53 seed samples collected from harvested seed loads of irrigated wheat fields in Markazi province in the central of Iran was used for this study. Isolation and identification of seed-borne fungi were conducted according to standard tests described by the International Seed Testing Association (ISTA). A total of 15 fungal species including Tilletia laevis, Tilletia tritici, Ustilago tritici, Fusarium graminearum, Fusarium culmorum, Microdochium nivale, Bipolaris sorokiniana, Alternaria alternata, Curvularia sp., Aspergillus niger, Aspergillus candidus, Aspergillus flavus, Penicillium sp., Mucor sp. and Rhizopus sp . were identified in three wheat cultivars of Backcross Roshan, Alvand and C-78-14. The average of infection level in tested samples to both T. laevis and T. tritici was estimated as much as 7.1% in the province and the minimum and maximum infection levels were found in Lilian (Khomein) and Jirya regions (Arak), respectively. The average of infection rate by U. tritici in seed samples was 1.3% while it was as much as 17.4% for both F. culmorum and B. sorokiniana in the province. The frequency of A. niger and Penicillium sp. was predominant with an infection range of 37.8 and 29.1%, respectively. For the first time, the incidence and infection level of seed-borne fungi in wheat seeds have been determined in the central part of Iran. Key words : Infection rate, seed-borne fungi, seed quality, wheat.
Summary Rotylenchus bunae n. sp. was discovered in the coffee rhizosphere in Gera district of Jimma, Ethiopia, and has been morphologically and molecularly characterised. The new species is identified by a female body length of 725-876 μ m, hemispherical lip region with 4-5 lip annuli, stylet length of 28-30 μ m, lateral field areolation only in the pharyngeal region, no cuticular striations, pharyngeal gland overlapping intestine dorsally by 15-26 μ m, double epiptygma, no clear spermathecae, vulva position at 54-58% of body length from anterior end, prominent fasciculi in mid and posterior body, rounded or sometimes slightly truncated, coarsely crenated tail with 11-13 annuli, and phasmids located at 7-16 annuli anterior to anus. No males were detected. This species was found closely related to other African Rotylenchus species, such as R. unisexus and R. wimbii ; however, it could be well separated from them by both morphology and molecular data (D2-D3 of 28S and partial 18S of rDNA).
Abstract We found that Nanidorus spp. was pathogenic to seashore paspalum ( Paspalum vaginatum ) turfgrass as its population increased from 100 to 2,080 nematodes per pot 180 days after inoculation under greenhouse conditions. Morphological measurements of adult females were similar to those described for N. minor . Molecular analysis also confirmed the morphological identification by targeting three different regions of the genomic DNA. Three primer pairs targeting 18S rDNA (360F/932R), 28S rDNA (D2A/D3B) and ITS1 rDNA (BL18/5818) were used in singleplex PCR. Forward and reverse sequences of each individual primer set were then subjected to multiple alignment and the complimentary sequences were assembled into a consensus sequence. Upon nucleotide blast on the NCBI website, they were all confirmed to be N. minor . A one-step multiplex PCR method using specific primers and a fragment size of 190 bp also confirmed the identity of N. minor . To the best of our knowledge, this is the first report of N. minor infecting seashore paspalum turfgrass in Georgia.
