The erythroid-enriched transcription factor NF-E2 is composed of two subunits, p45 and p18, the former of which is mainly expressed in the hematopoietic system. We have isolated and characterized the mouse p45 NF-E2 gene; we show here that, similar to the human gene, the mouse gene has two alternative promoters, which are differentially active during development and in different hematopoietic cells. Transcripts from the distal promoter are present in both erythroid and myeloid cells; however, transcripts from an alternative proximal 1b promoter, lying in the first intron, are abundant in erythroid cells, but barely detectable in myeloid cells. During development, both transcripts are detectable in yolk sac, fetal liver, and bone marrow. Transfection experiments show that proximal promoter 1b has a strong activity in erythroid cells, which is completely dependent on the integrity of a palindromic GATA-1 binding site. In contrast, the distal promoter 1a is not active in this assay. When the promoter 1b is placed 3′ to the promoter 1a and reporter gene, in an arrangement that resembles the natural one, it acts as an enhancer to stimulate the activity of the upstream promoter la. The erythroid-enriched transcription factor NF-E2 is composed of two subunits, p45 and p18, the former of which is mainly expressed in the hematopoietic system. We have isolated and characterized the mouse p45 NF-E2 gene; we show here that, similar to the human gene, the mouse gene has two alternative promoters, which are differentially active during development and in different hematopoietic cells. Transcripts from the distal promoter are present in both erythroid and myeloid cells; however, transcripts from an alternative proximal 1b promoter, lying in the first intron, are abundant in erythroid cells, but barely detectable in myeloid cells. During development, both transcripts are detectable in yolk sac, fetal liver, and bone marrow. Transfection experiments show that proximal promoter 1b has a strong activity in erythroid cells, which is completely dependent on the integrity of a palindromic GATA-1 binding site. In contrast, the distal promoter 1a is not active in this assay. When the promoter 1b is placed 3′ to the promoter 1a and reporter gene, in an arrangement that resembles the natural one, it acts as an enhancer to stimulate the activity of the upstream promoter la. nuclear factor erythroid 2 locus control region mouse erythroleukemia cell human erythroleukemia cell reverse transcription polymerase chain reaction tymidine kinase erythroid Kruppel-like factor nucleotide(s) NF-E21 is a transcription factor that was originally identified through its ability to interact, in vitro, with the porphobilinogen deaminase promoter and with critical functional elements of the β-globin locus control region (LCR) (1.Mignotte V. Wall L. deBoer E. Grosveld F. Romeo P.H. Nucleic Acids Res. 1989; 17: 37-54Crossref PubMed Scopus (216) Google Scholar, 2.Ney P.A. Sorrentino B.P. McDonagh K.T. Nienhuis A.W. Genes Dev. 1990; 4: 993-1006Crossref PubMed Scopus (209) Google Scholar, 3.Talbot D. Grosveld F. EMBO J. 1991; 10: 1391-1398Crossref PubMed Scopus (180) Google Scholar). NF-E2 recognizes the extended DNA sequenceGCTGA(G/C)TCA, which includes the core symmetric AP-1 motif, as well as other non consensus sequences (4.Lecine P. Blank V. Shivdasani R. J. Biol. Chem. 1998; 273: 7572-7578Abstract Full Text Full Text PDF PubMed Scopus (57) Google Scholar, 5.Kataoka K. Noda M. Nishizawa M. Mol. Cell. Biol. 1994; 14: 700-712Crossref PubMed Google Scholar, 6.Deveaux S. Cohen-Kaminsky S. Shivdasani R.A. Andrews N.C. Filipe A. Kuzniak I. Orkin S.H. Romeo P.-H. Mignotte V. EMBO. J. 1997; 16: 5654-5661Crossref PubMed Scopus (75) Google Scholar); these recognition motifs are present in several genes involved in the heme-synthetic pathway in erythroblasts and in genes expressed in megakaryocytes.NF-E2 is an obligate heterodimer between a 45-kDa polypeptide (p45 NF-E2) (7.Andrews N.C. Erdjument-Bromage H. Davidson M.B. Tempst P. Orkin S.H. Nature. 1993; 362: 722-728Crossref PubMed Scopus (565) Google Scholar), predominantly expressed in the hematopoietic system, and one of the widely expressed ≅18-kDa proteins (p18/Maf-K, Maf-G, and Maf-F), belonging to the Maf family (8.Andrews N.C. Kotkow K.J. Ney P.A. Erdjument-Bromage H. Tempst P. Orkin S.H. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 11488-11492Crossref PubMed Scopus (239) Google Scholar, 9.Ney P.A. Andrews N.C. Jane S.M. Safer B. Purucker M.E. Weremowicz S. Morton C.C. Goff S.C. Orkin S.H. Nienhuis A.W. Mol. Cell. Biol. 1993; 13: 5604-5612Crossref PubMed Scopus (162) Google Scholar, 10.Igarashi K. Kataoka K. Itoh K. Hayashi N. Nishizawa M. Yamamoto M. Nature. 1994; 367: 568-572Crossref PubMed Scopus (396) Google Scholar, 11.Kataoka K. Igarashi K. Itoh K. Fujiwara K.T. Noda M. Yamamoto M. Nishizawa M. Mol. Cell. Biol. 1995; 15: 2180-2190Crossref PubMed Scopus (199) Google Scholar, 12.Blank V. Kim M.J. Andrews N.C. Blood. 1997; 89: 3925-3935Crossref PubMed Google Scholar, 13.Fujiwara K.T. Kataoka K. Nishizawa M. Oncogene. 1993; 8: 2371-2380PubMed Google Scholar, 14.Igarashi K. Itoh K. Motohashi H. Hayashi N. Matuzaki Y. Nakauchi H. Nishizawa M. Yamamoto M. J. Biol. Chem. 1995; 270: 7615-7624Abstract Full Text Full Text PDF PubMed Scopus (104) Google Scholar). Both p45 and p18 subunits belong to the basic leucine zipper family of transcription factors. Five p45 NF-E2-related polypeptides have also been identified (15.Chan J.Y. Han X.-L. Kan Y.W. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 11371-11375Crossref PubMed Scopus (293) Google Scholar, 16.Caterina J.J. Donze D. Sun C.-W. Ciavatta D.J. Townes T.M. Nucleic Acids Res. 1994; 22: 2383-2391Crossref PubMed Scopus (123) Google Scholar, 17.Moi P. Chan K. Asunis I. Cao A. Kan Y.W. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 9926-9930Crossref PubMed Scopus (1187) Google Scholar, 18.Chui D.H.K. Tang W. Orkin S.H. Biochem. Biophys. Res. Commun. 1995; 209: 40-46Crossref PubMed Scopus (61) Google Scholar, 19.Itoh K. Igarashi K. Hayashi N. Nishizawa M. Yamamoto M. Mol. Cell. Biol. 1995; 15: 4184-4193Crossref PubMed Scopus (356) Google Scholar, 20.Oyake T. Itoh K. Motohashi H. Hayashi N. Hoshino H. Nishizawa M. Yamamoto M. Igarashi K. Mol. Cell. Biol. 1996; 16: 6083-6095Crossref PubMed Scopus (514) Google Scholar, 21.Igarashi K. Hoshino H. Muto A. Suwabe N Nishikawa S. Nakauchi H. Yamamoto M. J. Biol. Chem. 1998; 273: 11783-11790Abstract Full Text Full Text PDF PubMed Scopus (175) Google Scholar). Given the ability of large and small subunits to heterodimerize and to recognize the extended NF-E2 binding motif or variants of it, there is an enormous potential for regulation of genes containing NF-E2 sites.Of the several large and small subunits of the NF-E2 “family,” p45 NF-E2 is the only one that shows highly restricted expression, being detected primarily within the hematopoietic lineage, in erythroid, megakaryocytic, and mast cells, and possibly neutrophils (7.Andrews N.C. Erdjument-Bromage H. Davidson M.B. Tempst P. Orkin S.H. Nature. 