A central tenet of fibrinolysis is that tissue plasminogen activator–dependent (t-PA– dependent) conversion of plasminogen to active plasmin requires the presence of the cofactor/substrate fibrin. However, previous in vitro studies have suggested that the endothelial cell surface protein annexin II can stimulate t-PA–mediated plasminogen activation in the complete absence of fibrin. Here, homozygous annexin II–null mice displayed deposition of fibrin in the microvasculature and incomplete clearance of injury-induced arterial thrombi. While these animals demonstrated normal lysis of a fibrin-containing plasma clot, t-PA–dependent plasmin generation at the endothelial cell surface was markedly deficient. Directed migration of annexin II–null endothelial cells through fibrin and collagen lattices in vitro was also reduced, and an annexin II peptide mimicking sequences necessary for t-PA binding blocked endothelial cell invasion of Matrigel implants in wild-type mice. In addition, annexin II–deficient mice displayed markedly diminished neovascularization of fibroblast growth factor–stimulated cornea and of oxygen-primed neonatal retina. Capillary sprouting from annexin II–deficient aortic ring explants was markedly reduced in association with severe impairment of activation of metalloproteinase-9 and -13. These data establish annexin II as a regulator of cell surface plasmin generation and reveal that impaired endothelial cell fibrinolytic activity constitutes a barrier to effective neoangiogenesis.
Cultured human endothelial cells synthesize and secrete two types of plasminogen activator, tissue plasminogen activator (t-PA) and urokinase (u-PA). Previous work from this laboratory (Hajjar, K.A., Hamel, N. M., Harpel, P. C., and Nachman, R. L. (1987) J. Clin. Invest. 80, 1712-1719) has demonstrated dose-dependent, saturable, and high affinity binding of t-PA to two sites associated with cultural endothelial cell monolayers. We now report that an isolated plasma membrane-enriched endothelial cell fraction specifically binds 125I-t-PA at a single saturable site (Kd 9.1 nM; Bmax 3.1 pmol/mg membrane protein). Ligand blotting experiments demonstrated that both single and double-chain t-PA specifically bound to a Mr 40,000 membrane protein present in detergent extracts of isolated membranes, while high molecular weight, low molecular weight, and single-chain u-PA associated with a Mr 48,000 protein. Both binding interactions were reversible and cell-specific and were inhibitable by pretreatment of intact cells with nanomolar concentrations of trypsin. The relevant binding proteins were not found in subendothelial cell matrix, failed to react with antibodies to plasminogen activator inhibitor type 1 and interacted with their respective ligands in an active site-independent manner. The isolated t-PA binding site was resistant to reduction and preserved the capacity for plasmin generation. In contrast, the isolated u-PA binding protein was sensitive to reduction, and did not maintain the catalytic activity of the ligand on the blot. The results suggest that in addition to sharing a matrix-associated binding site (plasminogen activator inhibitor type 1), both t-PA and u-PA have unique membrane binding sites which may regulate their function. The results also provide further support for the hypothesis that plasminogen and t-PA can assemble on the endothelial cell surface in a manner which enhances cell surface generation of plasmin.
Platelet activation as a result of vascular injury provokes endothelial cells to respond in a manner which limits or reverses the occlusive consequences of platelet accumulation. If the agonistic forces are strong, platelet accumulation is irreversible. In vitro data from our laboratory have repeatedly demonstrated that platelets become unresponsive to all agonists when in proximity to endothelial cells. This unresponsiveness is due to at least three separate endothelial "thromboregulatory" systems: eicosanoids, endothelium-derived relaxing factor (EDRF/NO), and most importantly an endothelial cell ecto-nucleotidase which metabolizes released platelet adenosine diphosphate (ADP) with consequent restoration of platelets to the resting state. This nucleotidase is operative in the complete absence of EDRF/NO and eicosanoids, indicating that the latter two are dispensable thromboregulators. We have solubilized the human endothelial cell ectoADPase, as well as that from placental tissue. Candidate proteins from a purified ADPase fraction are now being studied in further detail. An understanding of the molecular biology of the ADPase gene may lead to development of therapeutic agents such as soluble forms of the enzyme as well as approaches toward up-regulation of ectoADPase activity. This could result in "early thromboregulation", i.e. prevention and/or reversal of platelet accumulation at sites of vascular damage via immediate metabolic removal of the prime platelet agonist-ADP.
