenger receptor B1.J. Lipid Res. 1999; 40: 1294-1303Abstract Full Text Full Text PDF PubMed Google Scholar). Human plasma apoB was quantified in the FPLC fractions as described previously (14Ouguerram K. Chetiveaux M. Zair Y. Costet P. Abifadel M. Varret M. Boileau C. Magot T. Krempf M. Apolipoprotein B100 metabolism in autosomal-dominant hypercholesterolemia related to mutations in PCSK9.Arterioscler. Thromb. Vasc. Biol. 2004; 24: 1448-1453Crossref PubMed Scopus (163) Google Scholar). Mouse postheparin plasma lipase activity was assayed as described previously (22Iverius P.H. Brunzell J.D. Human adipose tissue lipoprotein lipase: changes with feeding and relation to postheparin plasma enzyme.Am. J. Physiol. 1985; 249: E107-E114PubMed Google Scholar).Western blots and quantitative RT-PCRLiver pieces were homogenized in 1× PBS containing 0.25% Na-deoxycholate and 1% Triton X-100. Cultured cells were lysed in a buffer containing 50 mM Tris, 150 mM NaCl, 1 mM EDTA, 1% Triton X-100, and 0.25% sodium deoxycholate. Both buffers contained a protease inhibitor cocktail (Roche Diagnostics, Mannheim, Germany). The supernatant was collected, and proteins (50 μg of liver protein, 25–30 μg of cell proteins) were resolved on Nu-PAGE 4–12% Bis-Tris gels in MES-SDS buffer (Invitrogen, Cergy Pontoise, France) under reducing conditions. Cell lysates were spun at 14,000 rpm for 15 min at 4°C. Protein concentration was determined using the bicinchoninic acid protein assay kit (Interchim, Montluçon, France). Proteins were transferred onto a Protran nitrocellulose membrane (Schleicher and Shuell, Dassel, Germany), probed with polyclonal chicken anti-LDLr antibody (RDI, Flanders, NJ) or scavenger receptor class B type I (SR-BI; Novus, Littleton, CO) for mouse proteins and anti-LDLr antibody (Progen Biotechnik, Heidelberg, Germany) for cellular proteins using Vectastain PK6101 (AbCys, Paris, France). The monoclonal anti-V5 antibody (Invitrogen), targeting only the human transgene, as well as rabbit IgG directed against the ERTARRLQAQAARRGY peptide (Neosystem, Strasbourg, France), referred to as E16Y, within the prodomain of PCSK9 were used to probe mouse liver proteins as described above using the ECL plus kit (Amersham, Little Shalfont, UK). Mouse apoA-I, apoA-II, apoE, and apoB within FPLC fractions (10 μl) were analyzed by Western blot using antibodies raised against the purified apolipoproteins (Biodesign, Saco, ME) (23Vaisman B.L. Lambert G. Amar M. Joyce C. Ito T. Shamburek R.D. Cain W.J. Fruchart-Najib J. Neufeld E.D. Remaley A.T. et al.ABCA1 overexpression leads to hyperalphalipoproteinemia and increased biliary cholesterol excretion in transgenic mice.J. Clin. Invest. 2001; 108: 303-309Crossref PubMed Scopus (220) Google Scholar).Cellular RNA was isolated using the RNeasy kit and Qiashredder mini columns as well as RNase-free DNase I (Qiagen, Courtaboeuf, France). First-strand cDNA was synthesized with random primers using a Superscript II RNaseH reverse transcriptase reagent kit (Invitrogen). Quantification of human PCSK9 mRNA was performed using Assays-on-Demand and the Taqman universal PCR Master Mix (Applied Biosystems, Courtaboeuf, France). All samples were normalized to ribosomal protein L13a expression.LDL binding, apoB synthesis, and microsomal transfer protein activity in cultured cellsHuH7 cells (24Higashi Y. Itabe H. Fukase H. Mori M. Fujimoto Y. Takano T. Transmembrane lipid transfer is crucial for providing neutral lipids during very low density lipoprotein assembly in endoplasmic reticulum.J. Biol. Chem. 2003; 278: 21450-21458Abstract Full Text Full Text PDF PubMed Scopus (37) Google Scholar) were plated at a density of 2 × 105 cells on 12-well plates and transfected the next day with