1993; 362: 722-728Crossref PubMed Scopus (565) Google Scholar, 9.Ney P.A. Andrews N.C. Jane S.M. Safer B. Purucker M.E. Weremowicz S. Morton C.C. Goff S.C. Orkin S.H. Nienhuis A.W. Mol. Cell. Biol. 1993; 13: 5604-5612Crossref PubMed Scopus (162) Google Scholar,22.Romeo P.-H. Prandini M.-H. Joulin V. Mignotte V. Prenant M. Vainchenker W. Marguerie G. Uzan G. Nature. 1990; 344: 447-449Crossref PubMed Scopus (321) Google Scholar, 23.Toki T. Itoh J. Arai K. Kitazawa J. Yokoyama M. Igarashi K. Yamamoto M. Ito E. Biochem. Biophys. Res. Commun. 1996; 219: 760-765Crossref PubMed Scopus (18) Google Scholar, 24.Chan J.Y. Han X.-L. Kan Y.W. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 11366-11370Crossref PubMed Scopus (109) Google Scholar). In erythroid cell lines, such as mouse erythroleukemia cells (MEL), NF-E2 increases when erythroid differentiation is induced (1.Mignotte V. Wall L. deBoer E. Grosveld F. Romeo P.H. Nucleic Acids Res. 1989; 17: 37-54Crossref PubMed Scopus (216) Google Scholar,25.Ney P.A. Sorrentino B.P. Lowrey C.H. Nienhuis A.W. Nucleic Acids Res. 1990; 18: 6011-6017Crossref PubMed Scopus (113) Google Scholar). Secondary expression sites include intestine, lung, and placenta (7.Andrews N.C. Erdjument-Bromage H. Davidson M.B. Tempst P. Orkin S.H. Nature. 1993; 362: 722-728Crossref PubMed Scopus (565) Google Scholar, 24.Chan J.Y. Han X.-L. Kan Y.W. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 11366-11370Crossref PubMed Scopus (109) Google Scholar). The restricted expression of p45 NF-E2 suggests a critical role of this protein in at least some hematopoietic lineages. Indeed, homozygous inactivation of the p45 NF-E2 gene in the mouse (by homologous recombination) leads to a fatal hemorrhagic disease due to faulty megakaryocytic maturation and lack of platelets (4.Lecine P. Blank V. Shivdasani R. J. Biol. Chem. 1998; 273: 7572-7578Abstract Full Text Full Text PDF PubMed Scopus (57) Google Scholar). However, in the same mice, only minor erythroid cell defects were observed (26.Shivdasani R.A. Rosenblatt M.F. Zucker-Franklin D. Jackson C.W. Hunt P. Saris C.J. Orkin S.H. Cell. 1995; 81: 695-704Abstract Full Text PDF PubMed Scopus (614) Google Scholar,27.Shivdasani R.A. Orkin S.H. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 8690-8694Crossref PubMed Scopus (182) Google Scholar), suggesting some functional complementation in the erythroid lineage by other related genes (possibly Nrf-1, but not Nrf-2) (28.Kuroha T. Takahashi S. Komeno T. Itoh J. Nagasawa T. Yamamoto M. J. Biochem. (Tokyo). 1998; 123: 376-379Crossref PubMed Scopus (36) Google Scholar,29.Martin F. van Deursen J.M. Shivdasani R.A. Jackson C.W. Troutman A.G. Ney P.A. Blood. 1998; 91: 3459-3466Crossref PubMed Google Scholar).Evidence that p45 NF-E2 deficiency might affect at least a subset of erythroid cells is provided, however, by the lack of β-globin expression in a MEL cell line in which the endogenous p45 gene is inactive due to a retroviral integration; forced expression of p45-cDNA in these cells restores β-globin expression (30.Lu S.J. Rowan S. Bani M.R. Ben-David Y. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 8398-8402Crossref PubMed Scopus (123) Google Scholar,31.Kotkow K.J. Orkin S.H. Mol. Cell. Biol. 1995; 15: 4640-4647Crossref PubMed Scopus (148) Google Scholar).So far, the transcriptional regulation of p45 NF-E2 expression has not been extensively investigated. Recently, it was reported that two cDNA isoforms of p45 NF-E2 exist in human cells, resulting from transcription from two alternative promoters and differential splicing of the transcripts into the common second exon RNA. As the transcript from the distal promoter/first exon is more abundant in adult erythroid cells, and the transcript from the proximal promoter/first exon is predominant in fetal cells, they were termed “adult” and “fetal”, respectively (32.Pischedda C. Cocco S. Melis A. Marini M.G. Kan Y.W. Cao A. Moi P. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 3511-3515Crossref PubMed Scopus (23) Google Scholar).In this work, we have investigated the presence in the mouse p45 NF-E2 gene of similar promoters and studied the regulation of their expression by RNA analysis during development and by transfection. The distal promoter/first exon (1a) corresponds to the human adult promoter (32.Pischedda C. Cocco S. Melis A. Marini M.G. Kan Y.W. Cao A. Moi P. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 3511-3515Crossref PubMed Scopus (23) Google Scholar) and drives the expression of the previously described mouse mRNA (7.Andrews N.C. Erdjument-Bromage H. Davidson M.B. Tempst P. Orkin S.H. Nature. 1993; 362: 722-728Crossref PubMed Scopus (565) Google Scholar); the proximal mouse promoter/first exon (1b), lies in the first intron, and corresponds to the human fetal promoter (32.Pischedda C. Cocco S. Melis A. Marini M.G. Kan Y.W. Cao A. Moi P. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 3511-3515Crossref PubMed Scopus (23) Google Scholar). NF-E21 is a transcription factor that was originally identified through its ability to interact, in vitro, with the porphobilinogen deaminase promoter and with critical functional elements of the β-globin locus control region (LCR) (1.Mignotte V. Wall L. deBoer E. Grosveld F. Romeo P.H. Nucleic Acids Res. 1989; 17: 37-54Crossref PubMed Scopus (216) Google Scholar, 2.Ney P.A. Sorrentino B.P. McDonagh K.T. Nienhuis A.W. Genes Dev. 1990; 4: 993-1006Crossref PubMed Scopus (209) Google Scholar, 3.Talbot D. Grosveld F. EMBO J. 1991; 10: 1391-1398Crossref PubMed Scopus (180) Google Scholar). NF-E2 recognizes the extended DNA sequenceGCTGA(G/C)TCA, which includes the core symmetric AP-1 motif, as well as other non consensus sequences (4.Lecine P. Blank V. Shivdasani R. J. Biol. Chem. 1998; 273: 7572-7578Abstract Full Text Full Text PDF PubMed Scopus (57) Google Scholar, 5.Kataoka K. Noda M. Nishizawa M. Mol. Cell. Biol. 1994; 14: 700-712Crossref PubMed Google Scholar, 6.Deveaux S. Cohen-Kaminsky S. Shivdasani R.A. Andrews N.C. Filipe A. Kuzniak I. Orkin S.H. Romeo P.-H. Mignotte V. EMBO. J. 1997; 16: 5654-5661Crossref PubMed Scopus (75) Google Scholar); these recognition motifs are present in several genes involved in the heme-synthetic pathway in erythroblasts and in genes expressed in megakaryocytes. NF-E2 is an obligate heterodimer between a 45-kDa polypeptide (p45 NF-E2) (7.Andrews N.C. Erdjument-Bromage H. Davidson M.B. Tempst P. Orkin S.H. Nature. 