identified a M, = 40,000 endothelial cell receptor for tissue plasminogen activator (t-PA) and plasminogen (PLG) as the calcium-and phospholipid-binding protein, annexin I1 (Ann-11).Here, we examined the effect of Ann-I1 on t-PA-dependent plasminogen activation in a purified system.Purified native Ann-I1 bound t-PA, plasminogen, and plasmin with high affinity (ICd I 25 n ~, 161 m, and 75 m, respectively).At fixed plasminogen concentrations, preincubation with purified native Ann-I1 was associated with an -21-fold increase in the rate of Glu-PLG activation and an -14-fold increase in activation of Lys-PLG.Three irrelevant proteins had no effect on plasmin formation, while fibrinogen increased the rate of Glu-PLG activation by -4-fold.Annexin-II-mediated enhancement of t-PA-dependent plasminogen activation was 9695% inhibited by e-aminocaproic acid or by pretreatment of Ann-I1 with carboxypeptidase B, indicating a carboxyl-terminal lysine-dependent interaction.Kinetic analyses revealed that Ann-I1 conferred an -60-fold increase in catalytic efficiency upon t-PA-dependent activation of either Glu-PLG or Lys-PLG.Thus, Ann-II-mediated assembly of plasminogen and t-PA may promote and localize constitutive plasmin generation on the surface of the blood vessel wall.The preceding paper identifies an endothelial cell co-receptor for tissue plasminogen activator (t-PA)' and plasminogen as annexin I1 (Ann-11) (1).This phospholipid-binding protein is distinct from the urokinase receptor (2) and from other known cellular binding sites for plasminogen (3-6) and t-PA (6-9).
Vascular inflammation is central to the pathogenesis of the atherosclerotic lesion. In the setting of hypercholesterolemia, vascular inflammation accelerates the accumulation of cholesterol within arterial smooth muscle cells, macrophages, and other immune cells. In disorders such as obesity, diabetes, and thrombosis, a myriad of interactions between sterol metabolites and inflammatory mediators exacerbate cholesterol deposition in the vessel wall, leading to the well-known consequences of stroke, transient ischemic attack, myocardial infarction, and peripheral vascular insufficiency. This review highlights emerging concepts in the regulation of cholesterol synthesis, the lipolytic enzymes involved in cholesterol utilization, and the therapies that successfully modulate vascular inflammation. In addition, developments relating to the role of inflammasomes in the management of cholesterol-mediated inflammation are discussed.
The thiol amino acid homocysteine (HC) accumulates in homocystinuria and homocyst(e)inemia, and is associated with a wide variety of clinical manifestations. To determine whether HC influences the cell's program of gene expression, vascular endothelial cells were treated with HC for 6–42 h and analyzed by differential display. We found a 3–7-fold, time-dependent induction of a 220-base pair fragment, which demonstrated complete sequence identity with elongation factor-1δ (EF-1δ), a member of the multimeric complex regulating mRNA translation. Fibroblasts from cystathionine β-synthase −/− individuals also showed up to 3.0-fold increased levels of mRNA for EF-1α, -β, and -δ when compared with normal cells, and treatment of normal cells with the HC precursor, methionine, induced a 1.5–2.0-fold increase in EF-1α, -β, and -δ mRNA. This induction was completely inhibited by cycloheximide and reflected a doubling in the rate of gene transcription in nuclear run-on analyses. In HC-treated endothelial cells, pulse-chase studies revealed a doubling in the rate of synthesis of the thiol-containing protein, annexin II, but no change in synthesis of the cysteineless protein, plasminogen activator inhibitor-1. Thus, HC induces expression of a family of acute translational response genes through a protein synthesis-dependent transcriptional mechanism. This process may mediate accelerated synthesis of free thiol-containing proteins in response to HC-induced oxidative stress. The thiol amino acid homocysteine (HC) accumulates in homocystinuria and homocyst(e)inemia, and is associated with a wide variety of clinical manifestations. To determine whether HC influences the cell's program of gene expression, vascular