human PCSK9 short, interfering RNA (siRNA) (AAGGUCUGGAAUGCAAAGUCA) or a nonspecific SiCONTROL nontargeting siRNA#1 (Dharmacon, Lafayette, CO) and/or pIRES-hPCSK9 using the Lipofectamine 2000 reagent (Invitrogen). After 48 h in complete medium, cells were washed twice with PBS at 4°C and incubated with 4 μg/ml (3,3'-dioctadecylindocarbocyanine iodide)-LDL (DiI-LDL) (Invitrogen) in DMEM containing 10% lipoprotein-deficient serum for 30 min at 4°C. Cells were washed extensively to remove unbound DiI-LDL and fixed for 25 min in 4% Paraformaldehyde at room temperature, washed twice with PBS, and maintained in PBS containing NaN3 and analyzed for DiI fluorescence by microscopy. In a subset of studies, the cells were incubated in serum-free medium 1 day before LDL binding assay.HuH7 cells plated on six-well plates were washed twice with PBS and incubated for 1 h in methionine/cysteine-free medium containing 0.5 mM oleic acid. Cells were then pulsed for 30 min with 200 μCi/ml [35S]methionine/[35S]cysteine mix (Express EasyTag; Perkin-Elmer Life Sciences, Boston, MA) and chased in DMEM containing 5 mM methionine and cysteine. At the end of the pulse-chase, medium was transferred into tubes containing a cocktail of protease inhibitors (Roche Diagnostics). Cells were washed twice with cold PBS and lysed directly in the wells by the addition of a 50 mM Tris, 150 mM NaCl, 1 mM EDTA, 1% Triton X-100, and 0.25% sodium deoxycholate buffer containing the protease inhibitor cocktail. Both media and cell lysates were homogenized on a rocking platform for 1 h at 4°C and centrifuged for 10 min at 10,000 g to pellet cell debris. Supernatants were combined with 3× Radioimmunoprecipitation (RIPA) buffer before immunoprecipitation. Cell extracts and medium were incubated with an excess of goat anti-human apoB antibody (Santa Cruz Biotechnology, Santa Cruz, CA) and incubated overnight at 4°C. Antigen-antibody complexes were isolated by centrifugation after incubation for 2 h at 4°C with protein A/G agarose plus (Santa Cruz Biotechnology). The complexes were subjected to three washes with RIPA and two with PBS. The tubes were incubated for 10 min at 4°C and centrifuged for 2 min at 4,000 rpm to pellet the complexes between each wash. The immunoprecipitated complexes were boiled for 5 min in 50 μl of lauryl dodecyl sulfate reducing buffer (Invitrogen) and centrifuged, and the supernatant was resolved by gel electrophoresis and scintillation counting. The 35S-labeled apoB protein bands were quantified using a phosphorimager.For microsomal transfer protein (MTP) activity assay, the cells were washed twice with PBS, harvested in 200 μl of 10 mM Tris, 150 mM NaCl, and 1 mM EDTA buffer containing the protease inhibitor cocktail, and lysed by sonication. MTP activity was measured using 40 μg of the homogenate and a commercial kit (Calbiochem-Novabiochem Corp., San Diego, CA).Statistical analysisValues are expressed as means ± SEM. Comparisons between groups were made using Student's t-test for independent samples (one-tailed).RESULTSHuman PCSK9 expression in mice after infusion of recombinant adenovirusThe expression of PCSK9 in C57BL6/J mice after injection of either Ad-PCSK9 or Ad-Null was quantified by immunoblot analysis of liver extracts using a polyclonal anti-PCSK9 antibody that recognizes both murine and human pro-PCSK9. Peak expression of pro-PCSK9 occurred 4–5 days after infusion (data not shown). Figure 1Ashows representative data from day 5 C57BL6/J mouse liver extracts of both Ad-PCSK9- and Ad-Null-infused groups. Mice injected with Ad-PCSK9 had two to three times more hepatic pro-PCSK9 protein than sham-injected mice. Immunoblot analysis of the same liver extracts using a monoclonal V5 antibody that recognizes