Root-knot nematodes (RKN), Meloidogyne spp., are considered a major problem in most tropical fruit orchards worldwide, including dragon fruit (pitaya; Hylocereus spp.) (Collet et al., 2021; Long et al., 2022; Gitonga et al., 2023; Hajihassani et al., 2023a). Two dragon fruit orchards (TR and CT) were sampled in November 2023 in Homestead, Florida, to assess the incidence of nematodes. The dragon fruit from both orchards exhibited leaf yellowing, stunted growth and wilting (Fig. 1A and B). Small galls and egg masses were observed on the roots (Fig. 2A and B). About 2 kg of well-mixed soil and about 200 g of roots were collected randomly from at least 20 trees in each orchard at a 0–20 cm soil depth. Population densities of eight second-stage juveniles (J2s) per 100 cm3 of soil and 59 J2s per 5 g of roots were recovered after extraction using standard sugar flotational and mist chamber techniques, respectively. The perineal pattern was oval-shaped, displaying both coarse and smooth ridges, with the dorsal arch ranging from moderately elevated to nearly rounded or squared (Fig. 3A). The morphology and morphometric analyses of J2s revealed body length 423.46 ± 14.43 (402.18–446.28) μm; body width 16.15 ± 1.42 (14.62–18.5) μm; ratios a 26.22 ± 2.56 (21.74–29.04), b 5.48 ± 0.29 (5–5.87) and c 8.68 ± 1.23 (7.88–10.97); stylet length 15.3 ± 0.32 (14.87–15.9) μm; anterior to secretory-excretory pore 53.42 ± 6.55 (44.3–61.14) μm; tail length 48.80 ± 6.6 (41.14–56.21) μm; and tail hyaline length 16.19 ± 1.79 (13.85–18.86) μm (Fig. 3B). The body length and width range of adult females (n = 10) were 742.6 to 630.0 μm and 525.3 to 631.0 μm, respectively. The morphological analyses agreed with previous reports of M. enterolobii (Gitonga et al., 2023; Hajihassani et al., 2023b). For molecular identification, genomic DNA was isolated (Gitonga et al., 2023) from female nematodes and amplified using M. enterolobii species-specific primers, Me-F/Me-R (Long et al., 2006). An isolate of M. enterolobii from Georgia, USA was used as a positive control. A fragment of c. 250 bp was amplified from the two populations and the positive control. No amplification was evident on the negative Meloidogyne samples, confirming the M. enterolobii diagnosis (Hajihassani et al., 2023b; Gitonga et al., 2023). To confirm the identity of M. enterolobii using universal DNA markers, 28S, 18S, COI and ITS regions were amplified using the primer pairs D2/D3, 18A/26R, JB3/JB4.5 and Vrain2F/Vrain2R, respectively (Vrain et al., 1992; Janssen et al., 2017). The 28S, 18S, COI and ITS sequences were allocated GenBank Accession Nos. PP718986, PP716914, PP716916 and PP717825, and were 98.96%, 99.72%, 100% and 92.78% identical to sequences of M. enterolobii (PP564852, OK076893, MT075847 and MT406251, respectively). A neighbour-joining phylogenetic tree (Fig. 4) reconstructed using the COI mRNA gene sequence formed a single clade with six other representative sequences of M. enterolobii from GenBank further confirming the identity as M. enterolobii. A pathogenicity test was performed to confirm that dragon fruit is a susceptible host for M. enterolobii. The TR population was cultured on aubergine cv. Black Beauty and four-month-old red dragon fruit (unspecified cultivar) plants grown in 11-litre plastic pots were inoculated with 10,000 eggs of M. enterolobii and maintained outside under field conditions during the spring in South Florida. After 90 days, a reproduction factor of 4.4 was determined for the nematode, confirming its parasitism on dragon fruit. No eggs were recovered from uninfected plants. This is the first report of M. enterolobii infecting dragon fruit in the United States, which poses a potential threat to this crop. The authors would like to thank the grower and Dr. Daniel Carrillo who allowed us to sample their fields and Francisco Baquedano, Sebastian Palmieri, Jacob Larkin, and Andres Franco for their technical assistance.