endothelial cells were treated with HC for 6–42 h and analyzed by differential display. We found a 3–7-fold, time-dependent induction of a 220-base pair fragment, which demonstrated complete sequence identity with elongation factor-1δ (EF-1δ), a member of the multimeric complex regulating mRNA translation. Fibroblasts from cystathionine β-synthase −/− individuals also showed up to 3.0-fold increased levels of mRNA for EF-1α, -β, and -δ when compared with normal cells, and treatment of normal cells with the HC precursor, methionine, induced a 1.5–2.0-fold increase in EF-1α, -β, and -δ mRNA. This induction was completely inhibited by cycloheximide and reflected a doubling in the rate of gene transcription in nuclear run-on analyses. In HC-treated endothelial cells, pulse-chase studies revealed a doubling in the rate of synthesis of the thiol-containing protein, annexin II, but no change in synthesis of the cysteineless protein, plasminogen activator inhibitor-1. Thus, HC induces expression of a family of acute translational response genes through a protein synthesis-dependent transcriptional mechanism. This process may mediate accelerated synthesis of free thiol-containing proteins in response to HC-induced oxidative stress. Homocysteine (HC) 1The abbreviations used are: HC, homocysteine; CBS, cystathionine β-synthase; EF-1, translation elongation factor-1; ELISA, enzyme-linked immunosorbent assay; HUVEC, human umbilical vein endothelial cells; PAI-1, plasminogen activator inhibitor-1; PBS, phosphate-buffered saline; TES,N-tris(hydroxymethyl)methyl-2-aminoethanesulfonic acid. is an intermediate thiol amino acid, which accumulates intracellularly and in plasma in homocystinuria and homocyst(e)inemia (1Mudd H. Levy H.L. Skovby F. Scriver C.R. Beaudet A.L. Sly W.S. Valle D. The Metabolic and Molecular Basis of Inherited Disease. McGraw-Hill, 1995: 1279-1327Google Scholar). HC is formed upon demethylation of methionine, and participates in the transsulfuration pathway in which it condenses with serine to form cystathionine. The most frequently encountered form of homocystinuria results from deficiency of the pyridoxal-5′-phosphate (vitamin B6)-dependent rate-limiting enzyme, cystathionine β-synthase (2Mudd H. Skovby F. Levy H.L. Pettigrew K.D. Wilcken B. Pyeritz R.E. Andria G. Boers G.H.J. Bromberg I.L. Cerone R. Fowler B. Grobe H. Schmidt H. Schweitzer L. Am. J. Hum. Genet. 1985; 37: 1-31PubMed Google Scholar, 3Kraus J.P. J. Inher. Metab. Dis. 1994; 17: 383-390Crossref PubMed Scopus (87) Google Scholar). In addition, the enzymes 5-methyltetrahydrofolate-homocysteine methyltransferase and 5,10-methylenetetrahydrofolate reductase participate in the remethylation of HC, regenerating methionine in the presence of 5-methyltetrahydrofolate. Genetic or acquired deficiencies of these enzymes are also causes of homocyst(e)inemia (4Frosst P. Blom H.J. Milos R. Goyette P. Sheppard C.A. Matthews R.G. Boers G.H.J. Den Heijer M. Kluijtmans L.A.J. Van den Heuvel L.P. Rozen R. Nat. Genet. 1995; 10: 111-113Crossref PubMed Scopus (5166) Google Scholar). Since HC is not a dietary constituent, the sole source of HC in human tissues is methionine. Elevations in plasma homocyst(e)ine have been associated with a variety of clinical syndromes including thromboembolic vascular disease, dislocation of the ocular lens, osteoporosis, neural tube defects, and mental retardation (1Mudd H. Levy H.L. Skovby F. Scriver C.R. Beaudet A.L. Sly W.S. Valle D. The Metabolic and Molecular Basis of Inherited Disease. McGraw-Hill, 1995: 1279-1327Google Scholar, 5Rees M.M. Rodgers G.M. Thromb. Res. 1993; 71: 337-359Abstract Full Text PDF PubMed Scopus (257) Google Scholar, 6Loscalzo J. J. Clin. Invest. 1996; 98: 5-7Crossref PubMed Scopus (729) Google Scholar, 7Mills J.L. McPartin J.M. Kirke P.N. Lee Y.J. Conley M.R. Weir D.G. Lancet. 1995; 345: 149-151Abstract PubMed Scopus (500) Google Scholar). The mechanisms for these diverse effects are not understood. Recent studies suggest that imbalances in the redox state of a cell may profoundly influence its functional activity. Oxidatively modified proteins, as may form in the presence of HC (8McCully K.S. Ann. Clin. Lab. Sci. 1993; 23: 477-493PubMed Google Scholar), undergo modified rates of cellular processing (9Blazquez M. Fominaya J.M. Hofsteenge J. J. Biol. Chem. 1996; 271: 18638-18642Abstract Full Text Full Text PDF PubMed Scopus (51) Google Scholar, 10Stadtman E.R. Science. 1992; 257: 1220-1224Crossref PubMed Scopus (2417) Google Scholar, 11Rijken D.C. Groeneveld E. J. Biol. Chem. 1986; 261: 3098-3102Abstract Full Text PDF PubMed Google Scholar), follow alternative transport pathways (12Lentz S.R. Sadler J.E. J. Clin. Invest. 