only the human PCSK9 transgene indicated that in mouse liver human pro-PCSK9 is processed into mature PCSK9 (Fig. 1A).Plasma lipids and LDL catabolism in mice overexpressing PCSK9The plasma lipids of C57BL6/J mice after Ad-PCSK9 infusion were determined at day 5 after infusion (Table 1). The plasma levels of TC and cholesteryl ester but not those of HDL-C and TG were significantly increased in mice overexpressing PCSK9 versus controls, with the maximal plasma TC level reached 5 days after adenoviral infusion (i.e., upon peak expression of the transgene) (Fig. 1B). To assess the distribution of cholesterol within the plasma lipoproteins, pooled plasma samples from both Ad-PCSK9- and Ad-Null-infused mice were fractionated by FPLC (Fig. 1C). The cholesterol distribution in the Ad-PCSK9-infused group exhibited a dramatic increase in cholesterol content within the LDL and intermediate density lipoprotein (IDL)-sized lipoproteins compared with controls. To explore the mechanisms responsible for increased LDL/IDL-C in mice infused with Ad-PCSK9, we measured the hepatic expression of two major lipoprotein receptors (i.e., LDLr and SR-BI) by immunoblot analysis. The expression of the LDLr was dramatically decreased in the livers of Ad-PCSK9-infused mice (Fig. 1A), whereas the expression of the HDL receptor SR-BI remained unchanged. To further explore the molecular pathway responsible for increased LDL-cholesterol in mice overexpressing PCSK9, we performed Ad-PCSK9 and Ad-Null infusions in LDLr-KO male mice. Representative data for the hepatic levels of pro-PCSK9, SR-BI, and LDLr of LDLr-KO mice injected with either Ad-Null or Ad-PCSK9 are reported in Fig. 1A. The plasma lipids (Table 1) as well as the FPLC profiles (Fig. 1C) of LDLr-KO mice infused with either Ad-Null or Ad-PCSK9 were similar. The plasma TC levels of LDLr-KO mice infused with either Ad-Null or Ad-PCSK9 were similar at days 4, 5, 7, and 9 after adenoviral infusion (Fig. 1B). Notably, the dramatic LDL/IDL-C increase observed in C57BL6/J mice overexpressing PCSK9 was associated with a concomitant increase in the levels of LDL/IDL-apoB-100 and, to a lesser extent, LDL/IDL-apoB-48, similar to those of LDLr-KO mice (Fig. 1C, inset). No changes in apolipoprotein levels were detected after infusion of Ad-PCSK9 in LDLr-KO mice. Consistent with plasma HDL-C levels, the infusion of Ad-PCSK9 did not affect the apoA-I and apoA-II contents of the HDL particles. Thus, our data indicate that expression of PCSK9 in control mice results in a selective increase of LDL/IDL-C and LDL/IDL-apoB associated with a decrease in the hepatic expression of the LDLr.TABLE 1Plasma lipids of C57BL6/J controls and LDLr-KO male mice at 5 days after infusion of either Ad-PCSK9 or Ad-NullC57BL6/JLDLr-KOVariableAd-Null (n = 6)Ad-PCSK9 (n = 6)Ad-Null (n = 4)Ad-PCSK9 (n = 4)mg/dlTotal cholesterol74 ± 8176 ± 23aP < 0.05 versus Ad-Null injected C57B16/J.239 ± 13222 ± 11High density lipoprotein-cholesterol59 ± 764 ± 571 ± 1070 ± 12Cholesteryl ester64 ± 9149 ± 18aP < 0.05 versus Ad-Null injected C57B16/J.203 ± 11201 ± 12Triglyceride88 ± 1586 ± 9123 ± 14120 ± 12KO, knockout; LDLr, low density lipoprotein receptor; PCSK9, Proprotein Convertase Subtilisin Kexin 9.a P < 0.05 versus Ad-Null injected C57B16/J. Open table in a new tab To define the underlying mechanism by which PCSK9 reduces LDL cholesterol in C57BL6/J but not LDLr-KO mice, we performed a series of kinetic analyses of 125I-apoB-labeled LDL 5 days after injection of either Ad-Null or Ad-PCSK9 into both mouse lines. Plasma was collected at multiple time points after the initial injection of radiolabeled LDL, and the plasma decay of apoB was ascertained (Fig. 2). Compared with Ad-Null-injected controls, Ad-PCSK9-injected