Previous studies of macroscopic conditions detected in slaughter pigs at abattoir through voluntary pig health schemes have shown that some lesions have strong seasonal effects. This led us to investigate if weather and other climatic conditions are associated with increases or decreases in the prevalence of the conditions.
We have isolated a murine cDNA encoding a 9-kD protein, Chisel (Csl), in a screen for transcriptional targets of the cardiac homeodomain factor Nkx2-5. Csl transcripts were detected in atria and ventricles of the heart and in all skeletal muscles and smooth muscles of the stomach and pulmonary veins. Csl protein was distributed throughout the cytoplasm in fetal muscles, although costameric and M-line localization to the muscle cytoskeleton became obvious after further maturation. Targeted disruption of Csl showed no overt muscle phenotype. However, ectopic expression in C2C12 myoblasts induced formation of lamellipodia in which Csl protein became tethered to membrane ruffles. Migration of these cells was retarded in a monolayer wound repair assay. Csl-expressing myoblasts differentiated and fused normally, although in the presence of insulin-like growth factor (IGF)-1 they showed dramatically enhanced fusion, leading to formation of large dysmorphogenic “myosacs.” The activities of transcription factors nuclear factor of activated T cells (NFAT) and myocyte enhancer–binding factor (MEF)2, were also enhanced in an IGF-1 signaling–dependent manner. The dynamic cytoskeletal localization of Csl and its dominant effects on cell shape and behavior and transcription factor activity suggest that Csl plays a role in the regulatory network through which muscle cells coordinate their structural and functional states during growth, adaptation, and repair.
Collection of abattoir data related to public health is common worldwide. Standardised on-going programmes that collect information from abattoirs that inform producers about the presence and frequency of disease that are important to them rather than public health hazards are less common. The three voluntary pig health schemes, implemented in the United Kingdom, are integrated systems which capture information on different macroscopic disease conditions detected in slaughtered pigs. Many of these conditions have been associated with a reduction in performance traits and consequent increases in production costs. The schemes are the Wholesome Pigs Scotland in Scotland, the British Pig Health Scheme in England and Wales and the Pig Regen Ltd. health and welfare checks in Northern Ireland. In this study, four post mortem conditions (pericarditis, milk spots, papular dermatitis and tail damage) were surveyed and analysed over a ten and half year period, with the aim to compare the prevalence, monthly variations, and yearly trends between schemes. Liver milk spot was the most frequently recorded condition while tail damage was the least frequently observed condition. The prevalence of papular dermatitis was relatively low compared to liver milk spot and pericarditis in the three schemes. A general decreasing trend was observed for milk spots and papular dermatitis for all three schemes. The prevalence of pericarditis increased in Northern Ireland and England and Wales; while Scotland in recent years showed a decreasing trend. An increasing trend of tail damage was depicted in Scotland and Northern Ireland until 2013/2014 followed by a decline in recent years compared to that of England and Wales with a decreasing trend over the full study period. Monthly effects were more evident for milk spots and papular dermatitis. Similarity of the modus operandi of the schemes made the comparison of temporal variations and patterns in gross pathology between countries possible over time, especially between countries with similar pig production profile. This study of temporal patterns enables early detection of prevalence increases and alerts industry and researchers to investigate the reasons behind such changes. These schemes are, therefore, valuable assets for endemic disease surveillance, early warning for emerging disease and also for monitoring of welfare outcomes.
Bistability in developmental pathways refers to the generation of binary outputs from graded or noisy inputs. Signaling thresholds are critical for bistability. Specification of the left/right (LR) axis in vertebrate embryos involves bistable expression of transforming growth factor β (TGFβ) member NODAL in the left lateral plate mesoderm (LPM) controlled by feed-forward and feedback loops. Here we provide evidence that bone morphogenetic protein (BMP)/SMAD1 signaling sets a repressive threshold in the LPM essential for the integrity of LR signaling. Conditional deletion of Smad1 in the LPM led to precocious and bilateral pathway activation. NODAL expression from both the left and right sides of the node contributed to bilateral activation, indicating sensitivity of mutant LPM to noisy input from the LR system. In vitro, BMP signaling inhibited NODAL pathway activation and formation of its downstream SMAD2/4–FOXH1 transcriptional complex. Activity was restored by overexpression of SMAD4 and in embryos, elevated SMAD4 in the right LPM robustly activated LR gene expression, an effect reversed by superactivated BMP signaling. We conclude that BMP/SMAD1 signaling sets a bilateral, repressive threshold for NODAL-dependent Nodal activation in LPM, limiting availability of SMAD4. This repressive threshold is essential for bistable output of the LR system.