1991; 88: 1906-1914Crossref PubMed Scopus (457) Google Scholar, 13Lentz S.R. Sadler J.E. Blood. 1993; 81: 683-689Crossref PubMed Google Scholar), and manifest functional abnormalities (6Loscalzo J. J. Clin. Invest. 1996; 98: 5-7Crossref PubMed Scopus (729) Google Scholar). In addition, several genes including reducing agent and tunicamycin-responsive protein (RTP), the stress protein GRP78/BiP, activating transcription factor 4 (ATF-4), and a methylenetetrahydrofolate dehydrogenase/cyclohydrolase have been found to be induced in endothelial cells exposed to high dose HC (14Kokame K. Kato H. Miyata T. J. Biol. Chem. 1996; 271: 29659-29665Abstract Full Text Full Text PDF PubMed Scopus (307) Google Scholar). In vascular smooth muscle cells, the cyclin A gene appears to be transcriptionally activated following exposure to HC (15Tsai J.C. Perrella M.A. Yoshizumi M. Hsieh C. Haber E. Schlegel R. Lee M. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 6369-6373Crossref PubMed Scopus (769) Google Scholar, 16Tsai J.C. Wang H. Perrella M.A. Yoshizumi M. Sibinga N.E.S. Tan L.C. Haber E. Chang T.HT. Schlegel R. Lee M. J. Clin. Invest. 1996; 97: 146-153Crossref PubMed Scopus (195) Google Scholar). Elongation factor-1 (EF-1) is a multimeric protein that regulates the efficiency and fidelity of mRNA translation in eukaryotic cells. Expression of EF-1α, the best studied of four subunits (α, β, γ, and δ), is regulated at both transcriptional and post-transcriptional levels. In the present study, we show that HC, either supplied exogenously to endothelial cells or produced endogenously in cystathionine β-synthase-deficient fibroblasts, up-regulates the EF-1 family of genes. This occurs through a transcriptional mechanism that is protein synthesis-dependent. Furthermore, EF-1 induction by HC is associated with accelerated turnover of the thiol-containing protein, annexin II, whereas synthesis of a cysteineless protein, plasminogen activator inhibitor-1, is unchanged. These data suggest that the cell may respond to deleterious effects of HC by induction of an acute translational response by which damaged proteins may be efficiently replenished. dl-homocysteine,l-cysteine, l-methionine, and cycloheximide were purchased from Sigma. [α-35S]dATP, [α-32P]dCTP, and [α-32P]rUTP were obtained from NEN Life Science Products. Plasmids containing cDNAs encoding human EF-1α (81678) and EF-1β (78530) were from American Type Culture Collection. A 28 S rRNA probe was kindly supplied by Dr. Iris Gonzales, Department of Pathology, Hahneman University, Philadelphia, PA. Polyclonal rabbit IgG directed against human EF-1α, -β, -γ, and -δ subunits was generously provided by Dr. Wim Möller (Leiden University, Leiden, The Netherlands). Affinity-purified rabbit anti-Dyctiostelium EF-1α was kindly supplied by Dr. John Condeelis (Albert Einstein College of Medicine, Bronx, NY). Polyclonal goat anti-human plasminogen activator inhibitor-1 IgG (395G) was purchased from American Diagnostica. Human umbilical vein endothelial cells (HUVEC) were harvested, propagated in M199, 0.3 mmdl-methionine, 20% pooled human serum (17Hajjar K.A. Harpel P.C. Jaffe E.A. Nachman R.L. J. Biol. Chem. 1986; 261: 11656-11662Abstract Full Text PDF PubMed Google Scholar). Normal and cystathionine β-synthase −/− human fibroblasts (NIGMS Human Genetic Mutant Cell Repository; GM 00751) were cultured in Earle's minimal essential medium, 0.15 mml-methionine, 20% fetal bovine serum. dl-Homocysteine,l-cysteine, or l-methionine were added as 2- or 4-fold stock solutions. Fibroblasts or HUVEC from T75 flasks were washed three times with PBS, scraped into 5 ml of PBS, pelleted, and resuspended in 1 ml of PBS. Lysates were prepared by three cycles of freeze-thaw. Following centrifugation (15,000 ×g, 10 min), supernatants were diluted 1:10 in 0.1m Na2HPO4, pH 8.0, and treated immediately with 200 μm 5,5′-dithio-bis-(2-nitrobenzoic acid) (Ellman's reagent, 15 min, 21 °C). Absorbance at 412 nm was used to calculate free sulfhydryl content using a path length of 1 cm and molar extinction coefficient of 14,150. Total RNA from HUVEC treated with or without dl-homocysteine was isolated by guanidinium thiocyanate protein denaturation and phenol-chloroform extraction (18Chomczynski P. Sacchi N. Anal. Biochem. 1987; 162: 156-159Crossref PubMed Scopus (64658) Google Scholar). For differential display (19Liang P. Pardee A.B. Science. 