1993; 362: 722-728Crossref PubMed Scopus (565) Google Scholar), predominantly expressed in the hematopoietic system, and one of the widely expressed ≅18-kDa proteins (p18/Maf-K, Maf-G, and Maf-F), belonging to the Maf family (8.Andrews N.C. Kotkow K.J. Ney P.A. Erdjument-Bromage H. Tempst P. Orkin S.H. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 11488-11492Crossref PubMed Scopus (239) Google Scholar, 9.Ney P.A. Andrews N.C. Jane S.M. Safer B. Purucker M.E. Weremowicz S. Morton C.C. Goff S.C. Orkin S.H. Nienhuis A.W. Mol. Cell. Biol. 1993; 13: 5604-5612Crossref PubMed Scopus (162) Google Scholar, 10.Igarashi K. Kataoka K. Itoh K. Hayashi N. Nishizawa M. Yamamoto M. Nature. 1994; 367: 568-572Crossref PubMed Scopus (396) Google Scholar, 11.Kataoka K. Igarashi K. Itoh K. Fujiwara K.T. Noda M. Yamamoto M. Nishizawa M. Mol. Cell. Biol. 1995; 15: 2180-2190Crossref PubMed Scopus (199) Google Scholar, 12.Blank V. Kim M.J. Andrews N.C. Blood. 1997; 89: 3925-3935Crossref PubMed Google Scholar, 13.Fujiwara K.T. Kataoka K. Nishizawa M. Oncogene. 1993; 8: 2371-2380PubMed Google Scholar, 14.Igarashi K. Itoh K. Motohashi H. Hayashi N. Matuzaki Y. Nakauchi H. Nishizawa M. Yamamoto M. J. Biol. Chem. 1995; 270: 7615-7624Abstract Full Text Full Text PDF PubMed Scopus (104) Google Scholar). Both p45 and p18 subunits belong to the basic leucine zipper family of transcription factors. Five p45 NF-E2-related polypeptides have also been identified (15.Chan J.Y. Han X.-L. Kan Y.W. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 11371-11375Crossref PubMed Scopus (293) Google Scholar, 16.Caterina J.J. Donze D. Sun C.-W. Ciavatta D.J. Townes T.M. Nucleic Acids Res. 1994; 22: 2383-2391Crossref PubMed Scopus (123) Google Scholar, 17.Moi P. Chan K. Asunis I. Cao A. Kan Y.W. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 9926-9930Crossref PubMed Scopus (1187) Google Scholar, 18.Chui D.H.K. Tang W. Orkin S.H. Biochem. Biophys. Res. Commun. 1995; 209: 40-46Crossref PubMed Scopus (61) Google Scholar, 19.Itoh K. Igarashi K. Hayashi N. Nishizawa M. Yamamoto M. Mol. Cell. Biol. 1995; 15: 4184-4193Crossref PubMed Scopus (356) Google Scholar, 20.Oyake T. Itoh K. Motohashi H. Hayashi N. Hoshino H. Nishizawa M. Yamamoto M. Igarashi K. Mol. Cell. Biol. 1996; 16: 6083-6095Crossref PubMed Scopus (514) Google Scholar, 21.Igarashi K. Hoshino H. Muto A. Suwabe N Nishikawa S. Nakauchi H. Yamamoto M. J. Biol. Chem. 1998; 273: 11783-11790Abstract Full Text Full Text PDF PubMed Scopus (175) Google Scholar). Given the ability of large and small subunits to heterodimerize and to recognize the extended NF-E2 binding motif or variants of it, there is an enormous potential for regulation of genes containing NF-E2 sites. Of the several large and small subunits of the NF-E2 “family,” p45 NF-E2 is the only one that shows highly restricted expression, being detected primarily within the hematopoietic lineage, in erythroid, megakaryocytic, and mast cells, and possibly neutrophils (7.Andrews N.C. Erdjument-Bromage H. Davidson M.B. Tempst P. Orkin S.H. Nature. 1993; 362: 722-728Crossref PubMed Scopus (565) Google Scholar, 9.Ney P.A. Andrews N.C. Jane S.M. Safer B. Purucker M.E. Weremowicz S. Morton C.C. Goff S.C. Orkin S.H. Nienhuis A.W. Mol. Cell. Biol. 1993; 13: 5604-5612Crossref PubMed Scopus (162) Google Scholar,22.Romeo P.-H. Prandini M.-H. Joulin V. Mignotte V. Prenant M. Vainchenker W. Marguerie G. Uzan G. Nature. 1990; 344: 447-449Crossref PubMed Scopus (321) Google Scholar, 23.Toki T. Itoh J. Arai K. Kitazawa J. Yokoyama M. Igarashi K. Yamamoto M. Ito E. Biochem. Biophys. Res. Commun. 1996; 219: 760-765Crossref PubMed Scopus (18) Google Scholar, 24.Chan J.Y. Han X.-L. Kan Y.W. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 11366-11370Crossref PubMed Scopus (109) Google Scholar). In erythroid cell lines, such as mouse erythroleukemia cells (MEL), NF-E2 increases when erythroid differentiation is induced (1.Mignotte V. Wall L. deBoer E. Grosveld F. Romeo P.H. Nucleic Acids Res. 1989; 17: 37-54Crossref PubMed Scopus (216) Google Scholar,25.Ney P.A. Sorrentino B.P. Lowrey C.H. Nienhuis A.W. Nucleic Acids Res. 1990; 18: 6011-6017Crossref PubMed Scopus (113) Google Scholar). Secondary expression sites include intestine, lung, and placenta (7.Andrews N.C. Erdjument-Bromage H. Davidson M.B. Tempst P. Orkin S.H. Nature. 1993; 362: 722-728Crossref PubMed Scopus (565) Google Scholar, 24.Chan J.Y. Han X.-L. Kan Y.W. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 11366-11370Crossref PubMed Scopus (109) Google Scholar). The restricted expression of p45 NF-E2 suggests a critical role of this protein in at least some hematopoietic lineages. Indeed, homozygous inactivation of the p45 NF-E2 gene in the mouse (by homologous recombination) leads to a fatal hemorrhagic disease due to faulty megakaryocytic maturation and lack of platelets (4.Lecine P. Blank V. Shivdasani R. J. Biol. Chem. 1998; 273: 7572-7578Abstract Full Text Full Text PDF PubMed Scopus (57) Google Scholar). However, in the same mice, only minor erythroid cell defects were observed (26.Shivdasani R.A. Rosenblatt M.F. Zucker-Franklin D. Jackson C.W. Hunt P. Saris C.J. Orkin S.H. Cell. 1995; 81: 695-704Abstract Full Text PDF PubMed Scopus (614) Google Scholar,27.Shivdasani R.A. Orkin S.H. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 8690-8694Crossref PubMed Scopus (182) Google Scholar), suggesting some functional complementation in the erythroid lineage by other related genes (possibly Nrf-1, but not Nrf-2) (28.Kuroha T. Takahashi S. Komeno T. Itoh J. Nagasawa T. Yamamoto M. J. Biochem. (Tokyo). 1998; 123: 376-379Crossref PubMed Scopus (36) Google Scholar,29.Martin F. van Deursen J.M. Shivdasani R.A. Jackson C.W. Troutman A.G. Ney P.A. Blood. 1998; 91: 3459-3466Crossref PubMed Google Scholar). Evidence that p45 NF-E2 deficiency might affect at least a subset of erythroid cells is provided, however, by the lack of β-globin expression in a MEL cell line in which the endogenous p45 gene is inactive due to a retroviral integration; forced expression of p45-cDNA in these cells restores β-globin expression (30.Lu S.J. Rowan S. Bani M.R. Ben-David Y. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 8398-8402Crossref PubMed Scopus (123) Google Scholar,31.Kotkow K.J. Orkin S.H. Mol. Cell. Biol. 1995; 15: 4640-4647Crossref PubMed Scopus (148) Google Scholar). So far, the transcriptional regulation of p45 NF-E2 expression has not been extensively investigated. Recently, it was reported that two cDNA isoforms of p45 NF-E2 exist in human cells, resulting from transcription from two alternative promoters and differential splicing of the transcripts into the common second exon RNA. As the transcript from the distal promoter/first exon is more abundant in adult erythroid cells, and the transcript from the proximal promoter/first exon is predominant in fetal cells, they were termed “adult” and “fetal”, respectively (32.Pischedda C. Cocco S. Melis A. Marini M.G. Kan Y.W. Cao A. Moi P. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 3511-3515Crossref PubMed Scopus (23) Google Scholar). In this work, we have investigated the presence in the mouse p45 NF-E2 gene of similar promoters and studied the regulation of their expression by RNA analysis during development and by transfection. The distal promoter/first exon (1a) corresponds to the human adult promoter (32.Pischedda C. Cocco S. Melis A. Marini M.G. Kan Y.W. Cao A. Moi P. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 3511-3515Crossref PubMed Scopus (23) Google Scholar) and drives the expression of the previously described mouse mRNA (7.Andrews N.C. Erdjument-Bromage H. Davidson M.B. Tempst P. Orkin S.H. Nature. 1993; 362: 722-728Crossref PubMed Scopus (565) Google Scholar); the proximal mouse promoter/first exon (1b), lies in the first intron, and corresponds to the human fetal promoter (32.Pischedda C. Cocco S. Melis A. Marini M.G. Kan Y.W. Cao A. Moi P. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 3511-3515Crossref PubMed Scopus (23) Google Scholar). We thank M. Minuzzo and A. Ronchi for help and discussion and C. Santoro for the gift of an anti-GATA-1 antibody.
The locus control region of the β-globin gene cluster has been used previously to direct erythroid expression of globin genes from retroviral vectors for the purpose of gene therapy. Short erythroid regulatory elements represent a potentially valuable alternative to the locus control region. Among them, the GATA-1 enhancer HS2 was used to replace the retroviral enhancer within the 3′-long terminal repeat (LTR) of the retroviral vector SFCM, converting it into an erythroid-specific regulatory element. In this work, we have functionally studied an additional GATA-1 enhancer, HS1. HS1 participates in the transcriptional autoregulation of GATA-1 through an essential GATA-binding site that is footprinted in vivo. In this work we identified within HS1 a new in vivo footprinted region, and we showed that this sequence indeed binds a nuclear protein in vitro. Addition of HS1 to HS2 within the LTR of SFCM significantly improves the expression of a reporter gene. The deletion of the newly identified footprinted sequence in the retroviral construct further increases expression up to a level almost equal to that of the wild type retroviral LTR, without loss of erythroid specificity, suggesting that this sequence may act as a negative regulatory element. An improved vector backbone, MΔN, allows even better expression from the new GATA cassette. These results suggest that substantial improvement of overall expression can be achieved by the combination of multiple changes in both regulatory elements and vectors. The locus control region of the β-globin gene cluster has been used previously to direct erythroid expression of globin genes from retroviral vectors for the purpose of gene therapy. Short erythroid regulatory elements represent a potentially valuable alternative to the locus control region. Among them, the GATA-1 enhancer HS2 was used to replace the retroviral enhancer within the 3′-long terminal repeat (LTR) of the retroviral vector SFCM, converting it into an erythroid-specific regulatory element. In this work, we have functionally studied an additional GATA-1 enhancer, HS1. HS1 participates in the transcriptional autoregulation of GATA-1 through an essential GATA-binding site that is footprinted in vivo. In this work we identified within HS1 a new in vivo footprinted region, and we showed that this sequence indeed binds a nuclear protein in vitro. Addition of HS1 to HS2 within the LTR of SFCM significantly improves the expression of a reporter gene. The deletion of the newly identified footprinted sequence in the retroviral construct further increases expression up to a level almost equal to that of the wild type retroviral LTR, without loss of erythroid specificity, suggesting that this sequence may act as a negative regulatory element. An improved vector backbone, MΔN, allows even better expression from the new GATA cassette. These results suggest that substantial improvement of overall expression can be achieved by the combination of multiple changes in both regulatory elements and vectors. GATA-1 is a zinc finger transcription factor that is expressed in a subset of early multipotent and lineage-committed hematopoietic progenitors, including erythroblasts, megakaryocytes, basophils, etc. (1Weiss M.J. Orkin S.H. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 9623-9627Crossref PubMed Scopus (265) Google Scholar, 2Yamamoto M. Takahashi S. Onodera K. Muraosa Y. Engel J.D. Genes Cells. 1997; 2: 107-115Crossref PubMed Scopus (41) Google Scholar). GATA-1 regulates many transcription factors and lineage-specific genes, and its normal expression is essential for the correct development of several hematopoietic lineages, in particular the erythroid, megakaryocytic, and eosinophilic lineages (3Pevny L. Lin C.S. D'Agati V. Simon M.C. Orkin S.H. Costantini F. Development. 1995; 121: 163-172Crossref PubMed Google Scholar, 4Shivdasani R.A. Fujiwara Y. McDevitt M.A. Orkin S.H. EMBO J. 1997; 16: 3965-3973Crossref PubMed Scopus (587) Google Scholar, 5Simon M.C. Pevny L. Wiles M.V. Keller G. Costantini F. Orkin S.H. Nat. Genet. 1992; 1: 92-98Crossref PubMed Scopus (205) Google Scholar, 6Takahashi S. Onodera K. Motohashi H. Suwabe N. Hayashi N. Yanai N. Nabesima Y. Yamamoto M. J. Biol. Chem. 1997; 272: 12611-12615Abstract Full Text Full Text PDF PubMed Scopus (149) Google Scholar, 7McDevitt M.A. Shivdasani R.A. Fujiwara Y. Yang H. Orkin S.H. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 6781-6785Crossref PubMed Scopus (194) Google Scholar). The regulation of the expression of GATA-1 itself has been the subject of many investigations (7McDevitt M.A. Shivdasani R.A. Fujiwara Y. Yang H. Orkin S.H. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 6781-6785Crossref PubMed Scopus (194) Google Scholar, 8Tsai S.F. Strauss E. Orkin S.H. Genes Dev. 1991; 5: 919-931Crossref PubMed Scopus (261) Google Scholar, 9Nicolis S. Bertini C. Ronchi A. Crotta S. Lanfranco L. Moroni E. Giglioni B. Ottolenghi S. Nucleic Acids Res. 1991; 19: 5285-5291Crossref PubMed Scopus (69) Google Scholar, 10Hannon R. Evans T. Felsenfeld G. Gould H. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 3004-3008Crossref PubMed Scopus (89) Google Scholar, 11Cairns L.A. Crotta S. Minuzzo M. Moroni E. Granucci F. Nicolis S. Schiro R. Pozzi L. Giglioni B. Ricciardi-Castagnoli P. Ottolenghi S. EMBO J. 1994; 13: 4577-4586Crossref PubMed Scopus (24) Google Scholar, 12Onodera K. Takahashi S. Nishimura S. Ohta J. Motohashi H. Yomogida K. Hayashi N. Engel J.D. Yamamoto M. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 4487-4492Crossref PubMed Scopus (143) Google Scholar, 13McDevitt M.A. Fujiwara Y. Shivdasani R.A. Orkin S.H. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 7976-7981Crossref PubMed Scopus (84) Google Scholar, 14Ronchi A. Ciro M. Cairns L. Basilico L. Corbella P. Ricciardi-Castagnoli P. Cross M. Ghysdael J. Ottolenghi S. Genes Funct. 1997; 1: 245-258Crossref PubMed Scopus (20) Google Scholar, 15Vyas P. McDevitt M.A. Cantor A.B. Katz S.G. Fujiara Y. Orkin S.H. Development. 1999; 12: 2799-2811Crossref Google Scholar, 16Nishimura S. Takahashi S. Kuroha T. Suwabe N. Nagasawa T. Trainor C. Yamamoto M. Mol. Cell. Biol. 2000; 20: 713-723Crossref PubMed Scopus (100) Google Scholar). Constructs including the mouse GATA-1 promoter up to a DNase I-hypersensitive site lying at about -700 nts 1The abbreviations used are: nts, nucleotides; LTR, long terminal repeat; LCR, locus control region; DMS, dimethyl sulfate; EMSA, electrophoretic mobility shift assays; BM, bone marrow; Epo, erythropoietin; FCS, fetal calf serum; FACS, fluorescence-activated cell sorting; MEL, mouse erythroleukemia; wt, wild type; IVFP, in vivo footprinting protein; YS, yolk sac; MFI, mean fluorescence intensity; GFP, green fluorescent protein; EGFP, enhanced GFP; NGFr, nerve growth factor receptor; ts, thermosensitive. (HS2) are expressed, at low efficiency, in adult hematopoietic cells in transgenic mice but not in yolk sac cells; however, constructs including an additional more upstream site (HS1) are much more efficient and are also active in primitive hematopoietic cells (12Onodera K. Takahashi S. Nishimura S. Ohta J. Motohashi H. Yomogida K. Hayashi N. Engel J.D. Yamamoto M. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 4487-4492Crossref PubMed Scopus (143) Google Scholar, 13McDevitt M.A. Fujiwara Y. Shivdasani R.A. Orkin S.H. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 7976-7981Crossref PubMed Scopus (84) Google Scholar, 14Ronchi A. Ciro M. Cairns L. Basilico L. Corbella P. Ricciardi-Castagnoli P. Cross M. Ghysdael J. Ottolenghi S. Genes Funct. 1997; 1: 245-258Crossref PubMed Scopus (20) Google Scholar, 15Vyas P. McDevitt M.A. Cantor A.B. Katz S.G. Fujiara Y. Orkin S.H. Development. 1999; 12: 2799-2811Crossref Google Scholar, 16Nishimura S. Takahashi S. Kuroha T. Suwabe N. Nagasawa T. Trainor C. Yamamoto M. Mol. Cell. Biol. 2000; 20: 713-723Crossref PubMed Scopus (100) Google Scholar). GATA-binding sequences in HS1 and HS2 are essential for activity in a variety of constructs, suggesting GATA-1 auto-regulation (8Tsai S.F. Strauss E. Orkin S.H. Genes Dev. 1991; 5: 919-931Crossref PubMed Scopus (261) Google Scholar, 9Nicolis S. Bertini C. Ronchi A. Crotta S. Lanfranco L. Moroni E. Giglioni B. Ottolenghi S. Nucleic Acids Res. 1991; 19: 5285-5291Crossref PubMed Scopus (69) Google Scholar, 10Hannon R. Evans T. Felsenfeld G. Gould H. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 3004-3008Crossref PubMed Scopus (89) Google Scholar, 14Ronchi A. Ciro M. Cairns L. Basilico L. Corbella P. Ricciardi-Castagnoli P. Cross M. Ghysdael J. Ottolenghi S. Genes Funct. 1997; 1: 245-258Crossref PubMed Scopus (20) Google Scholar, 15Vyas P. McDevitt M.A. Cantor A.B. Katz S.G. Fujiara Y. Orkin S.H. Development. 1999; 12: 2799-2811Crossref Google Scholar, 16Nishimura S. Takahashi S. Kuroha T. Suwabe N. Nagasawa T. Trainor C. Yamamoto M. Mol. Cell. Biol. 2000; 20: 713-723Crossref PubMed Scopus (100) Google Scholar); however, a GATA-1 transgenic construct is active in mice lacking the endogenous GATA-1 gene, suggesting that other members of the GATA family of transcription factors (possibly GATA-2) may control GATA-1 transcription (13McDevitt M.A. Fujiwara Y. Shivdasani R.A. Orkin S.H. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 7976-7981Crossref PubMed Scopus (84) Google Scholar, 16Nishimura S. Takahashi S. Kuroha T. Suwabe N. Nagasawa T. Trainor C. Yamamoto M. Mol. Cell. Biol. 2000; 20: 713-723Crossref PubMed Scopus (100) Google Scholar). As GATA-2 is expressed in a wider range of cell types than GATA-1, this implies that other regulatory elements are necessary for appropriate GATA-1 regulation. Sequences relevant for this additional level of regulation have not yet been fully characterized. Regulatory elements of erythroid genes have been employed in retroviral vectors to express, in model systems, globin genes for therapeutic purposes. In particular, the locus control region (LCR) of the human β-globin cluster, which confers high level, position-independent, erythroid expression of globin genes, gave encouraging initial results (17May C. Rivella S. Callegari J. Heller G. Gaensler K.M. Luzzatto L. Sadelain M. Nature. 2000; 406: 82-86Crossref PubMed Scopus (493) Google Scholar, 18Pawliuk R. Westerman K.A. Fabry M.E. Payen E. Tighe R. Bouhassira E.E. Acharya S.A. Ellis J. London I.M. Eaves C.J. Humphries R.K. Beuzard Y. Nagel R.L. Leboulch P. Science. 2001; 294: 2368-2371Crossref PubMed Scopus (458) Google Scholar). More recently, short functional erythroid enhancers, such as the α-globin HS40 enhancer, the 5-aminolevulinate synthase intron 8, and the GATA-1 HS2 enhancer have been used instead of the β-globin LCR, in various combinations with different erythroid promoters (β and ζ globin, spectrin and ankyrin) to drive gene expression in erythroid cells (19Grande A. Piovani B. Aiuti A. Ottolenghi S. Mavilio F. Ferrari G. Blood. 1999; 93 (and references therein): 3276-3285Crossref PubMed Google Scholar, 20Moreau-Gaudry F. Xia P. Jiang G. Perelman N.P. Bauer G. Ellis J. Surinya K.H. Mavilio F. Shen C.K. Malik P. Blood. 2001; 98 (and references therein): 2664-2672Crossref PubMed Scopus (101) Google Scholar, 21Lotti F. Menguzzato E. Rossi C. Naldini L. Ailles L. Mavilio F. Ferrari G. J. Virol. 2002; 76 (and references therein): 3996-4007Crossref PubMed Scopus (45) Google Scholar, 22Sabatino D.E. Seidel N.E. Aviles-Mendoza G.J. Cline A.P. Anderson S.M. Gallagher P.G. Bodine D.M. Proc. Natl. Acad. Sci. U. S. A. 2000; 97 (and references therein): 13294-13299Crossref PubMed Scopus (41) Google Scholar). These short elements might thus provide a valuable alternative to LCR for the development of new vectors (23Russell D. Blood. 2001; 98: 2595-2596Crossref Google Scholar). In this context, the characterization of additional control elements conferring high levels of specific expression is essential for vector optimization. Among the enhancers studied, the GATA-1 HS2 element showed significant activity both in retroviral and lentiviral vectors (19Grande A. Piovani B. Aiuti A. Ottolenghi S. Mavilio F. Ferrari G. Blood. 1999; 93 (and references therein): 3276-3285Crossref PubMed Google Scholar, 20Moreau-Gaudry F. Xia P. Jiang G. Perelman N.P. Bauer G. Ellis J. Surinya K.H. Mavilio F. Shen C.K. Malik P. Blood. 