CITED1 is the founding member of the CITED family of cofactors that are involved in regulating a wide variety of CBP/p300-dependent transcriptional responses. In the present study, we show that the phosphorylation status of CITED1 changes during the cell cycle and affects its transcriptional cofactor activity. Tryptic mapping and mutagenesis studies identified five phosphorylated serine residues in CITED1. Phosphorylation of these residues did not affect CRM1-dependent nuclear export, but did decrease CITED1 binding to p300 and inhibited CITED1-dependent transactivation of Smad4 and p300. These results suggest that CITED1 functions as a cell cycle-dependent transcriptional cofactor whose activity is regulated by phosphorylation. CITED1 is the founding member of the CITED family of cofactors that are involved in regulating a wide variety of CBP/p300-dependent transcriptional responses. In the present study, we show that the phosphorylation status of CITED1 changes during the cell cycle and affects its transcriptional cofactor activity. Tryptic mapping and mutagenesis studies identified five phosphorylated serine residues in CITED1. Phosphorylation of these residues did not affect CRM1-dependent nuclear export, but did decrease CITED1 binding to p300 and inhibited CITED1-dependent transactivation of Smad4 and p300. These results suggest that CITED1 functions as a cell cycle-dependent transcriptional cofactor whose activity is regulated by phosphorylation. The CITED family of transcriptional cofactors consists of four members (CITED1-4, CITED1, -2, and -4 in mammals) that regulate diverse CBP/p300-dependent transcriptional responses (1Ng P.K. Wu R.S. Zhang Z.P. Mok H.O. Randall D.J. Kong R.Y. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 2003; 136: 163-172Crossref PubMed Scopus (7) Google Scholar, 2Andrews J.E. O'Neill M.J. Binder M. Shioda T. Sinclair A.H. Mech. Dev. 2000; 95: 305-308Crossref PubMed Scopus (15) Google Scholar, 3Gawantka V. Pollet N. Delius H. Vingron M. Pfister R. Nitsch R. Blumenstock C. Niehrs C. Mech. Dev. 1998; 77: 95-141Crossref PubMed Scopus (167) Google Scholar, 4Bhattacharya S. Michels C.L. Leung M.K. Arany Z.P. Kung A.L. Livingston D.M. Genes Dev. 1999; 13: 64-75Crossref PubMed Scopus (316) Google Scholar, 5Braganca J. Eloranta J.J. Bamforth S.D. Ibbitt J.C. Hurst H.C. Bhattacharya S. J. Biol. Chem. 2003; 278: 16021-16029Abstract Full Text Full Text PDF PubMed Scopus (126) Google Scholar, 6Braganca J. Swingler T. Marques F.I. Jones T. Eloranta J.J. Hurst H.C. Shioda T. Bhattacharya S. J. Biol. Chem. 2002; 277: 8559-8565Abstract Full Text Full Text PDF PubMed Scopus (83) Google Scholar, 7Yahata T. Takedatsu H. Dunwoodie S.L. Braganca J. Swingler T. Withington S.L. Hur J. Coser K.R. Isselbacher K.J. Bhattacharya S. Shioda T. Genomics. 2002; 80: 601-613Crossref PubMed Scopus (34) Google Scholar, 8Tien E.S. Davis J.W. Vanden Heuvel J.P. J. Biol. Chem. 2004; 279: 24053-24063Abstract Full Text Full Text PDF PubMed Scopus (94) Google Scholar, 9Fox S.B. Braganca J. Turley H. Campo L. Han C. Gatter K.C. Bhattacharya S. Harris A.L. Cancer Res. 2004; 64: 6075-6081Crossref PubMed Scopus (52) Google Scholar, 10Glenn D.J. Maurer R.A. J. Biol. Chem. 1999; 274: 36159-36167Abstract Full Text Full Text PDF PubMed Scopus (91) Google Scholar, 11Shioda T. Fenner M.H. Isselbacher K.J. Gene (Amst.). 1997; 204: 235-241Crossref PubMed Scopus (50) Google Scholar, 12Yahata T. de Caestecker M.P. Lechleider R.J. Andriole S. Roberts A.B. Isselbacher K.J. Shioda T. J. Biol. Chem. 2000; 275: 8825-8834Abstract Full Text Full Text PDF PubMed Scopus (105) Google Scholar, 13Yahata T. Shao W. Endoh H. Hur J. Coser K.R. Sun H. Ueda Y. Kato S. Isselbacher K.J. Brown M. Shioda T. Genes Dev. 2001; 15: 2598-2612Crossref PubMed Scopus (93) Google Scholar, 14Shioda T. Fenner M.H. Isselbacher K.J. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 12298-12303Crossref PubMed Scopus (80) Google Scholar). CITED1 is expressed in a variety of embryonic tissues including the heart, limb buds, hepatic primordia, and developing kidney (15Plisov S. Tsang M. Shi G. Boyle S. Yoshino K. Dunwoodie S.L. Dawid I.B. Shioda T. Perantoni A.O. de Caestecker M.P. J. Am. Soc. Nephrol. 2005; 16: 1632-1644Crossref PubMed Scopus (53) Google Scholar, 16Dunwoodie S.L. Rodriguez T.A. Beddington R.S. Mech. Dev. 1998; 72: 27-40Crossref PubMed Scopus (141) Google Scholar). In the adult, CITED1 is expressed at high levels in papillary carcinoma of the thyroid gland (17Prasad M.L. Pellegata N.S. Kloos R.T. Barbacioru C. Huang Y. de la Chapelle A. Thyroid. 2004; 14: 169-175Crossref PubMed Scopus (45) Google Scholar, 18Prasad M.L. Pellegata N.S. Huang Y. Nagaraja H.N. de la Chapelle A. Kloos R.T. Mod. Pathol. 2005; 18: 48-57Crossref PubMed Scopus (235) Google Scholar), malignant melanoma (19Li H. Ahmed N.U. Fenner M.H. Ueda M. Isselbacher K.J. Shioda T. Exp. Cell Res. 1998; 242: 478-486Crossref PubMed Scopus (25) Google Scholar, 20Sedghizadeh P.P. Williams J.D. Allen C.M. Prasad M.L. Med. Sci. Monit. 