1992; 257: 967-971Crossref PubMed Scopus (4718) Google Scholar), RNA (0.2 μg) was reverse transcribed in a buffer containing 50 mm Tris-HCl, 75 mmKCl, 3 mm MgCl2, and 5 mmdithiothreitol, pH 8.3, using degenerate primers T12MG, T12MA, and T12MC, where M is A, G, or C. The reaction mixture was heated to 65 °C (5 min), and then cooled (37 °C, 10 min) prior to incubation with Moloney murine leukemia virus reverse transcriptase (Life Technologies, Inc., 200 units, 37 °C, 60 min). The reaction was terminated by heating to 95 °C (5 min), and then stored at −20 °C (18 h). Reverse transcribed cDNA was amplified by polymerase chain reaction in the presence of [α-35S]dATP using 10 arbitrary forward primers (Genhunter Corp.; 5′-AGCCAGCGAA-3′, 5′-GACCGCTTGT-3′, 5′-AGGTGACCGT-3′, 5′-GGTACTCCAC-3′, 5′-GTTGCGATCC-3′, 5′-GCAATCGATG-3′, 5′-CCGAAGGAAT-3′, 5′-GGATTGTGCG-3′, 5′-CGTGGCAATA-3′, 5′-TAGCAAGTGC-3′) and three oligo(dT) reverse primers, through 40 cycles consisting of 94 °C (30 s), 40 °C (2 min), and 72 °C (30 s), and a final incubation at 72 °C (5 min). Amplified cDNAs were resolved on a 6% polyacrylamide sequencing gel (1500 constant V, 3 h). Gels were dried without fixation, and exposed to Kodak XAR film (−70 °C, 18 h). Differentially displayed bands were cut out, recovered by ethanol precipitation in the presence of 3 m sodium acetate (pH 5.2), and reamplified by polymerase chain reaction. Products were isolated on 1% low melting point agarose and purified by ethanol precipitation (20Gold P. Vessels. 1992; 2: 9-16Google Scholar). Total RNA from HUVEC or fibroblasts (4–10 μg) was resolved on a 1.5% agarose denaturing formaldehyde gel, and blotted to Zetaprobe (Bio-Rad) (21). Radiolabeled probes were generated by random prime labeling and incubated with filters (18 h, 43 °C in 50% formamide or 48 °C in 25% formamide). Filters were washed four times in increasingly stringent SSC solutions from 2 to 0.1×SSC at 21 °C, dried, and autoradiographed on Kodak XAR film (−70 °C). Signals were quantified by phosphorimaging and/or laser densitometry. Differentially displayed cDNAs were subcloned directionally into pBluescript KS+ (Stratagene) usingEcoRI and XbaI restriction sites, and sequenced at the Rockefeller University DNA and Protein Sequencing Laboratory using T3 and T7 primers. Derived sequences were compared with GenBank and EMBL data bases. Nuclei were isolated by cell lysis in 0.5% Nonidet P-40 from normal and cystathionine β-synthase −/− fibroblasts, washed, and stored in liquid nitrogen in 50 mmTris-HCl, 40% glycerol (v/v), 5 mm MgCl2, 0.1 mm EDTA, pH 8.3 (22Greenberg M. Ziff E. Nature. 1984; 311: 433-438Crossref PubMed Scopus (2220) Google Scholar). Thawed nuclear suspensions (200 μl) from either untreated cells, or cells treated with 0.3 mmmethionine or 0.3 mm cysteine (18 h), were incubated with 0.5 mm ATP, CTP, GTP, and [α-32P]UTP (800 Ci/mmol, 30 min, 30 °C). 32P-Labeled RNA was isolated by phenol/chloroform/isoamyl alcohol (25/24/1; v/v/v; pH 5.2) extraction and precipitation, and resuspended at equal cpm/ml in hybridization buffer (10 mm TES, 0.2% SDS, 10 mm EDTA, 600 mm NaCl, pH 7.4). Denatured probes for EF-1α, -β, and -δ and 28 S RNA (8.3 μg) slot-blotted on nitrocellulose filters were hybridized with labeled nuclear transcripts (65 °C, 36 h). The filters were dried, autoradiographed with Kodak XAR film (24 h, −70 °C), and the signals quantified by phosphorimaging. HUVEC or fibroblasts were washed three times with PBS (137 mm NaCl, 1.5 mmKH2PO4, 15 mmNa2HPO4·7H2O, 3 mmKCl, pH 7.4) and lysed by three cycles of freeze-thaw. Lysates were centrifuged at 15,000 × g, and the supernatants (5 μg/well in 50 μl of carbonate buffer: 15 mmNa2CO3, 35 mm NaHCO3, 3 mm NaN3, pH 9.6) used to coat wells of 96-well Nunc immunosorbent plates (18 h, 4 °C). The wells were blocked with bovine serum albumin (10 mg/ml in PBS/0.5% Tween 20, 2.5 h, 37 °C), washed and incubated with subunit-specific rabbit immune IgG (1:500 in PBS/0.5% Tween 20, 2.5 h, 37 °C), the specificities of which were verified by Western blot (23Sanders J. Brandsma M. Janssen G.M.C. Dijk J. Moller W. J. Cell. Sci. 1996; 109: 1113-1117Crossref PubMed Google Scholar). The wells were washed three times with PBS, incubated with alkaline phosphatase-conjugated goat anti-rabbit IgG (1:500 in PBS/0.5% Tween 20, 2.5 h, 37 °C), washed again three times, and developed withp-nitrophenylphosphate in diethanolamine buffer (9.7% diethanolamine v/v, 3 mm NaN3, 0.01% MgCl2·6H2O, pH 9.8). Change in absorbance was evaluated over a 60-min time interval. HUVEC (80% confluent), untreated or treated with 5 mmdl-homocysteine (18 h), were washed three times with Hepes-buffered saline (HBS, 11 