C57BL6/J mice had markedly delayed plasma clearance of 125I-apoB-LDL (FCR = 5.4 ± 0.2 vs. 4.5 ± 0.2 day−1, respectively; P < 0.03). In contrast, the catabolism of 125I-apoB-LDL was similar in LDLr-KO mice infused with either Ad-Null or Ad-PCSK9 (FCR = 4.0 ± 0.3 vs. 4.1 ± 0.4 day−1, respectively; P > 0.9) and delayed compared with C57BL6/J mice infused with Ad-Null (P < 0.01). Thus, PCSK9 attenuates the clearance of 125I-apoB-LDL in controls but not in LDLr-KO mice, establishing that PCSK9 promotes a decrease in hepatic LDLr expression and activity in vivo.Fig. 2Kinetic analysis of plasma 125I-apoB-labeled LDL in C57BL6/J controls (n = 6 per group; closed symbols) and LDLr-KO male mice (n = 4 per group; open symbols) infused with either Ad-PCSK9 (squares) or Ad-Null (diamonds). Five days after adenoviral infusion, the mice were injected with 125I-apoB-labeled LDL, and the plasma decay of the label was measured in plasma aliquots from sequential bleedings over 48 h. Values are expressed as means ± SEM. a P < 0.05 between LDLr-KO and C57BL6/J controls, both infused with Ad-Null. b P < 0.05 between C57BL6/J controls infused with Ad-PCSK9 and infused with Ad-Null.View Large Image Figure ViewerDownload (PPT)PCSK9 gene silencing and overexpression in HuH7 hepatomas modulate LDLr-mediated DiI-LDL bindingTo elucidate the role of PCSK9, we developed in parallel a transient knockdown model in the human hepatoma cell line HuH7 using RNA interference attenuation. As shown in Fig. 3A, transient transfection of siRNA duplexes against human PCSK9 in HuH7 decreases endogenous PCSK9 mRNA by ∼80% and totally suppresses PCSK9 overexpression mediated by pIRES-hPCSK9 (Fig. 3B). Overexpression of human PCSK9 in HuH7 decreases LDLr protein expression, and cotransfection of human PCSK9 siRNA virtually blocks the effects of the human PCSK9 overexpression (Fig. 3B). Transfection of human PCSK9 siRNA increased endogenous expression of the LDLr in HuH7 by 33% (Fig. 3C). We investigated the effect of PCSK9 gene silencing on LDLr function in HuH7 overexpressing or attenuated for PCSK9. The activity of the LDLr was determined by measuring the cellular binding of DiI-LDL by fluorescence microscopy at 4°C. PCSK9 gene silencing caused a 2.2-fold increase in DiI-LDL binding, whereas overexpression of human PCSK9 decreased DiI-LDL binding by 55% (Fig. 3D).Fig. 3A: Real-time PCR measurement of PCSK9 expression in HuH7 hepatoma cells transfected with short, interfering RNA (siRNA) targeting human PCSK9 (black bar). Controls were either not transfected (white bar; CTRL) or transfected with a nonspecific (Ns) siRNA (gray bar). The assay is standardized for human ribosomal protein L13a. Values are expressed as means ± SEM. B: Western blot analysis of V5-tagged PCSK9 and LDLr in HuH7 cells cotransfected with pIRES-hPCSK9 with or without anti-human PCSK9 siRNA. C: Western blot analysis of LDLr in HuH7 cells transfected or not with anti-human PCSK9 siRNA. D: DiI-LDL binding to HuH7 cells at 48 h after transfection with pIRES-hPCSK9 (A), nothing (B), or siRNA targeting human PCSK9 (C) (magnification ×50). The quantification of the DiI-LDL binding from three independent experiments performed in duplicate is presented. AU, arbitrary units; DiI, 3,3'-dioctadecylindocarbocyanine iodide. Values are expressed as means ± SEM. * P < 0.05 versus nontransfected cells.View Large Image Figure ViewerDownload (PPT)Analysis of VLDL metabolismTo further explore the molecular mechanisms by which PCSK9 affects apoB-containing lipoprotein metabolism, we injected tyloxapol, which blocks the hydrolysis of TG by plasma lipases, in C57BL6/J mice infused with either Ad-PCSK9 or Ad-Null. There was no significant difference in the plasma accumulation