2005; 11: BR189-BR194PubMed Google Scholar), and Wilms tumor (21Lovvorn H. N. B.S. Shi G. Shyr Y. Perantoni A. de Caestecker M.P. J. Pediatric Surg. 2006; Google Scholar), suggesting that it may play a role in the pathogenesis of certain tumors. Studies using CITED1 knock-out mice indicate that its expression in the extra-embryonic trophectoderm plays an essential role in regulating normal placental development (22Rodriguez T.A. Sparrow D.B. Scott A.N. Withington S.L. Preis J.I. Michalicek J. Clements M. Tsang T.E. Shioda T. Beddington R.S. Dunwoodie S.L. Mol. Cell. Biol. 2004; 24: 228-244Crossref PubMed Scopus (67) Google Scholar), whereas expression in the mammary gland is required for growth and branching of mammary epithelium at puberty (23Howlin J. McBryan J. Napoletano S. Lambe T. McArdle E. Shioda T. Martin F. Oncogene. 2006; 25: 1532-1542Crossref PubMed Scopus (37) Google Scholar). Biochemical studies indicate that CITED1 selectively enhances transcriptional responses involving TGF-β 4The abbreviations used are: TGF-β, transforming growth factor β; FBS, fetal bovine serum; NES, nuclear export signal; HEK, human embryonic kidney; DMEM, Dulbecco's modified Eagle's medium; GFP, green fluorescent protein; CHAPS, 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonic acid; BisTris, 2-[bis(2-hydroxyethyl)amino]-2-(hydroxymethyl)propane-1,3-diol.4The abbreviations used are: TGF-β, transforming growth factor β; FBS, fetal bovine serum; NES, nuclear export signal; HEK, human embryonic kidney; DMEM, Dulbecco's modified Eagle's medium; GFP, green fluorescent protein; CHAPS, 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonic acid; BisTris, 2-[bis(2-hydroxyethyl)amino]-2-(hydroxymethyl)propane-1,3-diol./Smad4 and estrogen receptor-α, whereas it inhibits Wnt/β-catenin-dependent responses (12Yahata T. de Caestecker M.P. Lechleider R.J. Andriole S. Roberts A.B. Isselbacher K.J. Shioda T. J. Biol. Chem. 2000; 275: 8825-8834Abstract Full Text Full Text PDF PubMed Scopus (105) Google Scholar, 13Yahata T. Shao W. Endoh H. Hur J. Coser K.R. Sun H. Ueda Y. Kato S. Isselbacher K.J. Brown M. Shioda T. Genes Dev. 2001; 15: 2598-2612Crossref PubMed Scopus (93) Google Scholar, 15Plisov S. Tsang M. Shi G. Boyle S. Yoshino K. Dunwoodie S.L. Dawid I.B. Shioda T. Perantoni A.O. de Caestecker M.P. J. Am. Soc. Nephrol. 2005; 16: 1632-1644Crossref PubMed Scopus (53) Google Scholar). These effects are dependent on interactions between CITED1 and CBP/p300, but the molecular mechanisms regulating CITED1-dependent transactivation have not been elucidated. In these studies we show that CITED1 exists in both an unphosphorylated and at least two phosphorylated forms, and that levels of both phosphoproteins are independently regulated over the course of the cell cycle. Mapping and functional evaluation of the dominant phosphorylated form of CITED1 found in interphase cells indicates that phosphorylation reduces CITED1-dependent transactivation of Smad4 and p300. This occurs without affecting the normal process of CRM1-dependent nuclear export, but is associated with decreased binding of CITED1 to p300. These findings indicate that the transcriptional activity of CITED1 is regulated by phosphorylation in a cell cycle-dependent manner. Cell Lines and Cell Cycle Synchronization—Human embryonic kidney (HEK) 293, human breast cancer MCF7, and the HepG2 hepatocellular carcinoma cells were obtained from the American Type Culture Collection, and B16-F1 murine melanoma cells were obtained from Isaiah Fidler (24Fidler I.J. Nat. New Biol. 1973; 242: 148-149Crossref PubMed Scopus (1265) Google Scholar). NPA187 human papillary thyroid carcinoma cells were obtained from Guy Juillard, UCLA (25Younes M.N. Kim S. Yigitbasi O.G. Mandal M. Jasser S.A. Dakak Yazici Y. Schiff B.A. El-Naggar A. Bekele B.N. Mills G.B. Myers J.N. Mol. Cancer Ther. 2005; 4: 1146-1156Crossref PubMed Scopus (73) Google Scholar). All cell lines were cultured at 37 °C and 5% CO2 in DMEM supplemented with 10% fetal bovine serum (FBS). HEK-293 cells were grown on plasticware coated with type 1 collagen (Rat tail, BD Biosciences) to increase adherence. Stable overexpression of FLAG-tagged CITED1 and the CITED1 S5A and S5E mutants in pcDNA3 (Invitrogen) or pEGFP-CITED1 (Clontech) was produced by transfection of the respective expression plasmids into HEK-293 and selection with 400 μg/ml G418. These are referred to as HEK-CITED1 or HEK-GFP CITED1 cells, respectively. For cell cycle studies, cells were synchronized in G0 by culturing for 48 h in serumfree medium (DMEM with 0.1% bovine serum albumin) (>70% G0/G1) and S-phase by double thymidine block (>70% cells in S). After release from thymidine, block cells were blocked in M-phase by treatment with 100 nm nocodazole (Sigma) overnight (>90% G2/M-phase), as described (26Harper J.V. Methods Mol. Biol. 2005; 296: 157-166PubMed Google Scholar). Efficiency of cell cycle block was evaluated in preliminary studies by flow cytometry using propidium iodide staining, as described (27Robinson J.P. Current Protocols in Cytometry. John Wiley & Sons, New York1997: 7.5.1Google Scholar). For M-phase release, loosely adherent mitotic cells were collected after gently tapping the plate, washed three times in phosphate-buffered saline and released from M-phase in DMEM with 10% FBS for various times, as indicated. The protein phosphatase inhibitor, okadaic acid (Calbiochem), was added to the cells at 10 nm concentration for the last 2 h after overnight treatment with nocodazole. Expression Plasmids and Transcriptional Response Assays—Amino-terminal FLAG-tagged human CITED1 in pcDNA3 and the Gal4 DNA binding Smad4-(266-552) fusion protein in pSG424 were generated in our laboratory (15Plisov S. Tsang M. Shi G. Boyle S. Yoshino K. Dunwoodie S.L. Dawid I.B. Shioda T. Perantoni A.O. de Caestecker M.P. J. Am. Soc. Nephrol. 