2001; 98 (and references therein): 2664-2672Crossref PubMed Scopus (101) Google Scholar, 21Lotti F. Menguzzato E. Rossi C. Naldini L. Ailles L. Mavilio F. Ferrari G. J. Virol. 2002; 76 (and references therein): 3996-4007Crossref PubMed Scopus (45) Google Scholar). In this work we have further characterized functional sequences of the GATA-1 HS1 enhancer. By adding HS1 to HS2 within the retroviral LTR and by deleting an inhibitory sequence within HS1, we obtained retroviruses that express downstream reporter genes at similar efficiencies as those retaining the wild type LTR, without loss of erythroid specificity. In Vivo Footprinting—In vivo DMS treatment of cells, DNA extraction, and piperidine treatment were according to Ref. 24Becker P.B. Weih F. Schutz G. Methods Enzymol. 1993; 218: 568-587Crossref PubMed Scopus (8) Google Scholar; ligation-mediated PCR was according to Ref. 25Quivy J.P. Becker P.B. Nucleic Acids Res. 1993; 21: 2779-2781Crossref PubMed Scopus (22) Google Scholar. Primers used are as follows: P1 from nt 2 to 25 (GATCCAAGGAAGAGAGGACATTAG); P2 from nt 13 to 36 (AGAGGACATTAGCATGGGTCTCAA); and P3 from nt 27 to 50 (GGGTCTCAAATGGAAGCCTGACAG) of HS1 (14Ronchi A. Ciro M. Cairns L. Basilico L. Corbella P. Ricciardi-Castagnoli P. Cross M. Ghysdael J. Ottolenghi S. Genes Funct. 1997; 1: 245-258Crossref PubMed Scopus (20) Google Scholar) in the sense orientation. Electrophoretic Mobility Shift Assay (EMSA)—Nuclear extracts were prepared as in Refs. 26Dignam J.D. Lebovitz R.M. Roeder R.G. Nucleic Acids Res. 1983; 11: 1475-1489Crossref PubMed Scopus (9159) Google Scholar and 27Ronchi A. Nicolis S. Santoro C. Ottolenghi S. Nucleic Acids Res. 1989; 17: 10231-10241Crossref PubMed Scopus (39) Google Scholar; in vitro binding and gel electrophoresis were as in Refs. 27Ronchi A. Nicolis S. Santoro C. Ottolenghi S. Nucleic Acids Res. 1989; 17: 10231-10241Crossref PubMed Scopus (39) Google Scholar and 28Singh H. Sen R. Baltimore D. Sharp P.A. Nature. 1986; 319: 154-158Crossref PubMed Scopus (624) Google Scholar. The sequences of the oligonucleotides used are as follows: +46+96 wt, 5′-CTGACAGAGAAGACGCTTCAACCCGGACACCCCACCCCCGCCTGCAATGGG-3′; Δ59-69, 5′-CTGACAGAGAAGAGGACACCCCACCCCCGCCTGCAATGGG-3′; core mut, 5′-CTGACAGAGAAGACGCTTTAATTTGGACACCCCACCCCCGCCTGCAATGGG-3′; 5′mut, 5′-CTGACAGTTAATTTGCTTCAACCCGGACACCCCACCCCCGCCTGCAATGGG-3′; +81+111, 5′-CCCGCCTGCAATGGGCTCCCCCAAGCCTAG-3′; and β-globin CACC box, 5′-CTTGGGGGCCCCTCCCCCACACTATCTCAA-3′. The sequence in boldface type in the wild type oligonucleotide corresponds to the in vivo footprinted region (see “Results”) and is deleted in the Δ59-69oligo. Underlined nucleotides represent the mutated sites. Retroviral Constructs—The retroviral vectors SFCM, containing an intact Moloney enhancer and its derivative Δ·SFCM (in which the 3′-LTR enhancer is deleted), have been described previously (19Grande A. Piovani B. Aiuti A. Ottolenghi S. Mavilio F. Ferrari G. Blood. 1999; 93 (and references therein): 3276-3285Crossref PubMed Google Scholar). The HS2 site of the mouse GATA-1 gene was inserted in place of the deleted enhancer into the Δ·SFCM vector to generate GATA·SFCM (19Grande A. Piovani B. Aiuti A. Ottolenghi S. Mavilio F. Ferrari G. Blood. 1999; 93 (and references therein): 3276-3285Crossref PubMed Google Scholar), here renamed as HS2·SFCM. Additional constructs were generated by inserting appropriate HS1 fragments into either Δ·SFCM or HS2·SFCM. The genomic 461-nt BamHI BglII HS1 fragment (14Ronchi A. Ciro M. Cairns L. Basilico L. Corbella P. Ricciardi-Castagnoli P. Cross M. Ghysdael J. Ottolenghi S. Genes Funct. 1997; 1: 245-258Crossref PubMed Scopus (20) Google Scholar) was modified with XhoI linkers and cloned into the compatible SalI site in the Δ·SFCM LTR polylinker, 10 nt upstream to the SnaBI site where HS2 was originally cloned. In the constructs carrying both HS1 and HS2, HS1 was inserted in the same SalI site into the HS2·SFCM vector to generate HS1·HS2·SFCM. All HS1 mutants (see the above oligonucleotides for mutations) were generated by PCR and sequenced to confirm the mutation. In the HS1GATA-·HS2·SFCM vector the HS1 GATA-1-binding site at positions 130-136 (14Ronchi A. Ciro M. Cairns L. Basilico L. Corbella P. Ricciardi-Castagnoli P. Cross M. Ghysdael J. Ottolenghi S. Genes Funct. 1997; 1: 245-258Crossref PubMed Scopus (20) Google Scholar) was changed from CTTATC to CTTAAA. The LGSΔN vector was derived by replacing the TKNeoR sequence in the SFCMM-3 vector (29Verzeletti S. Bonini C. Marktel S. Nobili N. Ciceri F. Traversari C. Bordignon C. Hum. Gene Ther. 1998; 9: 2243-2251Crossref PubMed Scopus (174) Google Scholar) with the 730-bp Eco47III-ScaI EGFP fragment from pEGFP-C3 (Clontech). HS2·LGSΔN was obtained by cloning the BamHI 200-bp GATA-1 HS2 cassette (19Grande A. Piovani B. Aiuti A. Ottolenghi S. Mavilio F. Ferrari G. Blood. 1999; 93 (and references therein): 3276-3285Crossref PubMed Google Scholar) into the SalI/BglII sites of LGSΔN, whereas ΔHS1·HS2·LGSΔN was derived by ClaI/NdeI digestion of the ΔHS1·HS2 elements from the ΔHS1·HS2·SFCM vector and cloning into ClaI/NdeI sites of LGSΔN. Cells—GATA-1 ts Epo bone marrow (BM) and GATA-1 ts Epo YS (yolk sac) are erythropoietin (Epo)-dependent immortalized hematopoietic progenitors derived from bone marrow and yolk sac of mice transgenic for a mutant SV40 T gene encoding a thermosensitive T protein driven by the GATA-1 promoter linked to either the HS2 or the HS1 sites, respectively (11Cairns L.A. Crotta S. Minuzzo M. Moroni E. Granucci F. Nicolis S. Schiro R. Pozzi L. Giglioni B. Ricciardi-Castagnoli P. Ottolenghi S. EMBO J. 1994; 13: 4577-4586Crossref PubMed Scopus (24) Google Scholar, 30Cairns L. Cirò M. Minuzzo M. Morlé F. Starck J. Ottolenghi S. Ronchi A. J. Cell. Physiol. 2003; 195: 38-49Crossref PubMed Scopus (5) Google Scholar). 2L. Cairns, S. Ottolenghi, and A. Ronchi, unpublished data. These cells grow at 32 °C, the permissive temperature for the thermosensitive T protein with a doubling time of 20-24 h, in RPMI 1640, 10% fetal calf serum (FCS), 0.3 unit/ml Epo. Transduction of Mouse and Human Cell Lines—For transduction of mouse cells, packaging lines for SFCM vectors were obtained by plasmid transfection of the ecotropic line GP+E86 (31Markowitz D. Goff S. Bank A. J. Virol. 