mm Hepes, 137 mmNaCl, 4 mm KCl, 11 mm glucose, pH 7.4) and incubated with methionine-free medium (4 h). Cells were then pulsed with 50 μCi of [35S]methionine per 75-cm2flask (1 h), washed three times with HBS, and chased with complete medium with or without 5 mm homocysteine. Cells were treated with protease inhibitors and lysed by three cycles of freeze-thaw in HBS. Supernatants (500 × g, 10 min, 500 μl) were incubated with polyclonal anti-annexin II (24Cesarman G.M. Guevara C.A. Hajjar K.A. J. Biol. Chem. 1994; 269: 21198-21203Abstract Full Text PDF PubMed Google Scholar) or anti-PAI-1 (American Diagnostica 395G) for 18 h, treated with a 200-μl packed volume of Protein G Sepharose 4 Fast Flow beads (Amersham Pharmacia Biotech 17-0618-01) pre-equilibrated in 0.75 Tris, pH 8.8 (4 °C, 3 h), and washed three times in the same buffer (25Hajjar K.A. Guevara C.A. Lev E. Dowling K. Chacko J. J. Biol. Chem. 1996; 271: 21652-21659Abstract Full Text Full Text PDF PubMed Scopus (109) Google Scholar). The beads were treated for 30 min (21 °C) with 100 μl of 5× PAGE sample buffer, and the samples electrophoresed on a 12% SDS-polyacrylamide gel (18 h). The gels were treated with EN3HANCE, dried, fluorographed, and analyzed by densitometric image analysis. Differential display analysis of mRNA from untreated HUVEC, and HUVEC treated with 5 mm HC for 6, 18, and 42 h was carried out. Total intracellular thiol content of HC-treated HUVEC peaked at 2.4 times base line within 4 h, and remained at greater than twice base line from 6–18 h (Fig.1). In HC-treated HUVEC, release of neither 51Cr (26Hajjar K.A. J. Clin. Invest. 1993; 91: 2873-2879Crossref PubMed Scopus (306) Google Scholar) nor lactate dehydrogenase differed from that observed in untreated controls (8.1 ± 2.3 versus9.1 ± 1.2 units/ml, respectively, S.E., n = 4), indicating that cellular integrity was maintained. In two separate experiments, approximately 10 discrete bands appeared to be up- or down-regulated in the presence of HC, one of which (arrow) showed a time-related increase in intensity (3.6-fold at 6 h, 4.8-fold at 18 h, and 6.9-fold at 42 h) (Fig.2). Upon reamplification and Northern blot analysis of mRNA from control and HC-treated HUVEC, time-dependent expression could be confirmed only for this band (Fig. 3 C). This DNA fragment was subcloned directionally into pBluescript KS+ usingEcoRI and XbaI restriction sites. Sequence analysis revealed complete identity with bases 770–991 of the cDNA for human elongation factor-1δ (EF-1δ), a protein involved in regulation of mRNA translation (TableI).Figure 2Representative differential display of mRNA transcripts from HC-stimulated HUVEC. Confluent passage 2–4 HUVEC were treated with 5 mmdl-HC in regular medium for 0, 6, 18, and 42 h. Total RNA was harvested, reverse transcribed, and amplified by polymerase chain reaction as described under “Experimental Procedures.” Transcripts were analyzed on a 6% polyacrylamide sequencing gel. Shown are products derived from degenerate primer T12MC (M = A, G, or C) and four arbitrary primers (A, 5′-AGCCAGCGAA-3′; B, 5′-GACCGCTTGT-3′; C, 5′-AGGTGACCGT-3′; D, 5′-GGTACTCCAC-3′). Arrowheads indicate bands selected for further analysis. The arrow indicates the band confirmed by Northern blot.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Figure 3Time course for the steady state EF-1 mRNA response in HC-treated HUVEC. A, EF-1α; B, EF-1β; C, EF-1δ. Total RNA from HUVEC treated for various periods of time with 5 mm HC was probed in Northern blot analyses with cDNA fragments encoding the indicated EF-1 subunit. Signals were normalized for total RNA loaded per lane using a 28 S probe. Shown are means ± S.E.,n = 3. (p < 0.01 by Student's two-tailed t test, except for * where value is not significantly different from control.)View Large Image Figure ViewerDownload Hi-res image Download (PPT)Table IEF-1δ, a transcript differentially displayed by homocysteine-treated HUVECG777GGGCY G I RK L Q IQ C V V781TACGGTATCCGGAAGCTACAGATTCAGTGTGTGGTGE D D KV G T DL L E E817GAGGACGACAAGGTGGGGACAGACTTGCTGGAGGAGE I T KF E E HV Q N V853GAGATCACCAAGTTTGAGGAGCACGTGCAGAATGTCD I A AF N K I889GATATCGCAGCTTTCAACAAGATCTGAAGCCTGAGT925GTGTGTACGTGCGCGCGTGCGTGAGGGCCCTGCCAC961GATTAAAGACTGAGACCGG Open table in a new tab EF-1δ is one member of a five-subunit complex that regulates the rate of mRNA translation. To determine whether mRNAs encoding related subunits EF-1α and EF-1β were also up-regulated in the presence of HC, additional Northern hybridization analyses were carried out (Fig. 3, A and B). These studies revealed an increase