of newly synthesized VLDL between groups (Fig. 4A). There was a trend (P = 0.08) toward increased apoB-100 (Fig. 4A, inset) but not apoB-48 (data not shown) plasma accumulation after tyloxapol injection in C57BL6/J mice overexpressing PCSK9 versus controls. In addition, the postheparin plasma lipolytic activity was similar in Ad-Null- and Ad-PCSK9-infused animals (206 ± 59 vs. 184 ± 38 nmol FFA/ml/h, respectively; P > 0.8).Fig. 4A: VLDL-triglyceride (TG) production in C57BL6/J mice (n = 5 per group) infused with Ad-Null (open squares) or Ad-PCSK9 (closed squares) after transient inhibition of plasma lipases by tyloxapol injection. In
We have reported further heterogeneity in familial autosomal-dominant hypercholesterolemia (FH) related to mutation in proprotein convertase subtilisin/kexin type 9 (PCSK9) gene previously named neural apoptosis regulated convertase 1 (Narc-1). Our aim was to define the metabolic bases of this new form of hypercholesterolemia.In vivo kinetics of apolipoprotein B100-containing lipoproteins using a 14-hour primed constant infusion of [2H3] leucine was conducted in 2 subjects carrying the mutation S127R in PCSK9, controls subjects, and FH subjects with known mutations on the low-density lipoprotein (LDL) receptor gene (LDL-R). Apo B100 production, catabolism, and transfer rates were estimated from very LDL (VLDL), intermediate-density lipoprotein (IDL), and LDL tracer enrichments by compartmental analysis. PCSK9 mutation dramatically increased the production rate of apolipoprotein B100 (3-fold) compared with controls or LDL-R mutated subjects, related to direct overproduction of VLDL (3-fold), IDL (3-fold), and LDL (5-fold). The 2 subjects also showed a decrease in VLDL and IDL conversion (10% to 30% of the controls). LDL fractional catabolic rate was slightly decreased (by 30%) compared with controls but still higher than LDL-R-mutated subjects.These results showed that the effect of the S127R mutation of PCSK9 on plasma cholesterol homeostasis is mainly related to an overproduction of apolipoprotein B100.
Objective. Pro-protein convertase subtilisin/kexin type 9 (PCSK9) is a circulating protein that impairs LDL clearance by promoting the LDL receptor (LDLR) degradation. Plasma lipid parameters (LDL-C and HDL-C) are related to severity of illness and survival in intensive care patients. Here, we aimed to determine whether circulating PCSK9 concentrations were correlated to the severity of illness in patients with multiple trauma. Methods/Results. Plasma PCSK9 were measured, at day 0 and 8 after admission, by ELISA in 111 patients hospitalized in ICU for severe trauma. Patients were included in the HIPOLYTE study and were randomly assigned to hydrocortisone therapy or placebo. Plasma PCSK9 levels were significantly increased by 161% at day 8 compared to day 0 (481 ± 227 vs 231 ± 117 ng/ml, P=0.0001). Hydrocortisone therapy did not alter PCSK9 concentrations at day 8 compared to placebo (451 ± 216 vs 511 ± 239ng/ml, P=0.33). In the whole population of the study, PCSK9 was positively associated with LDL-C (Pearson coefficient : 0.26, p=0.007) at day 0, but not with markers of severity illness. At day 8, an inverse correlation was found between PCSK9 and HDL-C (β =-653 ; P=0.004). Interestingly, PCSK9 concentrations at day 8 were related to markers of severity illness as injury severity score (β =6.17 ; P=0.0007), length of stay in ICU (β =6.14 ; P=0.0001), duration of both mechanical ventilation (β =8.26 ; P=0.0001) and cathecolamines infusion (β =18.57; P=0.015). Conclusion. PCSK9 appears as a late biomarker of severity illness in patients hospitalized for multiple trauma in ICU. These results open new perspectives for a role of PCSK9 in critical illness.