Abstract Onions ( Allium cepa L.) are the leading vegetable crop in Georgia accounting for 13.7% of total state vegetable production (Wolfe and Stubbs, 2017). In November 2017, two samples each of onion (var. Candy Ann) seedlings and soil were received from the University of Georgia Cooperative Extension office in Tattnall County, GA. The samples were collected from a nursery fumigated with metam sodium and used for sweet onion transplant production. Symptoms of the damaged plants included stunted growth both in the root system and foliage, tip die-back of the leaves (Fig. 1A,B), and slight swelling at the tip of roots. Vermiform life stages from the soil samples were extracted using centrifugal-flotation technique (Jenkins, 1964). On an average, 67 stubby-root nematodes per 100 cm 3 of soil were obtained. Additional two soil samples were collected from the nursery in December 2017 to confirm the presence of the nematode. On an average, 1 and 75 nematodes per 100 cm 3 of soil were recovered from areas with healthy and infested plants, respectively. Because the male individuals were not found in the soil samples, females were used for species identification. Morphological and molecular analyses of females (Fig. 2A-C) identified the species as Paratrichodorus minor (Colbran) Siddiqi; (Decraemer, 1995). Nematode body shape was “cigar-shaped” with dorsally curved “onchiostyle” stylet Females had an oval-shaped vagina, vulva a transverse slit, and lateral body pores were absent. The measurements of females ( n = 20) included: body length 671.1 (570.1–785.3) µm; body width 32.5 (27.8–37.0) µm; onchiostyle 32.5 (31.1–34.8) µm; anterior end to esophagus-intestinal valve 117.6 (101.2–128.5) µm; a 21.5 (15.3–28.1) µm; b 5.2 (4.9–6.3) µm; V 52.9% (48.1–55.4%) µm; and vagina length 8.7 (7.8–10.7) µm. To confirm the identity of P. minor, DNA was extracted from single females ( n = 3) using Extract-N-Amp ™ Tissue PCR Kit (Sigma-Alredich Inc., St. Louis, MO). The partial 18S rRNA, the D2-D3 expansion segments of 28S rRNA, and ITS1 rDNA were amplified using primer pairs 360F (5′ CTACCACATCCAAGGAAGGC 3′)/932R (5′ TATCTGATCGCTGTCGAACC 3′), D2A (5′ ACAAGTACCGTGAGGGAAAGTTG 3′)/D3B (5′ TCGGAAGGAACCAGCTACTA 3′), and BL18 (5′ CCCGTCGCTACTACCGATT 3′)/5818 (5′ ACGARCCGAGTGATCCAC 3′), respectively (Riga et al., 2007; Duarte et al., 2010; Ye et al., 2015; Shaver et al., 2016). The obtained PCR fragments were purified using QIAquick Gel Extraction Kit (Qiagen Inc., Santa Clara, CA, USA), sequenced and deposited in the GenBank databases (18S rRNA: MG856931; 28S rRNA: MG856933; ITS1 rDNA: MH464152). The 18S rRNA, 28S D2-D3, and ITS1 rDNA sequences shared 99% similarity (100% coverage) with GenBank accessions of P. minor from California, Arkansas, and China (18S rRNA: JN123365; 28S D2-D3: JN123395; ITS1 rDNA: GU645811). In a pathogenicity test, five sweet onion seeds var. Pirate were planted (one per pot) in 11.5-cm-diameter polyethylene pots containing 1,000 cm 3 of equal parts of pasteurized field soil and sand, and then inoculated with 1,000 fresh P. minor . Plants were grown for 9 wk in a greenhouse at 25 ± 2°C prior to extraction of nematodes from soil. Plant roots were abbreviated and final population density of P. minor was 2,856 ± 104 per pot (285 nematodes/100 cm 3 of soil) confirming the nematode parasitism on onion. To our knowledge, this is the first report of P. minor parasitizing onion in Georgia. Stubby-root nematode ( Paratrichodorus sp.) has already been reported on corn, St. Augustine grass, and switchgrass in Georgia (Heald and Perry, 1969; Davis and Timper, 2000; Mekete et al., 2011). In the U.S.A, P. minor is known to occur on diverse crops in most of the states (Decraemer, 1995; CABI/EPPO, 2002). A survey of vegetable-producing areas in Georgia is currently under investigation to determine the distribution of this economically important nematode species. Figure 1 Damage symptoms caused by stubby-root nematode Paratrichodorus minor on sweet onion in Georgia. A large area of stunted and chlorotic plant foliage (A); Infested seedlings with abbreviated roots and necrotic leaf tips (B). Figure 2 Light microscopy micrographs showing morphological characters of stubby-root nematode, Paratrichodorus minor . Entire body (A), anterior end (B), and posterior region (C) of female nematode.
"Corrigendum to: Evaluation of summer and winter cover crops for variations in host suitability for Meloidogyne incognita, M. arenaria and M. javanica, Nematology 24 (2022) 841-854 (DOI: 10.1163/15685411-bja10172)" published on 24 Feb 2023 by Brill.