in steady state mRNA for EF-1α, -β, and -δ that was evident by 6–18 h, and maximal (2–4-fold) by 42 h. Thus, exposure of endothelial cells to HC appeared to coordinately up-regulate steady state mRNA for all three EF-1 subunits. To determine the specificity and dose-response relationship of EF-1δ mRNA upon exposure to HC, HUVEC were treated with 5 μM to 5 mm HC or l-cysteine for 24 h (data not shown). Northern hybridization revealed a 1.4–3.0-fold dose-related increase in steady state mRNA levels in response to HC, but, interestingly, no significant response to l-cysteine in the same dosage range. These data indicated that the effect of HC was both specific and dose-dependent, occurring at concentrations of HC commonly seen in vascular disease (15–100 μM). To determine whether up-regulation of EF-1 subunit mRNAs was reflected at the protein level, ELISAs were carried out (27Voller A. Bidwell D. Bartlett A. Rose N.R. Friedman H. Manual of Clinical Immunology. 1976: 506-512Google Scholar) (Fig.4). After 8 h, expression of EF-1α and -β increased by 90–95%, while EF-1γ and -δ rose by 60–65%. By 24 h, expression of all four subunits had increased by 2.5–3.5 times (p < 0.001). These data suggested that all components of the EF-1 complex are coordinately regulated, and increase significantly at the protein level in response to HC. To determine whether EF-1δ and its partners, EF-1α and -β, were up-regulated under conditions where homocysteine is produced endogenously, normal human foreskin fibroblasts were compared with homocystinuric fibroblasts which lack the enzyme cystathionine β-synthase (CBS −/−). At rest, CBS −/− fibroblasts contained approximately twice as much intracellular thiol as normal fibroblasts (Fig. 1). When CBS +/+ fibroblasts were treated with 0.45 mm methionine, a homocysteine precursor, intracellular thiols doubled within 4 h, and slowly returned to base line over the next 14 h. CBS −/− fibroblasts, on the other hand, showed roughly a doubling of intracellular thiol within 4 h, followed by a continuous further increase over the ensuing 14 h. These experiments verified that CBS −/− fibroblasts were unable to clear methionine-induced intracellular thiols, whereas CBS +/+ cells did so with relative efficiency. As shown in Fig. 5, treatment of normal fibroblasts with 0.45 mm methionine led to a 1.3–1.7-fold increase in steady state mRNA levels for EF-1α, -β, and -δ in Northern blot analyses (p < 0.001). Furthermore, normal fibroblasts treated with 1 mm HC showed a 1.5–2.5-fold increase in EF-1α, -β and -δ mRNA (p < 0.001). In resting homocystinuric fibroblasts, steady state levels of EF-1α, -β, and -δ mRNA were increased by 1.5–3.0-fold (p < 0.001). Supplemental methionine did not increase these levels further. These data indicated that steady state levels of EF-1α, -β, and -δ mRNA are significantly up-regulated under conditions where intracellular homocysteine is increased. In addition, protein levels of EF-1 subunits in normal and homocystinuric fibroblasts were assessed by ELISA (Fig. 4 B). Compared with CBS +/+ cells, CBS −/− fibroblasts showed a 2.5–4.5-fold increase in expression of EF-1 subunit protein (p < 0.001). To ascertain the mechanism by which EF-1 subunit mRNA was induced in response to methionine, time-course studies were undertaken (Fig.6 ). In response to methionine, both EF-1α (Fig. 6 A) and EF-1δ (Fig. 6 B) mRNA steady state levels in CBS +/+ fibroblasts peaked within 4 h and remained elevated for up to 18 h. This response was inhibited in cells pretreated with cycloheximide (100 μM, 2 h). EF-1α mRNA levels also fell in response to cycloheximide, but recovered between 4 and 18 h. These data suggest that induction of both EF-1α and EF-1δ requires protein synthesis. Identical results were obtained when 5 mm HC was substituted for methionine, suggesting that methionine may act by conversion to HC.Figure 6Time course of EF-1 subunit mRNA induction in normal fibroblasts by methionine. Normal fibroblasts were treated with 0.45 mm methionine for 1, 2, 4, and 18 h. Steady state mRNA levels for EF-1α (A) or for EF-1δ (B) were estimated by Northern blot analysis of samples from cells either pretreated (+CHX) or not pretreated (−CHX) with cycloheximide (100 μM, 2 h). mRNA levels were normalized to 28 S RNA for each sample.View Large Image Figure ViewerDownload Hi-res image Download (PPT) To determine whether induction of EF-1 subunits by methionine involved regulation at the transcriptional level, nuclear run-on experiments were conducted (Fig. 7). For all three genes, the rate of transcription in CBS +/+ cells