1988; 62: 1120-1124Crossref PubMed Google Scholar) and selection in 0.8 mg/ml G418. For viral infections, subconfluent packaging lines were treated with mitomycin C (1 μg/ml) for 3 h at 37 °C, carefully washed, and replated (1 × 106 cells) into 6-cm diameter dishes in 3 ml of RPMI 1640, 10% FCS. The next day, 0.6-1 × 106 mouse hematopoietic cells in 1 ml of complete Epo-containing medium were added to each dish and grown for 24 h at 32 °C. The hematopoietic cells growing in suspension were collected, washed, and grown for 2 days prior to selection. G418 was then added at 0.8 mg/ml, and resistant cells were obtained within 10-15 days. Selected cells were then analyzed by flow cytometry (see below). For each infection, the copy number of constructs integrated within the resistant cells was evaluated by Southern blotting by using a probe for the neomycin resistance gene and checked for equal loading by further probing with a genomic fragment downstream of the GATA-1 locus. The copy numbers were essentially identical between all samples and close to one integration (on average) per cell (as determined by comparison with serial dilutions of appropriately digested viral DNA mixed with genomic DNA of non-infected cells). NIH3T3 cells were grown in Dulbecco’s medium (Invitrogen) supplemented with 10% FCS (Hyclone) and infected for 16 h with undiluted viral supernatants containing 8 μg/ml Polybrene (Sigma). Further analyses were carried out on transduced and control bulk cultures. For transduction of human cells viral stocks were produced by transient transfection of Phoenix-Ampho cells as described previously (32Kinsella T.M. Nolan G.P. Hum. Gene Ther. 1996; 7: 1405-1413Crossref PubMed Scopus (672) Google Scholar). Human erythroblastic K562 and HEL cell lines (ATCC) were grown in RPMI 1640 (Invitrogen) supplemented with 10% FCS and transduced by spinoculation (33Sanyal A. Schuening F.G. Hum. Gene Ther. 1999; 10: 2859-2868Crossref PubMed Scopus (15) Google Scholar) in the presence of Polybrene (8 μg/ml). For transduction of mouse hematopoietic cells with LSGΔN and MΔN viral stocks, spinoculation was used as above. FACS Analysis—Expression of the reporter gene (ΔLNGFr) was monitored by flow cytometry (FACScan, BD Biosciences) using the murine anti-human p75-NGFr monoclonal antibody 20-4 (ATCC). A goat monoclonal anti-mouse IgG (Fab-specific) conjugated to fluorescein isothiocyanate or phycoerythrin was used as secondary antibody (Pharmingen). An “In Vivo” Footprint in GATA HS1—DNA fragments from the HS1 region of the mouse GATA-1 gene have been shown previously to have enhancer activity, when linked to the GATA-1 promoter alone or in combination with HS2 and other GATA-1 regulatory elements, in transient transfections, and in transgenic assays (13McDevitt M.A. Fujiwara Y. Shivdasani R.A. Orkin S.H. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 7976-7981Crossref PubMed Scopus (84) Google Scholar, 14Ronchi A. Ciro M. Cairns L. Basilico L. Corbella P. Ricciardi-Castagnoli P. Cross M. Ghysdael J. Ottolenghi S. Genes Funct. 1997; 1: 245-258Crossref PubMed Scopus (20) Google Scholar, 15Vyas P. McDevitt M.A. Cantor A.B. Katz S.G. Fujiara Y. Orkin S.H. Development. 1999; 12: 2799-2811Crossref Google Scholar, 16Nishimura S. Takahashi S. Kuroha T. Suwabe N. Nagasawa T. Trainor C. Yamamoto M. Mol. Cell. Biol. 2000; 20: 713-723Crossref PubMed Scopus (100) Google Scholar). The activity of HS1 is totally dependent on a strong GATA-1-binding site (14Ronchi A. Ciro M. Cairns L. Basilico L. Corbella P. Ricciardi-Castagnoli P. Cross M. Ghysdael J. Ottolenghi S. Genes Funct. 1997; 1: 245-258Crossref PubMed Scopus (20) Google Scholar, 15Vyas P. McDevitt M.A. Cantor A.B. Katz S.G. Fujiara Y. Orkin S.H. Development. 1999; 12: 2799-2811Crossref Google Scholar, 16Nishimura S. Takahashi S. Kuroha T. Suwabe N. Nagasawa T. Trainor C. Yamamoto M. Mol. Cell. Biol. 2000; 20: 713-723Crossref PubMed Scopus (100) Google Scholar) that appears to be occupied in vivo, as indicated by in vivo footprinting (14Ronchi A. Ciro M. Cairns L. Basilico L. Corbella P. Ricciardi-Castagnoli P. Cross M. Ghysdael J. Ottolenghi S. Genes Funct. 1997; 1: 245-258Crossref PubMed Scopus (20) Google Scholar). To identify additional functional motifs within HS1, we further extended the dimethyl sulfate (DMS) in vivo footprinting analysis of HS1 (Fig. 1A). Transcription factors bound to specific DNA sequences protect guanines from in vivo DMS-induced methylation and thus from subsequent in vitro piperidine cleavage of the methylated sites. The following ligation-mediated PCR results in the absence of bands at the positions corresponding to the guanines protected “in vivo” (24Becker P.B. Weih F. Schutz G. Methods Enzymol. 1993; 218: 568-587Crossref PubMed Scopus (8) Google Scholar, 25Quivy J.P. Becker P.B. Nucleic Acids Res. 1993; 21: 2779-2781Crossref PubMed Scopus (22) Google Scholar). Fig. 1B shows that six guanines (lower strand) within an 11-nt sequence between positions 59 and 69 of HS1 are footprinted “in vivo” in hematopoietic mouse erythroleukemia cells (MEL) grown in culture; a weaker footprint is also detected on the CACCC motif between positions 78 and 82 (not shown). In Vitro Binding Studies of the Footprinted Region—To better characterize proteins responsible for the in vivo footprint, we performed EMSA. A 32P-labeled oligonucleotide (wt, see “Experimental Procedures”) spanning from nt 46 to 96 generates a complex pattern consisting of an intense slow band and additional faster bands in the presence of nuclear extracts from the hematopoietic cell lines: human K562 erythroleukemia cells, murine GATA-1 ts Epo BM, and GATA-1 ts Epo YS cells (30Cairns L. Cirò M. Minuzzo M. Morlé F. Starck J. Ottolenghi S. Ronchi A. J. Cell. Physiol. 2003; 195: 38-49Crossref PubMed Scopus (5) Google Scholar), (Fig. 2); however, when an oligonucleotide deleted between nucleotides 59 and 69 (Δ59-69)is used, one of these bands is clearly missing (Fig. 2B, arrow, compare lanes 1 and 2). The protein responsible for this band will be called from now on the GATA-1 HS1 “in vivo footprinting protein” (IVFP). As expected, unlabeled oligonucleotides including a CACCC box sequence from the human β-globin gene and the GC-rich region (positions 81-111) from the HS1 itself compete all bands, with the exception of the IVFP band (Fig. 2B, lanes 3 and 4 and lanes 7 and 8); an unrelated control oligonucleotide has no effect (lanes 5 and 6). We further tested two additional oligonucleotides (Fig. 2): “core mutant” carries mutations centered on nucleotides involved in the in vivo footprint, whereas the “5′ mutant” is mutated at the upstream border of the footprinted region (see “Experimental Procedures” for sequences). The mutation in oligonucleotide core mutant (Fig. 2B, lane 4) has the same effect as the deletion of nucleotides 59-69, i.e. loss of IVFP binding, whereas the upstream mutation in oligonucleotide 5′ mutant does not significantly affect IVFP binding (Fig. 2B, lane 3). To better resolve the IVFP band, we used in EMSA experiments poly(dC·dG) as a competitor, instead of poly(dI·dC) (Fig. 2B, lanes 5-18). Under these conditions, only the IVFP band is visible (lane 5) with the wt oligonucleotide and is efficiently competed by the unlabeled wt oligonucleotide itself (Fig. 2B, lanes 6-8) and by the 5′ mutant oligonucleotide (lanes 12-14) but not by the deleted (lanes 9-11) or core mutant (lanes 15-17) oligonucleotides. The IVFP protein appears to be relatively widespread, although its amount varies between different cell types. In particular, it is expressed in both mouse and human cells, particularly in human K562 and mouse erythroleukemia MEL cells, in SV40-T immortalized bone marrow (GATA-1 ts Epo, BM) and yolk sac (GATA-1 ts Epo, YS) erythropoietin-dependent cells (11Cairns L.A. Crotta S. Minuzzo M. Moroni E. Granucci F. Nicolis S. Schiro R. Pozzi L. Giglioni B. Ricciardi-Castagnoli P. Ottolenghi S. EMBO J. 1994; 13: 4577-4586Crossref PubMed Scopus (24) Google Scholar, 30Cairns L. Cirò M. Minuzzo M. Morlé F. Starck J. Ottolenghi S. Ronchi A. J. Cell. Physiol. 