2005; 16: 1632-1644Crossref PubMed Scopus (53) Google Scholar, 28de Caestecker M.P. Yahata T. Wang D. Parks W.T. Huang S. Hill C.S. Shioda T. Roberts A.B. Lechleider R.J. J. Biol. Chem. 2000; 275: 2115-2122Abstract Full Text Full Text PDF PubMed Scopus (143) Google Scholar); the p5E1B-Luc Gal4 reporter construct was provided by Jeff Wrana (29Hayashi H. Abdollah S. Qiu Y. Cai J. Xu Y.Y. Grinnell B.W. Richardson M.A. Topper J.N. Gimbrone M.A. Wrana J.L. Falb D. Cell. 1997; 89: 1165-1173Abstract Full Text Full Text PDF PubMed Scopus (1145) Google Scholar), and the full-length Gal4-p300 fusion protein construct obtained from Neil Perkins (30Snowden A.W. Anderson L.A. Webster G.A. Perkins N.D. Mol. Cell. Biol. 2000; 20: 2676-2686Crossref PubMed Scopus (112) Google Scholar). Serine to alanine (Ser → Ala) or glutamic acid (Ser → Glu) mutations at residues 16, 63, 67, 71, and 137 were generated sequentially using a PCR-based site-directed mutagenesis kit (Stratagene) on the FLAG-tagged human CITED1 expression plasmid, using primer sets shown in Table 1. Sequence changes were confirmed by dideoxynucleotide sequencing. Transient transfection assays were performed on HEK-293 cells using Lipofectamine (Invitrogen), with transfection efficiency evaluated by cotransfecting with constitutively expressed pSVβ-galactosidase vector and subsequent enzyme activity assay. Transcriptional response assays were performed by cotransfecting the p5E1B-Luc Gal4 reporter construct with the Gal4 Smad4 or p300 fusion proteins, along with the FLAG-tagged CITED1 expression constructs, as previously described (15Plisov S. Tsang M. Shi G. Boyle S. Yoshino K. Dunwoodie S.L. Dawid I.B. Shioda T. Perantoni A.O. de Caestecker M.P. J. Am. Soc. Nephrol. 2005; 16: 1632-1644Crossref PubMed Scopus (53) Google Scholar, 28de Caestecker M.P. Yahata T. Wang D. Parks W.T. Huang S. Hill C.S. Shioda T. Roberts A.B. Lechleider R.J. J. Biol. Chem. 2000; 275: 2115-2122Abstract Full Text Full Text PDF PubMed Scopus (143) Google Scholar). Cells were washed after 4 - 6 h, allowed to recover for 24 h in growth medium, serum-starved, and treated for 18 h with or without 10 ng/ml TGF-β1 (R&D Systems). Luciferase and β-galactosidase activities in the cell lysates were determined, and luciferase activities were normalized for β-galactosidase expression to correct for transfection efficiency, as described (31de Caestecker M.P. Hemmati P. Larisch-Bloch S. Ajmera R. Roberts A.B. Lechleider R.J. J. Biol. Chem. 1997; 272: 13690-13696Abstract Full Text Full Text PDF PubMed Scopus (130) Google Scholar). All assays were performed in triplicate and values represented as mean ± S.E. of three independent transfections. Experiments were repeated twice with similar results. Expression of FLAG-tagged CITED1 mutants in the same cell lysates was determined by Western blot using M2 anti-FLAG monoclonal antibody (Sigma).TABLE 1Primers used for site-directed mutagenesis of CITED1CITED1 mutationForwardReverseS16AGTCAAGGGTGGCACCGCACCTGCGAAGGAGCTCCTTCGCAGGTGCGGTGCCACCCTTGACS16ECAAGGGTGGCACCGAACCTGCGAAGCTTCGCAGGTTCGGTGCCACCCTTGS63AGTGGGGCTCCCACTGCTTCCTCGGGATCTAGATCCCGAGGAAGCAGTGGGAGCCCCACS63EGTGGGGCTCCCACTGAATCCTCGGGATCTAGATCCCGAGGATTCAGTGGGAGCCCCACS67ACTAGTTCCTCGGGAGCTCCAATAGGCTCTCGAGAGCCTATTGGAGCTCCCGAGGAACTAGS67EGTTCCTCGGGAGAACCAATAGGCTCTCGAGAGCCTATTGGTTCTCCCGAGGAACS71ACCAATAGGCTCTCCTACAACCACCGGTGGTTGTAGGAGAGCCTATTGGS71ECCAATAGGCGAACCTACAACCGGTTGTAGGTTCGCCTATTGGS137AGCAGAATCACTCGCTCCTTCTGCTGGTGCACCAGCAGAAGGAGCGAGTGATTCTGCS137EGCAGAATCACTCGAACCTTCTGCTGGTCACCAGCAGAAGGTTCGAGTGATTCTG Open table in a new tab Western Blot and Two-dimensional Gel Electrophoresis—Western blots were performed after separating lysates and/or immunoprecipitated proteins by SDS-PAGE and transfer to polyvinylidene difluoride membranes using anti-CITED1 mouse monoclonal antibody clone 2H6 (15Plisov S. Tsang M. Shi G. Boyle S. Yoshino K. Dunwoodie S.L. Dawid I.B. Shioda T. Perantoni A.O. de Caestecker M.P. J. Am. Soc. Nephrol. 2005; 16: 1632-1644Crossref PubMed Scopus (53) Google Scholar), mouse anti-p300 (Upstate, clone RW128), or mouse anti-β-actin (Sigma, clone AC74), as indicated. For two-dimensional gel electrophoresis, HEK-CITED1 immunoprecipitates were treated with or without alkaline phosphatase (as outlined below), and resuspended in 8 m urea buffer (8 m urea, 1% CHAPS, 20 mm dithiothreitol) with 0.5% ampholytes (Bio-Rad, Ready Strip buffer pH 3.9 - 5.1). These were separated in the first dimension by isoelectric focusing using a non-linear, immobilized pH gradient strip gel, pH range 3.0-5.6 (Amersham Biosciences), using the Invitrogen ZOOM immobilized pH gradient runner system at 100 V for 30 min. For the second dimension, focused immobilized pH gradient strips were equilibrated in NuPAGE lithium dodecyl sulfate sample buffer (Invitrogen Corp.) in the presence of NuPAGE sample reducing agent (Invitrogen Corp.) for 15 min, and further incubated in lithium dodecyl sulfate sample buffer in the presence of 125 mm iodoacetamide for 15 min. The strips were placed on 12% BisTris gels and embedded in 0.5% agarose, and after separation transferred to polyvinylidene difluoride membranes for Western