Meloidogyne floridensis, also known as the peach root-knot nematode (RKN), is a new emerging species found to break crop host-resistance to M. incognita (Stanley et al. 2009). It was first described from Florida (Handoo et al. 2004) parasitizing M. incognita-resistant rootstock cultivars of peach (Prunus persica), and tomato (Solanum lycopersicum) (Church 2005). The nematode has recently been reported in California's almond orchards (Westphal et al. 2019) and peach rootstock (cv. Guardian) in South Carolina (Reighard et al. 2019). In a 2018 survey of vegetable fields sampled randomly in South Georgia, RKN was found with a high density (5,264 second-stage juveniles (J2)/100 cm3 of soil) from a tomato field in Ware County, GA. The soil sample consist of 30 soil cores sampled at 20-cm depth across the field in a zig-zag motion. To perform Koch's postulate, 2,000 eggs from a single egg-mass culture were inoculated into deepots filled with mixture of sand and sterilized field soil (1:1 v/v) and grown with tomato cv. Rutgers for 60 days in the greenhouse. A reproduction factor of 21.1 ± 6.1 was obtained confirming the nematode parasitism on tomato (Fig. 1S). For molecular identification, DNA was extracted by smashing three individual females isolated from the galled roots in 50 µl sterile distilled water, followed by a freeze-thaw (95°C, 1 min). Results of PCR analyzes by species-specific primers (Fjav/Rjav, Finc/Rinc and Far/Rar) did not detect the nematode species (Zijlstra et al. 2000). PCR products were obtained and sequenced from two primer sets consisting of the forward NAD5F2 (5'-TATTTTTTGTTTGAGATATATTAG-3') and the reverse NAD5R1 (5'-CGTGAATCTTGATTTTCCATTTTT-3') for amplification of a fragment of the NADH dehydrogenase subunit 5 (NADH5) gene (Janssen et al. 2016), and the forward TRANH (5'-TGAATTTTTTATTGTGATTAA-3') and the reverse MRH106 (5'-AATTTCTAAAGACTTTTCTTAGT-3') for amplification covering a portion of the cytochrome c oxidase subunit II (COII) and large subunit 16SrDNA (16S) gene (Stanton et al. 1997). DNA sequence of NADH5 gene fragment (accession no. MT795954) was 100% identical (532/532 bp) with a M. floridensis isolate from California and South Carolina (accession no. MH729181 and MN072363), while fragment of the COII and 16S genes (accession no. MT787563) was 99.76% identical (421/422 bp) with an isolate from Florida (accession no. DQ228697). The nematode females were also used for morphometric and perennial pattern analysis. Several micrographs with the inverted microscope (ZEISS Axio Vert.A1, Germany) and camera (ZEISS Axiocam 305 color, Germany) were taken from ten J2s for mean, standard deviation and range of body length: 362.7 ± 11.2 (340.4-379) µm, maximum body width: 15 ± 1.3 (12.4-16.4) µm, stylet length: 12.3 ± 1.3 (9.5-14) µm, hyaline tail terminus: 8.9 ± 1.1 (7.5-10.9) µm and tail length: 35.7 ± 4.4 (28.5-39.5) µm. Morphological measurements and configuration of perineal patterns (Fig. 2S) were comparable to previous reports of M. floridensis isolates from Florida (Handoo et al. 2004; Stanley et al. 2009). To the best of our knowledge, this is the first report of M. floridensis in Georgia as the fourth state in the USA after South Carolina, California and Florida. This nematode has been reported to parasitize several vegetable crops, including cucumber, eggplant, tomato, snap bean and squash. Furthermore, RKN resistant cultivars of tomato (harboring Mi-1 gene), pepper (harboring N gene), corn cv. Mp-710 and tobacco cv. NC 95 have been found susceptible to M. floridensis (Stanley et al. 2009), making it a serious threat.
The use of plasticulture systems, which consist of raised beds, plastic mulch, and drip irrigation, for watermelon production has increased in the Southern United States in recent decades. The root-knot nematode (RKN), Meloidogyne incognita, is a significant pathogen of watermelon production in plasticulture systems and can cause varying levels of yield loss depending on the nematode population density if not properly controlled. A few new nonfumigant nematicides (fluensulfone, fluazaindolizine, and fluopyram) have emerged in the last decade to help manage RKNs. A 2-year field study was conducted to examine the impact of different rates, application timing (i.e., days before transplanting, at transplanting, and days after transplanting), and combinations of these new nematicides and an older one (oxamyl) in control of RKN in watermelon cultivar Fascination. The nematicide treatments, except for a single-time application of oxamyl in 2019 and 2020, significantly reduced root galling compared with the untreated check. Similarly, all treatments, except a single application of oxamyl in 2020, resulted in a lower soil population level of M. incognita than the untreated check. All nematicide treatments, except a single application of fluensulfone and a two-time application of fluopyram at a half-recommended rate, increased fruit yields when compared with the untreated check. Overall, the drip application of new chemistries, known as 3-F nematicides, has been shown to be a useful option for RKN management in watermelon. At-planting application of fluazaindolizine or fluopyram and two-time applications of oxamyl based on the manufacturer's recommended rate show potential to prevent crop loss.