increased 1.8–2.5-fold upon addition of 0.45 mm methionine (p < 0.001). Similarly, in CBS −/− cells, transcription was increased 1.8–2.5-fold compared with CBS +/+ cells (p < 0.001), and this rate was not augmented further upon addition of methionine. In contrast, addition ofl-cysteine (0.3 mm) to the culture medium failed to significantly enhance the rate of transcription of EF-1α, -β, or -δ in either CBS +/+ or CBS −/− cells. These data suggest that increased intracellular levels of methionine or homocysteine, but not cysteine, are specifically associated with increased transcription of EF-1α, -β, and -δ mRNA. To assess the effect of HC on overall protein synthesis, incorporation of [35S]methionine into trichloroacetic acid-precipitable material was quantified in both control and HC-treated HUVEC. By this criterion, total protein synthesis was consistently reduced over 4–40 h to 63 ± 5% (S.E., n = 10) in the presence of HC. To determine the effect of EF-1 induction on turnover of a thiol-containing protein, pulse-chase metabolic labeling was conducted (Fig.8 A). Annexin II is a calcium-regulated phospholipid-binding protein that contains 4 cysteine residues, at least 2 of which exist in the reduced state (28Burger A. Berendes R. Liemann S. Benz J. Hofmann A. Gottig P. Huber R. Gerke V. Thiel C. Romisch J. Weber K. J. Mol. Biol. 1996; 257: 839-847Crossref PubMed Scopus (110) Google Scholar). Following the initial [35S]methionine pulse, synthesis of annexin II proceeded 2.1 times as rapidly in HC-treated cells as in untreated control cells. By 16 h of chase, levels of immunoprecipitable annexin II in HC-treated cells averaged twice those observed in untreated control cells. The rate of disappearance of annexin II in HC-treated cells was 1.9 times greater than that of control cells. These data indicate that HC accelerates rates of annexin II synthesis and degradation. Because HC had no significant effect on annexin II mRNA levels at 16 h and 42 h (annexin II mRNA/GAPDH mRNA: 102% and 94% of untreated control, respectively), the observed increase in annexin II synthesis appears to reflect an enhancement in translational efficiency. In contrast, there was no significant difference in turnover of the non-thiol-containing, cysteineless protein, plasminogen activator inhibitor-1 (PAI-1) (Fig.8 B), as immunoprecipitable levels of PAI-1 differed by less than 15% throughout a 40-h time course. Thus, although turnover of a thiol-containing protein, annexin II, was accelerated in the presence of HC, metabolism of a non-thiol protein, PAI-1, was unaltered. Protein translation plays a crucial role in processes governing cell growth, proliferation, and differentiation (29Proud C.G. Mol. Biol. Rev. 1994; 19: 161-170Google Scholar, 30Merrick W.C. Microbiol. Rev. 1992; 56: 291-315Crossref PubMed Google Scholar, 31Morris D.R. Prog. Nucleic Acids Res. 1995; 51: 339-363Crossref PubMed Scopus (63) Google Scholar). In most eukaryotes, the two primary elongation factors, multimeric EF-1 and monomeric EF-2, are primary sites of regulation of protein translation (29Proud C.G. Mol. Biol. Rev. 1994; 19: 161-170Google Scholar). EF-1 consists of five subunits (α2βγδ), which promote GTP-driven delivery of aminoacyl tRNAs to the ribosome. The EF-1α·GDP complex is converted to active EF-1α·GTP by the nucleotide exchange activities of EF-1β and EF-1δ. The EF-1γ moiety is known to enhance the nucleotide exchange activity of EF-1β, and may also serve to anchor the complex to membrane structures. Interestingly, EF-1δ, which is homologous to EF-1β in the C-terminal nucleotide exchange region, is unique among these factors in that it contains a leucine zipper motif of unknown function. EF-1 appears to play a central role in regulation of mRNA translation, and alterations in levels of EF-1 subunit expression have been reported in a variety of settings. Over-expression of EF-1α is associated with increased translational fidelity in yeast (32Song J.M. Picologlou S. Grant C.M. Firoozan M. Tuite M.F. Liebman S. Mol. Cell. Biol. 1989; 9: 4571-4575Crossref PubMed Scopus (69) Google Scholar), and increased longevity in Drosophila (33Shepherd J.C.W. Walldorf U. Hug P. Gehring W.J. Proc. Natl. Acad. Sci. U. S. A. 1989; 86: 7520-7521Crossref PubMed Scopus (146) Google Scholar). Loss of expression of EF-1α, on the other hand, is accompanied by decreased rates of protein synthesis and the onset of senescence in human fibroblasts (34Cavallius J. Rattan S.I. Clark B.F. Exp. Gerontol. 1986; 21: 149-157Crossref PubMed Scopus (85) Google Scholar). Furthermore, EF-1α expression, possibl