blot. Subcellular Fractionation—Subcellular fractionation was performed by differential centrifugation of asynchronous MCF7 and HEK-CITED1 cells following homogenization in hypotonic media, as previously described (32Graham J.M. Scientific World J. 2002; 2: 1638-1642Crossref Scopus (33) Google Scholar). Nuclear fractions were separated after centrifugation at 1,000 × g for 10 min, whereas membrane and free cytosolic fractions were separated after centrifugation at 100,000 × g for 45 min. Fractions were separated by SDS-PAGE and CITED1 detected by Western blot using mouse anti-CITED1 monoclonal antibody (2H6). Equal protein loading of each fraction was estimated by Bradford assay. Metabolic Labeling—For metabolic labeling studies, MCF7 and HEK-CITED1 cells were incubated in phosphate-free DMEM with 10% dialyzed FBS for 30 min before labeling with 0.5 mCi/ml [32P]orthophosphate for 4 h. After extensive washing, cells were lysed in Trion X-100 lysis buffer (1% Triton X-100, 150 mm NaCl, 25 mm HEPES, 5 mm EDTA, and 10% glycerol) along with 50 mg/ml of the protease inhibitor 4-(2-aminoethyl)benzenesulfonyl fluoride (Sigma), and the phosphatase inhibitors 50 mm sodium fluoride and 1 μm sodium orthovanadate. Lysates were then clarified and pre-cleared with protein A/G-agarose beads (Santa Cruz Biotechnology). Immunoprecipitation was performed for 4 h on ice using an affinity purified rabbit anti-CITED1 antibody raised against a unique COOH-terminal peptide sequence (J) (15Plisov S. Tsang M. Shi G. Boyle S. Yoshino K. Dunwoodie S.L. Dawid I.B. Shioda T. Perantoni A.O. de Caestecker M.P. J. Am. Soc. Nephrol. 2005; 16: 1632-1644Crossref PubMed Scopus (53) Google Scholar). After addition of protein A/G-agarose beads, the immunoprecipitates were extensively washed in ice-cold Triton X-100 lysis buffer, separated by SDS-PAGE, and transferred to polyvinylidene difluoride membranes for autoradiography. Phosphoamino Acid Analysis—Phosphoamino acid analysis of the HEK-FLAG CITED1 immunoprecipitates was performed on the 32P-labeled M-phase CITED1 bands detected by autoradiography, as previously described (33Boyle W.J. van der Geer P. Hunter T. Methods Enzymol. 1991; 201: 110-149Crossref PubMed Scopus (1272) Google Scholar). For phosphoamino acid analysis, the cut polyvinylidene difluoride membrane was incubated with 6 m HCl at 110 °C for 1 h, the supernatant removed, vacuum dried, and resuspended in pH 1.9 buffer (2.2% formic acid with 7.8% glacial acetic acid) along with phosphoserine, phosphothreonine, and phosphotyrosine standards (Sigma) at 1 mg/ml. After spotting on to TLC plates, amino acids were separated using a Hunter thin layer electrophoresis system in pH 1.9 buffer in the first dimension, followed by pH 3.5 buffer (10% glacial acetic acid, 1% pyridine, and 1 mm EDTA) in the second dimension. The phosphoamino acid standards were visualized by spraying with 0.25% ninhydrin in acetone, and 32P-labeled amino acids were visualized by autoradiography of the TLC plate. Tryptic Mapping—Tryptic mapping was performed on the excised 32P-labeled S-phase and M-phase CITED1 bands detected by autoradiography, as previously described (33Boyle W.J. van der Geer P. Hunter T. Methods Enzymol. 1991; 201: 110-149Crossref PubMed Scopus (1272) Google Scholar). These were incubated with methanol, and then blocked with 50 mm NH4HCO3 containing 0.1% Tween 20 for 30 min at room temperature. Phosphoproteins were digested twice with 10 μl of 1 mg/ml l-1-tosylamido-2-phenylethyl chloromethyl ketone trypsin (Promega) in 100 μl of NH4HCO3 at 37 °C overnight, and oxidized with performic acid. Released peptides were first separated by electrophoresis on TLC plates at pH 1.9, using the Hunter thin-layer electrophoresis system (model HTLE-7000), at 1000 V for 45 min. Separation in the second dimension was performed by ascending chromatography in n-butyl alcohol (37.5%), pyridine (25%), and acetic acid (7.5%). Resolved phosphopeptides were visualized by autoradiography using Bio-Max MS high speed film (Eastman Kodak Co.). Immunofluorescence Studies—E15.5 mouse kidneys were fixed for 4 h in 4% paraformaldehyde, embedded, and sectioned. After blocking in 10% goat serum, sections were incubated overnight at 4 °C with mouse monoclonal anti-E-cadherin (BD Biosciences, clone 32) and rabbit polyclonal anti-CITED1 (Neomarkers). These were detected using fluorescein-conjugated horse antimouse (Vector Labs) and rhodamine-conjugated goat anti-rabbit antibodies (Jackson ImmunoResearch), and visualized using a Nikon Eclipse epifluorescence microscope. For immunofluorescence staining of cultured cells, HEK-293 and HEK-CITED1 cells were plated onto glass chamber slides coated with type I collagen (Rat Tail, BD Biosciences), fixed in 3% paraformaldehyde in phosphate-buffered saline with 2% sucrose, and permeabilized with 0.2% Triton X, as described (34Eid J.E. Kung A.L. Scully R. Livingston D.M. Cell. 2000; 102: 839-848Abstract Full Text Full Text PDF PubMed Scopus (83) Google Scholar). After blocking, chambers were incubated overnight at 4 °C with rabbit anti-CITED1 (Neomarkers) or FLAG M2 monoclonal antibodies (Sigma), and detected using fluorescein isothiocyanate-conjugated anti-rabbit or mouse antibodies (Jackson ImmunoResearch), respectively. Nuclear structures were visualized using the far red nuclear stain TO-PRO-3 (Molecular