2003; 195: 38-49Crossref PubMed Scopus (5) Google Scholar),2 and in lymphoid cells (CH27, A20, and BAF3) (Fig. 2C and data not shown). By using mutant oligonucleotides with these extracts, we obtained results similar to those shown for K562 (data not shown). HS1 DNA Sequences Co-operate with HS2 in Retrovirally Mediated Gene Expression in Hematopoietic Cells—To analyze functional effects of the HS1 DNA sequences, we used a modified SFCM retroviral vector, as described previously (19Grande A. Piovani B. Aiuti A. Ottolenghi S. Mavilio F. Ferrari G. Blood. 1999; 93 (and references therein): 3276-3285Crossref PubMed Google Scholar). In this vector, the Moloney-leukemia virus enhancer in the 3′-LTR is deleted (Δ·SFCM) and can be replaced by an exogenous enhancer; following retroviral infection of the target cells, the new enhancer is moved to the 5′-LTR from which it drives retroviral transcription and expression of a truncated form of nerve growth factor receptor (ΔLNGFr), a reporter gene. In addition, an internal SV40 promoter drives the expression of a neomycin resistance gene (Fig. 3A). Our strategy was therefore to infect in vitro hematopoietic cell lines with appropriate constructs and to select cells expressing the neo-resistance gene by G418 treatment. Following complete selection, the proportion of expressing cells and levels of expression were analyzed by fluorescence-activated cell sorting (FACS). The copy number of integrated constructs was examined by Southern blotting using a neo-resistance probe (for the detection of the retroviral DNA) and a GATA-1 3′ genomic probe for detection of an endogenous gene and normalization. The copy numbers were very similar between the various constructs and close to 1 copy per cell, as expected for the relatively low probability of infection in these experiments (between 25 and 50% of cells transduced). For these experiments, we primarily used two cell lines, GATA-1 ts Epo (BM) and GATA-1 ts Epo (YS) (11Cairns L.A. Crotta S. Minuzzo M. Moroni E. Granucci F. Nicolis S. Schiro R. Pozzi L. Giglioni B. Ricciardi-Castagnoli P. Ottolenghi S. EMBO J. 1994; 13: 4577-4586Crossref PubMed Scopus (24) Google Scholar, 30Cairns L. Cirò M. Minuzzo M. Morlé F. Starck J. Ottolenghi S. Ronchi A. J. Cell. Physiol. 2003; 195: 38-49Crossref PubMed Scopus (5) Google Scholar),2 which represent erythropoietin-dependent multipotent cells derived from bone marrow and yolk sac cells immortalized in vitro by SV40 T-antigen (driven by a transgenic GATA-1 promoter linked to HS2 or HS1 respectively). These cells are 95-100% positive for endogenous GATA-1 (based on nuclear immunofluorescence tests) (30Cairns L. Cirò M. Minuzzo M. Morlé F. Starck J. Ottolenghi S. Ronchi A. J. Cell. Physiol. 2003; 195: 38-49Crossref PubMed Scopus (5) Google Scholar) and are thus expected to express foreign constructs depending on GATA regulatory elements. In a first series of experiments (Fig. 3B), we compared the activities of retroviral constructs (HS1·SFCM and HS2·SFCM) containing HS1 or HS2 as the foreign enhancer replacing the original Moloney enhancer. The mean fluorescence intensity (MFI) of cells infected with the wild type SFCM is given as 100% activity. The MFI of each construct is given below as percentage of activity relative to that of the
The GATA‐1 gene encodes a transcription factor expressed in early multipotent haemopoietic progenitors, in more mature cells of the erythroid, megakaryocytic and other lineages, but not in late myeloid precursors; its function is essential for the normal development of the erythroid and megakaryocytic system. To define regulatory elements of the mouse GATA‐1 gene, we mapped DNaseI‐hypersensitive sites in nuclei of erythroid and haemopoietic progenitor cells. Five sites were detected. The two upstream sites, site 1 and site 2, represent a new and a previously defined erythroid enhancer respectively. The site 1 enhancer activity depends both on a GATA‐binding site (also footprinted in vivo ) and on several sites capable of binding relatively ubiquitous factors. A DNA fragment encompassing site 1, placed upstream of a GATA‐1 minimal promoter, is able to drive expression of a simian virus 40 (SV40) T‐antigen in the yolk sac, but not bone‐marrow cells, obtained from mice transgenic for this construct, allowing in vitro establishment of immortalized yolk‐sac cells. A similar construct including site 2, instead of site 1, and previously shown to be able to immortalize adult marrow cells is not significantly active in yolk‐sac cells. Sites 4 and 5, located in the first large intron, have no enhancer activity; they include a long array of potential Ets‐binding sites. Mnl I restriction sites, overlapping some of the Ets sites, are highly accessible, in intact nuclei, to Mnl I. Although these sites are present in all GATA‐1‐expressing cells studied, they are the only strong sites detectable in FDCP‐mix multipotent progenitor cells, most of which do not yet express GATA‐1. The data indicate that appropriate GATA‐1 regulation may require the co‐operation of different regulatory elements acting at different stages of development and cell differentiation.
We investigated the mechanism whereby expression of a transgene encoding a locally acting isoform of insulin-like growth factor 1 (mIGF-1) enhances repair of skeletal muscle damage. Increased recruitment of proliferating bone marrow cells to injured MLC / mIgf-1 transgenic muscles was accompanied by elevated bone marrow stem cell production in response to distal trauma. Regenerating MLC / mIgf-1 transgenic muscles contained increased cell populations expressing stem cell markers, exhibited accelerated myogenic differentiation, expressed markers of regeneration and readily converted cocultured bone marrow to muscle. These data implicate mIGF-1 as a powerful enhancer of the regeneration response, mediating the recruitment of bone marrow cells to sites of tissue damage and augmenting local repair mechanisms.