Probes). For subcellular localization studies in live cells, GFP-tagged CITED1 constructs were either transiently transfected into C2C12 cells or stably transfected into HEK-293 cells, and live cells were visualized using an inverted confocal microscope using the appropriate filter sets. Images were acquired before and 30 min after treatment with 1 ng/ml leptomycin B (Sigma), to inhibit CRM-dependent nuclear export. CITED1 Is Phosphorylated in a Cell Cycle-dependent Manner—We evaluated endogenous CITED1 expression in three cell lines. CITED1 appears as a doublet in B16 melanoma and MCF7 breast carcinoma cells synchronized in S-phase. There was a further shift in mobility in these cells and in NPA187 papillary thyroid carcinoma cells synchronized in M-phase (Fig. 1A, lanes 1 and 2). This mobility shift was further enhanced by incubating M-phase cells with okadaic acid (Fig. 1A, lane 3). This suggests that M-phase phosphorylation of CITED1 is regulated either directly or indirectly by an okadaic acid-sensitive protein phosphatase. To determine whether these changes in mobility resulted from protein phosphorylation, M-phase CITED1 immunoprecipitates were dephosphorylated by incubation with alkaline phosphatase. This treatment completely reversed the M-phase mobility shift, resulting in a single CITED1 band (Fig. 1A, lane 4). We compared changes in CITED1 mobility in S-phase and M-phase synchronized HEK-293 cells (which express low levels of endogenous CITED1 (15Plisov S. Tsang M. Shi G. Boyle S. Yoshino K. Dunwoodie S.L. Dawid I.B. Shioda T. Perantoni A.O. de Caestecker M.P. J. Am. Soc. Nephrol. 2005; 16: 1632-1644Crossref PubMed Scopus (53) Google Scholar)) stably overexpressing FLAG-tagged CITED1 (HEK-CITED1 cells). In these cells, CITED1 clearly migrated as a doublet in S-phase synchronized cells, and underwent a further shift in mobility in M-phase cells (Fig. 1B). This effect was further accentuated by incubating the cells with okadaic acid prior to lysis. An identical pattern of CITED1 mobility was seen in cells arrested in M-phase using Taxol (data not shown). As in the previous studies, incubation of the immunoprecipitates with alkaline phosphatase reversed the M-phase mobility shift, resulting in a single CITED1 band (Fig. 1B). The S-phase doublet also disappeared with λ-phosphatase treatment (see Fig. 4C). Separation of CITED1 by two-dimensional gel electrophoresis (isoelectric focusing and SDS-PAGE) confirmed the presence of two CITED1 phosphoproteins in S-phase- and M-phase-synchronized cells that were sensitive to alkaline phosphatase treatment (Fig. 1C). Throughout the rest of the article we will refer to the intermediate mobility phosphorylated form of CITED1 as "pCITED1," and the upper, hyperphosphorylated band seen in mitotic cells as "ppCITED1" (Fig. 1, B and C, arrows). To evaluate the regulation of these CITED1 phosphoproteins during progression of the cell cycle, HEK-CITED1 cells were synchronized in S-phase (>70% S-phase), G0 (>70% G0/G1), or M-phase (>90% G2/M), and released in medium containing 10% serum for various time periods. Whereas the level of pCITED1 was only slightly increased after release from thymidine block, the relative level of pCITED1 was reduced after prolonged serum starvation and strongly up-regulated after release in 10% serum for 8 h (Fig. 2A). In contrast, cells released from M-phase showed no change in the relative level of pCITED1, but there was a rapid reduction in levels of ppCITED1 following release (Fig. 2B). Taken together, these findings indicate that CITED1 exists in both unphosphorylated and at least two phosphorylated forms, and that levels of these phosphoproteins are dynamically regulated over the course of the cell cycle. Mapping CITED1 Phosphorylation Sites—Having established that CITED1 phosphorylation is regulated in a cell cycle-dependent manner, we sought to map the phosphorylation sites. [32P]Orthophosphate labeling of MCF7 and HEK-CITED1 cells confirmed that CITED1 was phosphorylated both in S- and M-phase-arrested cells (Fig. 3A). Phosphoamino acid analysis of the CITED1 band from mitotic HEK-CITED1 cells only detected phosphoserine residues (Fig. 3B). To characterize these phosphorylation sites further, we performed tryptic mapping of the [32P]orthophosphate-labeled CITED1 bands from S-phase- and M-phase-synchronized HEK-CITED1 cells. Separation of the tryptic peptides by electrophoresis and chromatography identified three dominant 32P-labeled CITED1 peptides in S-phase cells (Fig. 3C, spots 1-3). The same peptides appeared in M-phase cell preparations (confirmed when S-phase and M-phase digests were mixed), although one of the spots (spot 2) showed increased mobility along the x axis in M-phase (migrating toward the positive electrode). In addition, a single negatively charged, hydrophobic phosphopeptide appeared in mitotic cells, which was not seen in S-phase preparations (spot 4). These data confirm that CITED1 exists in two phosphorylated forms: a phosphorylated form found in S- and M-phase cells containing three phosphorylated tryptic peptides, and a hyperphosphorylated form that is only found in M-phase cells containing an additional phosphorylated tryptic peptide. CITED1 contains a number of potential serine phosphorylation sites. Six of these residues are conserved in human, mouse, and rat CITED1 sequences (Ser-16, Ser-63, Ser-67, Ser-71, Ser-137, and Ser-139), and five of these have predicted phosphorylation site scores of greater than 90% (Ser-16, Ser-63, Ser-67, Ser-71, and Ser-137) (NetPhos 2.0). We therefore explored the effects of individual and combinatorial mutations of these five serine residues on CITED1 mobility by Western blot. Whereas most of these mutations either individually or in combination gave rise to two M-phase bands (as opposed to the three seen with wild type CITED1), only the combination of mutations at residues Ser-16, Ser-63, Ser-67, Ser-71, and Ser-137 showed no change in mobility with mitosis (Fig. 4A shows a representative selection of combinatorial mutations that were studied). We will refer to this combined mutant construct as CITED1 S5A for the remainder of the text. Introduction of glutamic acid residues at these sites to generate the phosphomimetic mutant, CITED1 S5E, gave rise to a single, low mobility band (Fig. 4B). λ-Phosphatase treatment of anti-FLAG immunoprecipitates from these cells had no significant effect on mobility of the dominant CITED1 S5A and S5E bands in S- or M-phase synchronized cells when compared with wild type CITED1 (Fig. 4C). There was, however, a low mobility band seen with both of the CITED1 mutations in M-phase cells that was lost following λ-phosphatase treatment (Fig. 4C, arrow). Whereas this was only seen in concentrated immunoprecipitates from M-phase-synchronized cells (compare lysates in Fig. 4, A and B), it indicates that there is a minor M-phase CITED1 phosphorylation site that is not blocked by the CITED1 S5A and S5E mutations. To define the precise effects of mutating these five serine residues on S- and M-phase phosphorylation, we evaluated phosphotryptic maps of [32P]orthophosphate-labeled CITED1 bands from HEK-293 cells overexpressing CITED1 S5A. These studies showed that the S5A mutation prevented phosphorylation of the three dominant 32P-labeled CITED1 peptides seen in S- and M-phase cells (Fig. 5A, spots 1-3). This is consistent with the predicted tryptic fragment map of CITED1 indicating that the five phosphorylated serine residues are dispersed across three separate predicted tryptic fragments (Fig. 5B, red dotted lines and arrows). However, these studies also demonstrated that there were two additional M-phase tryptic phosphopeptides in the CITED1 S5A preparations (Fig. 5A, spots A and B). Mixing M-phase digests from wild type CITED1 and the S5A mutation suggests that one of the peptides (spot A) corresponds to the negatively charged M-phase phosphopeptide identified in the previous CITED1 tryptic map (Fig. 3C, spot 4). The additional phosphopeptide (spot B) did not overlay with any of the wild type CITED1 phosphopeptides, and is likely to represent an artificial M-phase phosphorylation site that only occurs when the five serine residues are mutated. These findings indicate that CITED1 S5A blocks the common S- and M-phase phosphorylation sites in CITED1, but does not prevent the additional M-phase phosphorylation event. Subcellular Localization of C
Abstract Funding Acknowledgements Type of funding sources: Foundation. Main funding source(s): Wellcome Trust; British Heart Foundation Background/Introduction Alpha-actinin is an integral protein of the Z-discs in heart and skeletal muscle cells, with important structural and signalling functions. Missense variants in alpha-actinin can cause inherited conditions, e.g. myopathies and cardiomyopathies. The underlying disease mechanisms are still unknown. Purpose In order to study the disease mechanisms of an alpha-actinin missense variant, which is known to cause Hypertrophic Cardiomyopathy in human patients, a mouse model was generated. Methods Mice carrying the alpha-actinin missense variant were generated by CRISPR-Cas9 genome editing. The heterozygous adult mice carrying the alpha-actinin variant were characterised by echocardiography and quantitative PCR. Hearts of homozygous embryos were analysed at E15.5 by high-resolution episcopic microscopy (HREM). Results Mice carrying a single copy of the missense variant were viable and had normal appearance. Adult heterozygous mice showed no signs of cardiomyopathy on echocardiography. However, mature male mice displayed molecular signs of cardiomyopathy, such as induction of the fetal gene programme at transcript level. The attempt to generate adult mice homozygous for the variant failed: 9 breeding pairs produced 18 litters with 83 weaned pups, but no homozygous offspring. Embryonic lethality was confirmed and E15.5 was the latest stage homozygous pups were reliably found to be viable. At this timepoint, genotype distribution was within the expected Mendelian ratios. HREM of the hearts at this stage revealed increased right ventricular chamber size and decreased left atrial size, when compared to wildtype littermates. Membranous ventricular septal defects were observed in 3 out of 8 homozygous hearts. Further these embryos displayed aortic stenosis and dysplasic leaflets of the pulmonary valve. Conclusions Heterozygous adult mice only displayed sub-clinical signs of disease. In contrast, the missense variant is embryonic lethal in the homozygous setting and leads to a range of morphological abnormalities in E15.5 hearts. Future work will identify how altered functions of alpha-actinin cause these changes.
The placental vasculature provides the developing embryo with a circulation to deliver nutrients and dispose of waste products. However, in the mouse, the vascular components of the chorio-allantoic placenta have been largely unexplored due to a lack of well-validated molecular markers. This is required to study how these blood vessels form in development and how they are impacted by embryonic or maternal defects. Here, we employed marker analysis to characterize the arterial/arteriole and venous/venule endothelial cells (ECs) during normal mouse placental development. We reveal that placental ECs are potentially unique compared with their embryonic counterparts. We assessed embryonic markers of arterial ECs, venous ECs, and their capillary counterparts—arteriole and venule ECs. Major findings were that the arterial tree exclusively expressed Dll4 , and venous vascular tree could be distinguished from the arterial tree by Endomucin (EMCN) expression levels. The relationship between the placenta and developing heart is particularly interesting. These two organs form at the same stages of embryogenesis and are well known to affect each other’s growth trajectories. However, although there are many mouse models of heart defects, these are not routinely assessed for placental defects. Using these new placental vascular markers, we reveal that mouse embryos from one model of heart defects, caused by maternal iron deficiency, also have defects in the formation of the placental arterial, but not the venous, vascular tree. Defects to the embryonic cardiovascular system can therefore have a significant impact on blood flow delivery and expansion of the placental arterial tree.
Cited1 and Cited2 interact with CBP and p300. CBP/p300 bind numerous proteins and evidence exists, for Cited2 at least, that Cited binding prevents the binding of other proteins to CBP/p300. Since CBP/p300 interact with many proteins, can acetylate protein and DNA, and act as a ubiquitin ligase, it is likely that Cited1 and Cited2 function at a number of sites during development. We have generated mice that carry a null mutant allele for each of these genes. Analysis of null mutant embryos demonstrates that both Cited1 and Cited2 are required for normal embryonic development and survival. Although both Cited1 and Cited2 are expressed in the developing embryo and placenta, it appears that abnormal placental development and function is the cause of embryonic death. The defect that develops in the placentas of Cited1 null mutants is not apparent until late in gestation (16.5dpc). Cited1 null mutants are smaller than controls at birth and die during the early postnatal period. The placentas of these mutants are disorganised, with spongiotrophoblasts projecting in to the labyrinthine layer. In addition, resin casts of the maternal blood spaces within these placentas revealed extremely enlarged blood sinuses. We are searching for factors that could result in the increased size of the maternal blood sinuses. Cited2 null placentas and embryos are significantly smaller than controls; mutants die 3/4 the way through gestation (15.5dpc). The null mutant placentas have proportionally fewer spongiotrophoblasts, trophoblast giant cells and invasive trophoblasts. In addition, resin casts of fetal vasculature of the placenta reveal that the capillary network is underdeveloped. Through the isolation of trophoblast stem (TS) cells we are exploring the possibility that TS cell proliferation and/or differentiation is impaired due to a lack of Cited2. We suspect that the development of the phenotype may relate to the Hypoxia Inducible Factor-1a (HIF1a) transcription factor as Cited2 expression is induced by HIF1 and it acts to negatively regulate its activity.
'%3e%3cpath fill='%23012169' d='M0 0v30h60V0z'/%3e%3cpath stroke='%23fff' stroke-width='6' d='m0 0 60 30m0-30L0 30'/%3e%3cpath stroke='%23C8102E' stroke-width='4' d='m0 0 60 30m0-30L0 30' clip-path='url(%23b)'/%3e%3cpath stroke='%23fff' stroke-width='10' d='M30 0v30M0 15h60'/%3e%3cpath stroke='%23C8102E' stroke-width='6' d='M30 0v30M0 15h60'/%3e%3c/g%3e%3c/svg%3e)
'/%3e%3c/defs%3e%3cpath fill='%23012169' d='M0 0h10080v5040H0z'/%3e%3cpath stroke='%23fff' stroke-width='.6' d='m0 0 6 3m0-3L0 3' clip-path='url(%23b)' transform='scale(840)'/%3e%3cpath stroke='%23e4002b' stroke-width='.4' d='m0 0 6 3m0-3L0 3' clip-path='url(%23c)' transform='scale(840)'/%3e%3cpath stroke='%23fff' stroke-width='840' d='M2520 0v2520M0 1260h5040'/%3e%3cpath stroke='%23e4002b' stroke-width='504' d='M2520 0v2520M0 1260h5040'/%3e%3cg fill='%23fff'%3e%3cuse xlink:href='%23d' x='2520' y='3780'/%3e%3cuse xlink:href='%23a' x='7560' y='4200'/%3e%3cuse xlink:href='%23a' x='6300' y='2205'/%3e%3cuse xlink:href='%23a' x='7560' y='840'/%3e%3cuse xlink:href='%23a' x='8680' y='1869'/%3e%3cuse xlink:href='%23e' x='8064' y='2730'/%3e%3c/g%3e%3c/svg%3e)
